Dataset for CDS E1B19K of organism Human adenovirus B serotype 3

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q2Y0J3_E1B19K-01        atgga-----------------------------ggtttgggct------
A0A8B0LCV0_E1B19K-      atgga-----------------------------ggtttgggct------
A0A8B0LD36_E1B19K-      atgga-----------------------------ggtttgggct------
A0A8B0LBX6_E1B19K-      atgga-----------------------------ggtttgggct------
A0A8B0L9Y2_E1B19K-      atgga-----------------------------ggtttgggct------
Q2KSL3_E1B19K-01        atgga-----------------------------ggtttgggct------
Q2KSL3_E1B19K-02        atggatccgccaaactcacttcagcaagggatacgttttggatttcatag
Q2Y0J3_E1B19K-02        atggatccgccaaactcacttcagcaagggatacgttttggatttcatag
                        *****                             * *****  *      

Q2Y0J3_E1B19K-01        ----------------atcttggaagac-ctcagacaga--------cta
A0A8B0LCV0_E1B19K-      ----------------atcttggaagac-ctcagacaga--------cta
A0A8B0LD36_E1B19K-      ----------------atcttggaagac-ctcagacaga--------cta
A0A8B0LBX6_E1B19K-      ----------------atcttggaagac-ctcagacaga--------cta
A0A8B0L9Y2_E1B19K-      ----------------atcttggaagac-ctcagacaga--------cta
Q2KSL3_E1B19K-01        ----------------atcttggaagac-ctcagacaga--------cta
Q2KSL3_E1B19K-02        cagcagctttgtggagaacatggaaggctcgcaggatgaggacaatctta
Q2Y0J3_E1B19K-02        cagcagctttgtggagaacatggaaggctcgcaggatgaggacaatctta
                                        * * ****** * * ***   **         **

Q2Y0J3_E1B19K-01        agctactgctagaaaacgcctcggacggagtctctggcctttggaga---
A0A8B0LCV0_E1B19K-      ggctactgctagaaaacgcctcggacggagtctctggtttttggaga---
A0A8B0LD36_E1B19K-      ggctactgctagaaaacgcctcggacggagtctctggcctttggaga---
A0A8B0LBX6_E1B19K-      ggctactgctagaaaacgcctcggacggagtctctggcctttggaga---
A0A8B0L9Y2_E1B19K-      ggctactgctagaaaacgcctcggacggagtctctggcctttggaga---
Q2KSL3_E1B19K-01        ggctactgctagaaaacgcctcggacggagtctctggcctttggaga---
Q2KSL3_E1B19K-02        gattactggccagtgcagcctctg--ggagtagcagggatactgagacac
Q2Y0J3_E1B19K-02        gattactggccagtgcagcctctg--ggagtagcagggatactgagacac
                           *****         ***** *  *****  * **  *   ****   

Q2Y0J3_E1B19K-01        -------------------ttctg--------------------------
A0A8B0LCV0_E1B19K-      -------------------ttctg--------------------------
A0A8B0LD36_E1B19K-      -------------------ttctg--------------------------
A0A8B0LBX6_E1B19K-      -------------------ttctg--------------------------
A0A8B0L9Y2_E1B19K-      -------------------ttctg--------------------------
Q2KSL3_E1B19K-01        -------------------ttctg--------------------------
Q2KSL3_E1B19K-02        ccaccgaccatgccagcggttctgcaggaggagcagcaggaggacaatcc
Q2Y0J3_E1B19K-02        ccaccgaccatgccagcggttctgcaggaggagcagcaggaggacaatcc
                                           *****                          

Q2Y0J3_E1B19K-01        -----------------gttcggtggtgatctagcta-------------
A0A8B0LCV0_E1B19K-      -----------------gttcggtggtgatctagcta-------------
A0A8B0LD36_E1B19K-      -----------------gttcggtggtgatctagcta-------------
A0A8B0LBX6_E1B19K-      -----------------gttcggtggtgatctagcta-------------
A0A8B0L9Y2_E1B19K-      -----------------gttcggtggtgatctagcta-------------
Q2KSL3_E1B19K-01        -----------------gttcggtggtgatctagcta-------------
Q2KSL3_E1B19K-02        gagagccggcctggaccctccggtggaggagtagctgacctgtttcctga
Q2Y0J3_E1B19K-02        gagagccggcctggaccctccggtggaggagtagctgacctgtttcctga
                                          * ****** *   *****              

Q2Y0J3_E1B19K-01        -----ggctagtgttta-----------------ggataaaacagga---
A0A8B0LCV0_E1B19K-      -----ggctagtgttta-----------------ggataaaacagga---
A0A8B0LD36_E1B19K-      -----ggctagtgttta-----------------ggataaaacagga---
A0A8B0LBX6_E1B19K-      -----ggctagtgttta-----------------ggataaaacagga---
A0A8B0L9Y2_E1B19K-      -----ggctagtgttta-----------------ggataaaacagga---
Q2KSL3_E1B19K-01        -----ggctagtgttta-----------------ggataaaacagga---
Q2KSL3_E1B19K-02        actgcgacgggtgcttactaggtctacaaccagtggacagaacaggggca
Q2Y0J3_E1B19K-02        actgcgacgggtgcttactaggtctacgaccagtggacagaacaggggaa
                             * *  *** ***                 *** * ******    

