Dataset for CDS E1B19K of organism Human adenovirus C serotype 1

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q71BY5_E1B19K-01      atga----------------gacatatt---------------atttgcc
Q71BY5_E1B19K-02      atggaggcttgggagtgtttggaagatttttctgctgtgcgtaacttgct
                      ***                 *  * ***               * **** 

Q71BY5_E1B19K-01      a------------------------------cggaggtgtt---------
Q71BY5_E1B19K-02      ggaacagagctctaacagtacctcctggttttggaggtttctgtggggct
                                                      ****** *          

Q71BY5_E1B19K-01      ------------------------------------attac---------
Q71BY5_E1B19K-02      cctcccaagcaaagttagtctgcagaattaaggaggattacaagtgggaa

Q71BY5_E1B19K-01      --------------------------------------------------
Q71BY5_E1B19K-02      tttgaagagcttttgaaatcctgtggtgagctgtttgattctttgaatct

Q71BY5_E1B19K-01      ------------------cgaagaaatggccgccagtcttttgga-----
Q71BY5_E1B19K-02      gggtcaccaggcgcttttccaagagaaggtcatcaagactttggattttt
                                        * **** * ** *  **    ******     

Q71BY5_E1B19K-01      --------------------------------------------------
Q71BY5_E1B19K-02      ccacaccggggcgcgctgcggctgctgttgcttttttgagttttataaag

Q71BY5_E1B19K-01      --------------------ccagctaatcgaagaggtcctg------tg
Q71BY5_E1B19K-02      gataaatggagcgaagaaacccatctgagcggggggtacctgctggattt
                                          *** ** * **  * *  ****      * 

Q71BY5_E1B19K-01      tctgaacctgagcct-----gagc--------------------------
Q71BY5_E1B19K-02      tctggccatgcatttgtggagagcggtggtgagacacaagaatcgcctac
                      ****  * **    *     ****                          

Q71BY5_E1B19K-01      --------------------------------ccgagccagaaccggaac
Q71BY5_E1B19K-02      tactgttgtcttccgtccgcccggcaataataccgacggaggagcagcag
                                                      ****   ** * * * * 

Q71BY5_E1B19K-01      ctgcaagacctgcc----------------------cggcgtcctaaa--
Q71BY5_E1B19K-02      cagcaacagcagcagcaggaggaagccaggcggcggcggcggcaggagca
                      * **** * * **                       ***** *   *   

Q71BY5_E1B19K-01      ------atggtgcctgctatcc------------------tga
Q71BY5_E1B19K-02      gagcccatggaacccgagagccggcctggaccctcgggaatga
                            ****  ** *  * **                  ***

© 1998-2020Legal notice