Dataset for CDS E1B19K of organism Human adenovirus C serotype 1

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q71BY5_E1B19K-01        at-gagacat---attatttgccacggaggtgttattacc----------
Q71BY5_E1B19K-02        at-gagacat---attatttgccacggaggtgttattacc----------
Q71BY5_E1B19K-03        at-gagacat---attatttgccacggaggtgttattacc----------
Q71BY5_E1B19K-04        atggaggcttgggagtgtttg----gaagatttttctgctgtgcgtaact
A0A5K6WAR5_E1B19K-      atggaggcttgggagtgtttg----gaagatttttttgctgtgcgtaact
A0A7D6TSN5_E1B19K-      atggaggcttgggagtgtttg----gaagatttttctgctgtgcgtaact
                        ** *** * *   * * ****    * ** * **  * *           

Q71BY5_E1B19K-01        -----gaagaaatggccgccagtcttttggaccagctaatcgaagaggta
Q71BY5_E1B19K-02        -----gaagaaatggccgccagtcttttggaccagctaatcgaagaggta
Q71BY5_E1B19K-03        -----gaagaaatggccgccagtcttttggaccagctaatcgaagag---
Q71BY5_E1B19K-04        tgctggaacagagctctaacagt-------acctcctggttttggaggtt
A0A5K6WAR5_E1B19K-      tactggaacagagctctaacagt-------acctcttggttttggaggtt
A0A7D6TSN5_E1B19K-      tgctggaacagagctctaacagt-------acctcttggttttggaggtt
                             *** * *   *   ****       ***   *  *    ***   

Q71BY5_E1B19K-01        ctggctgataatcttccacctcctagccattttgaaccacctacccttca
Q71BY5_E1B19K-02        ctggctgataatcttccacctcctagccattttgaaccacctacccttca
Q71BY5_E1B19K-03        --------------------------------------------------
Q71BY5_E1B19K-04        tctgtgggg-------ctcctcccaagcaaagttagt-------------
A0A5K6WAR5_E1B19K-      tctgtgggg-------ctcctcccaggcaaagttagt-------------
A0A7D6TSN5_E1B19K-      tctgtgggg-------ctcctcccaggcaaagttagt-------------

Q71BY5_E1B19K-01        cgaactgtatgatttagacgtgacggcccccgaagatcccaacgaggagg
Q71BY5_E1B19K-02        cgaactgtatgatttagacgtgacggcccccgaagatcccaacgaggagg
Q71BY5_E1B19K-03        --------------------------------------------------
Q71BY5_E1B19K-04        ----ctgcagaattaag--------------gaggattacaagtgggaa-
A0A5K6WAR5_E1B19K-      ----ctgcagaattaag--------------gaggattacaagtgggaa-
A0A7D6TSN5_E1B19K-      ----ctgcagaattaag--------------gaggattacaagtgggaa-

Q71BY5_E1B19K-01        cggtttcgcagatttttcctgactctgtaatgttggcggcgcaggaaggg
Q71BY5_E1B19K-02        cggtttcgcagatttttcctgactctgtaatgttggcggcgcaggaaggg
Q71BY5_E1B19K-03        --------------------------------------------------
Q71BY5_E1B19K-04        ----tttgaagagcttttgaaatcctgtggtg------------------
A0A5K6WAR5_E1B19K-      ----tttgaagagcttttgaaatcctgtggtg------------------
A0A7D6TSN5_E1B19K-      ----tttgaagagcttttgaaatcctgtggtg------------------

Q71BY5_E1B19K-01        attgacttactcacttttccgccggcgcccggttctccggagccgcctca
Q71BY5_E1B19K-02        attgacttactcacttttccgccggcgcccggttctccggagccgcctca
Q71BY5_E1B19K-03        --------------------------------------------------
Q71BY5_E1B19K-04        ----------------------agctgtttgattctttgaatctgggtca
A0A5K6WAR5_E1B19K-      ----------------------agctgtttgattctttgaatctgggtca
A0A7D6TSN5_E1B19K-      ----------------------agctgtttgattctttgaatctgggtca

Q71BY5_E1B19K-01        cctttcccggcagcccgagcagccggagcagagagccttgggtccggttt
Q71BY5_E1B19K-02        cctttcccggcagcccgagcagccggagcagagagccttgggtccggttt
Q71BY5_E1B19K-03        --------------------------------------------------
Q71BY5_E1B19K-04        ccaggc---gcttttccaagagaaggtcatcaagactttggatt---ttt
A0A5K6WAR5_E1B19K-      ccaggc---gcttttccaagagaaggtcatcaagactttggatt---ttt
A0A7D6TSN5_E1B19K-      ccaggc---gcttttccaagagaaggtcatcaagactttggatt---ttt

Q71BY5_E1B19K-01        ctatgccaaaccttgtaccggaggtgatcgatcttacctgccacgaggct
Q71BY5_E1B19K-02        ctatgccaaaccttgtaccggaggtgatcgatcttacctgccacgaggct
Q71BY5_E1B19K-03        --------------------------------------------------
Q71BY5_E1B19K-04        ccacaccggggcgcgctgcggctgctgttgctttt---------------
A0A5K6WAR5_E1B19K-      ccacaccggggcgcgctgcggctgctgttgctttt---------------
A0A7D6TSN5_E1B19K-      ccacaccggggcgcgctgcggctgctgttgctttt---------------

Q71BY5_E1B19K-01        ggctttccacccagtgacgacgaggatgaagagggtgaggagtttgtgtt
Q71BY5_E1B19K-02        ggctttccacccagtgacgacgaggatgaagagg----------------
Q71BY5_E1B19K-03        --------------------------------------------------
Q71BY5_E1B19K-04        ---------ttgagttttataaaggataaatggagcgaagaa--------
A0A5K6WAR5_E1B19K-      ---------ttgagttttataaaggataaatggagcgaagaa--------
A0A7D6TSN5_E1B19K-      ---------ttgagttttataaaggataaatggagcgaagaa--------

