Dataset for CDS E1B19K of organism Human adenovirus B serotype 3

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q2KSL3_E1B19K-01      atgga-----------------------------ggtttgggct------
Q2Y0J3_E1B19K-01      atgga-----------------------------ggtttgggct------
Q2KSL3_E1B19K-02      atggatccgccaaactcacttcagcaagggatacgttttggatttcatag
Q2Y0J3_E1B19K-02      atggatccgccaaactcacttcagcaagggatacgttttggatttcatag
                      *****                             * *****  *      

Q2KSL3_E1B19K-01      ----------------atcttggaagac-ctcagacaga--------cta
Q2Y0J3_E1B19K-01      ----------------atcttggaagac-ctcagacaga--------cta
Q2KSL3_E1B19K-02      cagcagctttgtggagaacatggaaggctcgcaggatgaggacaatctta
Q2Y0J3_E1B19K-02      cagcagctttgtggagaacatggaaggctcgcaggatgaggacaatctta
                                      * * ****** * * ***   **         **

Q2KSL3_E1B19K-01      ggctactgctagaaaacgcctcggacggagtctctggcctttggaga---
Q2Y0J3_E1B19K-01      agctactgctagaaaacgcctcggacggagtctctggcctttggaga---
Q2KSL3_E1B19K-02      gattactggccagtgcagcctctg--ggagtagcagggatactgagacac
Q2Y0J3_E1B19K-02      gattactggccagtgcagcctctg--ggagtagcagggatactgagacac
                         *****         ***** *  *****  * **  *   ****   

Q2KSL3_E1B19K-01      -------------------ttctg--------------------------
Q2Y0J3_E1B19K-01      -------------------ttctg--------------------------
Q2KSL3_E1B19K-02      ccaccgaccatgccagcggttctgcaggaggagcagcaggaggacaatcc
Q2Y0J3_E1B19K-02      ccaccgaccatgccagcggttctgcaggaggagcagcaggaggacaatcc
                                         *****                          

Q2KSL3_E1B19K-01      -----------------gttcggtggtgatctagcta-------------
Q2Y0J3_E1B19K-01      -----------------gttcggtggtgatctagcta-------------
Q2KSL3_E1B19K-02      gagagccggcctggaccctccggtggaggagtagctgacctgtttcctga
Q2Y0J3_E1B19K-02      gagagccggcctggaccctccggtggaggagtagctgacctgtttcctga
                                        * ****** *   *****              

Q2KSL3_E1B19K-01      -----ggctagtgttta-----------------ggataaaacagga---
Q2Y0J3_E1B19K-01      -----ggctagtgttta-----------------ggataaaacagga---
Q2KSL3_E1B19K-02      actgcgacgggtgcttactaggtctacaaccagtggacagaacaggggca
Q2Y0J3_E1B19K-02      actgcgacgggtgcttactaggtctacgaccagtggacagaacaggggaa
                           * *  *** ***                 *** * ******    

Q2KSL3_E1B19K-01      ------------------ctacagggaagaatttga--------------
Q2Y0J3_E1B19K-01      ------------------ctacagggaagaatttga--------------
Q2KSL3_E1B19K-02      ttaagagggagaggaatcctagtgggaacaattcaagaaccgagttggct
Q2Y0J3_E1B19K-02      ttaagagggagaggaatcctagtgggaataattcaagaaccgagttggct
                                        ***  ***** ****  *              

Q2KSL3_E1B19K-01      --aaagttattggacgacag----tccaggactttt--------------
Q2Y0J3_E1B19K-01      --aaagttattggacgatag----tccgggactttt--------------
Q2KSL3_E1B19K-02      ttaagtttaatgagccgcaggcgtcctgaaactgtttggtggcatgaggt
Q2Y0J3_E1B19K-02      ttaagtttaatgagccgcaggcgtcctgaaactgtttggtggcatgaggt
                        **  *** **  *   **     *    *** **              

Q2KSL3_E1B19K-01      ------------------tgaagctcttaacttg----------------
Q2Y0J3_E1B19K-01      ------------------tgaagctcttaacttg----------------
Q2KSL3_E1B19K-02      tcagagcgaaggcagggatgaagtttcaatattgcaggagaaatattcac
Q2Y0J3_E1B19K-02      tcagagcgaaggcagggatgaagtttcaatattgcaggagaaatattcac
                                        ***** *   *  ***                

Q2KSL3_E1B19K-01      -------------------------------------------------g
Q2Y0J3_E1B19K-01      -------------------------------------------------g
Q2KSL3_E1B19K-02      tagaacaacttaagacctgttggttggaacctgaggatgattgggaggtg
Q2Y0J3_E1B19K-02      tagaacaacttaagacctgttggttggaacctgaggatgattgggaggtg
                                                                       *