Q71BY5_E1B19K-01        agattatgtggagcagcccgggcacggttgcaggtcttgtcattatcatc
Q71BY5_E1B19K-02        --------------------------------------------------
Q71BY5_E1B19K-03        --------------------------------------------------
Q71BY5_E1B19K-04        --------------------------------------------------
A0A5K6WAR5_E1B19K-      --------------------------------------------------
A0A7D6TSN5_E1B19K-      --------------------------------------------------

Q71BY5_E1B19K-01        ggaggaatacgggggacccagatattatgtgttcgctttgctatatgagg
Q71BY5_E1B19K-02        --------------------------------------------------
Q71BY5_E1B19K-03        --------------------------------------------------
Q71BY5_E1B19K-04        --------------------------------------------------
A0A5K6WAR5_E1B19K-      --------------------------------------------------
A0A7D6TSN5_E1B19K-      --------------------------------------------------

Q71BY5_E1B19K-01        acctgtggcatgtttgtctacagtcctgtgtctgaacctgagcctgagcc
Q71BY5_E1B19K-02        ----------------------gtcctgtgtctgaacctgagcctgagcc
Q71BY5_E1B19K-03        ----------------------gtcctgtgtctgaacctgagcctgagcc
Q71BY5_E1B19K-04        ----------------------accc---------atctgagcgggg---
A0A5K6WAR5_E1B19K-      ----------------------accc---------atttgagcgggg---
A0A7D6TSN5_E1B19K-      ----------------------accc---------atctgagcgggg---
                                                **         *  *****  *    

Q71BY5_E1B19K-01        cgagccagaaccggaacctgcaagacctgcccggcgtcctaaaatggtgc
Q71BY5_E1B19K-02        cgagccagaaccggaacctgcaagacctgcccggcgtcctaaaatggtgc
Q71BY5_E1B19K-03        cgagccagaaccggaacctgcaagacctgcccggcgtcctaaaatggtgc
Q71BY5_E1B19K-04        ------------ggtacctgctggattttctggccatgcatttgtggaga
A0A5K6WAR5_E1B19K-      ------------ggtacctgctggattttctggccatgcatctgtggaga
A0A7D6TSN5_E1B19K-      ------------ggtacctgctggattttctggccatgcatctgtggaga
                                    ** ******  **  * *  * * * *     *** * 

Q71BY5_E1B19K-01        ctgctatcctgagacgcccgacatcacctgtgtccagagaatgcaatagt
Q71BY5_E1B19K-02        ctgctatcctgagacgcccgacatcacctgtgtccagagaatgcaatagt
Q71BY5_E1B19K-03        ctgctatcctga--------------------------------------
Q71BY5_E1B19K-04        --gcggtggtgagacacaaga-atcgcctac-------------------
A0A5K6WAR5_E1B19K-      --gcggtggtgagacacaaga-atcgcctgc-------------------
A0A7D6TSN5_E1B19K-      --gcggtggtgagacacaaga-atcgcctgc-------------------
                          **  *  ***                                      

Q71BY5_E1B19K-01        agtacggatagctgtgactccggtccttctaacacacctcctgagataca
Q71BY5_E1B19K-02        agtacggatagctgtgactccggtccttctaacacacctcctgagataca
Q71BY5_E1B19K-03        --------------------------------------------------
Q71BY5_E1B19K-04        --------tactgttgtcttccgtccgcccggca--------ataatacc
A0A5K6WAR5_E1B19K-      --------tactgttgtcttccgtccgcccggca--------ataatacc
A0A7D6TSN5_E1B19K-      --------tactgttgtcttccgtccgcccggca--------ataatacc

Q71BY5_E1B19K-01        tccggtggtcccgctgtgccccattaaaccagttgccgtgagagttggtg
Q71BY5_E1B19K-02        tccggtggtcccgctgtgccccattaaaccagttgccgtgagagttggtg
Q71BY5_E1B19K-03        --------------------------------------------------
Q71BY5_E1B19K-04        gacggagg---agcagc----------agcagcaacagcagcagcaggag
A0A5K6WAR5_E1B19K-      gacggagg----------------------agcagcagcagcagcaggag
A0A7D6TSN5_E1B19K-      gacggaggagcagcagc----------agcagcagcagcagcagcaggag

Q71BY5_E1B19K-01        ggcgtcgccgggctgtggaatgtatcgaggacttgcttaacgagcctggg
Q71BY5_E1B19K-02        ggcgtcgccgggctgtggaatgtatcgaggacttgcttaacgagcctggg
Q71BY5_E1B19K-03        --------------------------------------------------
Q71BY5_E1B19K-04        gaagcca---ggcggcggcggcggcaggagcagagcccatggaacccgag
A0A5K6WAR5_E1B19K-      gaagcca---ggcggcggcggcggcaggagcagagcccatggaacccgag
A0A7D6TSN5_E1B19K-      gaagccaggcggcggcggcggcggcaggagcagagcccatggaacccgag

Q71BY5_E1B19K-01        caacctttggacttgagctgtaaacgccccaggccataa
Q71BY5_E1B19K-02        caacctttggacttgagctgtaaacgccccaggccataa
Q71BY5_E1B19K-03        ---------------------------------------
Q71BY5_E1B19K-04        agcc----ggcctgga----------ccctcgggaatga
A0A5K6WAR5_E1B19K-      agcc----ggcctgga----------ccctcgggaatga
A0A7D6TSN5_E1B19K-      agcc----ggcctgga----------ccctcgggaatga

© 1998-2022Legal notice