Q2KSL3_E1B19K-01      gtcatcagg-ctcattttaag-----------------------------
Q2Y0J3_E1B19K-01      gtcatcagg-ctcattttaag-----------------------------
Q2KSL3_E1B19K-02      gccattaggaattatgctaagatatctctgaggcctgataaacaatatag
Q2Y0J3_E1B19K-02      gccattaggaattatgctaagatatctctgaggcctgataaacaatatag
                      * *** ***  * **  ****                             

Q2KSL3_E1B19K-01      -------gagaaggtt----------------------------------
Q2Y0J3_E1B19K-01      -------gagaaggtt----------------------------------
Q2KSL3_E1B19K-02      aattactaagaagattaatattagaaatgcatgctacatatcagggaatg
Q2Y0J3_E1B19K-02      aattactaagaagattaatattagaaatgcatgctacatatcagggaatg
                              ***** **                                  

Q2KSL3_E1B19K-01      --------------------------------------------------
Q2Y0J3_E1B19K-01      --------------------------------------------------
Q2KSL3_E1B19K-02      gggcagaggttataatagatacacaagataaagcagcttttagatgttgt
Q2Y0J3_E1B19K-02      gggcagaggttataatagatacacaagataaagcagtttttagatgttgt
                                                                        

Q2KSL3_E1B19K-01      ----------------------------------------------ttat
Q2Y0J3_E1B19K-01      ----------------------------------------------ttat
Q2KSL3_E1B19K-02      atgatgggtatgtggccaggggttgtcggcatggaagcagtaacacttat
Q2Y0J3_E1B19K-02      atgatgggtatgtggccaggggttgtcggcatggaagcagtaacacttat
                                                                    ****

Q2KSL3_E1B19K-01      cagttttagattt----------------------ttctactcctgg-ta
Q2Y0J3_E1B19K-01      cagttttagattt----------------------ttctactcctgg-ta
Q2KSL3_E1B19K-02      gaatattaggtttagaggggatgggtataatggcattgtatttatggcta
Q2Y0J3_E1B19K-02      gaatattaggtttaaaggggatgggtataatggcattgtatttatggcta
                       * * **** ***                      ** ** *  *** **

Q2KSL3_E1B19K-01      gaact--gctgct--------gctgtagcttttct---------------
Q2Y0J3_E1B19K-01      gaact--gctgct--------gctgtagcttttct---------------
Q2KSL3_E1B19K-02      acactaagctgattctacatggttgtagcttttttgggtttaataatacg
Q2Y0J3_E1B19K-02      acactaagctgattctacatggttgtagcttttttgggtttaataatacg
                        ***  **** *        * ********** *               

Q2KSL3_E1B19K-01      --------------------------------------tactttt-----
Q2Y0J3_E1B19K-01      --------------------------------------tactttt-----
Q2KSL3_E1B19K-02      tgtgtagaagcttgggggcaagttagtgtgaggggttgtagtttttatgc
Q2Y0J3_E1B19K-02      tgtgtagaagcttgggggcaagttagtgtgaggggttgtagtttttatgc
                                                            ** ****     

Q2KSL3_E1B19K-01      --------------------------------------------------
Q2Y0J3_E1B19K-01      --------------------------------------------------
Q2KSL3_E1B19K-02      atgctggattgcaacatcaggtagggtgaagagtcagttgtctgtaaaga
Q2Y0J3_E1B19K-02      atgctggattgcaacatcaggtagggtcaagagtcagttgtctgtgaaga
                                                                        

Q2KSL3_E1B19K-01      -----------------------------atattggataaat--------
Q2Y0J3_E1B19K-01      -----------------------------atattggataaat--------
Q2KSL3_E1B19K-02      aatgcatgtttgagagatgtaatcttggcatactgaatgaaggtgaagca
Q2Y0J3_E1B19K-02      aatgcatgtttgagagatgtaatcttggcatactgaatgaaggtgaagca
                                                   *** ** ** **         

Q2KSL3_E1B19K-01      -ggatccgcc---------------aaac--------tcacttcagcaag
Q2Y0J3_E1B19K-01      -ggatccgcc---------------aaac--------tcacttcagcaag
Q2KSL3_E1B19K-02      agggtccgccactgcgcggctacagaaactggctgcttcattctaataaa
Q2Y0J3_E1B19K-02      agggtccgccactgcgcagctacagaaactggctgcttcattctaataaa
                       ** ******               ****        *** *  *  ** 

Q2KSL3_E1B19K-01      gg---------------------atacg--ttttggat-ttcatagcagc
Q2Y0J3_E1B19K-01      gg---------------------atacg--ttttggat-ttcatagcagc
Q2KSL3_E1B19K-02      gggaaatgccagtgtaaagcataatatgatctgtggacattcggatgaga
Q2Y0J3_E1B19K-02      gggaaatgccagtgtgaagcataatatgatctgtggacattcggatgaga
                      **                     *** *   * ****  ***  *  ** 

Q2KSL3_E1B19K-01      agctttg------------------tggagaacatggaag----------
Q2Y0J3_E1B19K-01      agctttg------------------tggagaacatggaag----------
Q2KSL3_E1B19K-02      ggccttatcagatgctgacctgcgctggtggacattgcaatattcttgct
Q2Y0J3_E1B19K-02      ggccttatcagatgctgacctgcgctggtggacattgcaatattcttgct
                       ** **                   *** * **** * *           

Q2KSL3_E1B19K-01      ---------------------gctcgcagga-------------tgagga
Q2Y0J3_E1B19K-01      ---------------------gctcgcagga-------------tgagga
Q2KSL3_E1B19K-02      accgtgcatatcgtttcacatgcacgcaagaaatggcctgtatttgaaca
Q2Y0J3_E1B19K-02      accgtgcatatcgtttcacatgcacgcaaaaaatggcctgtatttgaaca
                                           ** ****  *             ***  *

Q2KSL3_E1B19K-01      caatcttagatta-------------------------------------
Q2Y0J3_E1B19K-01      caatcttagatta-------------------------------------
Q2KSL3_E1B19K-02      taatgt--gattaccaagtgcaccatgcacataggtggtcgcaggggaat
Q2Y0J3_E1B19K-02      taatgt--gattaccaagtgcaccatgcacataggtggtcgcaggggaat
                       *** *  *****                                     

Q2KSL3_E1B19K-01      --------ctggccagtgca------------------------------
Q2Y0J3_E1B19K-01      --------ctggccagtgca------------------------------
Q2KSL3_E1B19K-02      gtttatgccttaccagtgtaacatgaatcatgtgaaggtgatgttggaac
Q2Y0J3_E1B19K-02      gtttatgccttaccagtgtaacatgaatcatgtgaaggtaatgttggaac
                              **  ****** *                              

Q2KSL3_E1B19K-01      -----gcctc--------tgggagtagcagg-------------------
Q2Y0J3_E1B19K-01      -----gcctc--------tgggagtagcagg-------------------
Q2KSL3_E1B19K-02      cagatgccttttccagagtgagcttaacaggaatctttgatatgaatatt
Q2Y0J3_E1B19K-02      cagatgccttttccagagtgagcttaacaggaatctttgatatgaatatt
                           ****         ** *  ** ****                   

Q2KSL3_E1B19K-01      -----------gatactgagacacccaccgaccatgccagcggttc----
Q2Y0J3_E1B19K-01      -----------gatactgagacacccaccgaccatgccagcggttc----
Q2KSL3_E1B19K-02      caactatggaagatcctgagatatgatgacactaaaccaagggtgcgcgc
Q2Y0J3_E1B19K-02      caactatggaagatcctgagatatgatgacactaaaccaagggtgcgcgc
                                 *** ****** *       ** *  ***  *** *    

Q2KSL3_E1B19K-01      -------tgcaggaggag-------------cagcaggag----------
Q2Y0J3_E1B19K-01      -------tgcaggaggag-------------cagcaggag----------
Q2KSL3_E1B19K-02      atgcgaatgcggaggcaagcatgctagattccagccggtgtgcgtggatg
Q2Y0J3_E1B19K-02      atgcgaatgcggaggcaagcatgctagattccagccggtgtgcgtggatg
                             *** *  * *              **** ** *          

Q2KSL3_E1B19K-01      -----gacaatccgagagccg--------------gcctggacc------
Q2Y0J3_E1B19K-01      -----gacaatccgagagccg--------------gcctggacc------
Q2KSL3_E1B19K-02      tgactgaagacctgagacccgatcatttggtgcttgcctgcactggagcg
Q2Y0J3_E1B19K-02      tgactgaagacttgagacccgatcatttggtgcttgcctgcactggagcg
                           **  *   **** ***              ***** **       

Q2KSL3_E1B19K-01      --------ctccggtggaggag--------tag
Q2Y0J3_E1B19K-01      --------ctccggtggaggag--------tag
Q2KSL3_E1B19K-02      gagtttggttctagtggtgaagaaactgactaa
Q2Y0J3_E1B19K-02      gagttcggttctagtggtgaagaaactgactaa
                               **  **** * **        ** 

© 1998-2022Legal notice