Q2Y0J3_E1B19K-01        ------------------ctacagggaagaatttga--------------
A0A8B0LCV0_E1B19K-      ------------------ctacagggaagaatttga--------------
A0A8B0LD36_E1B19K-      ------------------ctacagggaagaatttga--------------
A0A8B0LBX6_E1B19K-      ------------------ctacagggaagaatttga--------------
A0A8B0L9Y2_E1B19K-      ------------------ctacagggaagaatttga--------------
Q2KSL3_E1B19K-01        ------------------ctacagggaagaatttga--------------
Q2KSL3_E1B19K-02        ttaagagggagaggaatcctagtgggaacaattcaagaaccgagttggct
Q2Y0J3_E1B19K-02        ttaagagggagaggaatcctagtgggaataattcaagaaccgagttggct
                                          ***  ***** ****  *              

Q2Y0J3_E1B19K-01        --aaagttattggacgatag----tccgggactttt--------------
A0A8B0LCV0_E1B19K-      --aaagttattggacgacag----tccaggactttt--------------
A0A8B0LD36_E1B19K-      --aaagttattggacgacag----tccaggactttt--------------
A0A8B0LBX6_E1B19K-      --aaagttattggacgacag----tccaggactttt--------------
A0A8B0L9Y2_E1B19K-      --aaagttattggacgacag----tccaggactttt--------------
Q2KSL3_E1B19K-01        --aaagttattggacgacag----tccaggactttt--------------
Q2KSL3_E1B19K-02        ttaagtttaatgagccgcaggcgtcctgaaactgtttggtggcatgaggt
Q2Y0J3_E1B19K-02        ttaagtttaatgagccgcaggcgtcctgaaactgtttggtggcatgaggt
                          **  *** **  *   **     *    *** **              

Q2Y0J3_E1B19K-01        ------------------tgaagctcttaacttg----------------
A0A8B0LCV0_E1B19K-      ------------------tgaagctcttaacttg----------------
A0A8B0LD36_E1B19K-      ------------------tgaagctcttaacttg----------------
A0A8B0LBX6_E1B19K-      ------------------tgaagctcttaacttg----------------
A0A8B0L9Y2_E1B19K-      ------------------tgaagctcttaacttg----------------
Q2KSL3_E1B19K-01        ------------------tgaagctcttaacttg----------------
Q2KSL3_E1B19K-02        tcagagcgaaggcagggatgaagtttcaatattgcaggagaaatattcac
Q2Y0J3_E1B19K-02        tcagagcgaaggcagggatgaagtttcaatattgcaggagaaatattcac
                                          ***** *   *  ***                

Q2Y0J3_E1B19K-01        -------------------------------------------------g
A0A8B0LCV0_E1B19K-      -------------------------------------------------g
A0A8B0LD36_E1B19K-      -------------------------------------------------g
A0A8B0LBX6_E1B19K-      -------------------------------------------------g
A0A8B0L9Y2_E1B19K-      -------------------------------------------------g
Q2KSL3_E1B19K-01        -------------------------------------------------g
Q2KSL3_E1B19K-02        tagaacaacttaagacctgttggttggaacctgaggatgattgggaggtg
Q2Y0J3_E1B19K-02        tagaacaacttaagacctgttggttggaacctgaggatgattgggaggtg
                                                                         *

Q2Y0J3_E1B19K-01        gtcatcagg-ctcattttaag-----------------------------
A0A8B0LCV0_E1B19K-      gtcatcagg-ctcattttaag-----------------------------
A0A8B0LD36_E1B19K-      gtcatcagg-ctcattttaag-----------------------------
A0A8B0LBX6_E1B19K-      gtcatcagg-ctcattttaag-----------------------------
A0A8B0L9Y2_E1B19K-      gtcatcagg-ctcattttaag-----------------------------
Q2KSL3_E1B19K-01        gtcatcagg-ctcattttaag-----------------------------
Q2KSL3_E1B19K-02        gccattaggaattatgctaagatatctctgaggcctgataaacaatatag
Q2Y0J3_E1B19K-02        gccattaggaattatgctaagatatctctgaggcctgataaacaatatag
                        * *** ***  * **  ****                             

Q2Y0J3_E1B19K-01        -------gagaaggtt----------------------------------
A0A8B0LCV0_E1B19K-      -------gagaaggtt----------------------------------
A0A8B0LD36_E1B19K-      -------gagaaggtt----------------------------------
A0A8B0LBX6_E1B19K-      -------gagaaggtt----------------------------------
A0A8B0L9Y2_E1B19K-      -------gagaaggtt----------------------------------
Q2KSL3_E1B19K-01        -------gagaaggtt----------------------------------
Q2KSL3_E1B19K-02        aattactaagaagattaatattagaaatgcatgctacatatcagggaatg
Q2Y0J3_E1B19K-02        aattactaagaagattaatattagaaatgcatgctacatatcagggaatg
                                ***** **                                  

Q2Y0J3_E1B19K-01        --------------------------------------------------
A0A8B0LCV0_E1B19K-      --------------------------------------------------
A0A8B0LD36_E1B19K-      --------------------------------------------------
A0A8B0LBX6_E1B19K-      --------------------------------------------------
A0A8B0L9Y2_E1B19K-      --------------------------------------------------
Q2KSL3_E1B19K-01        --------------------------------------------------
Q2KSL3_E1B19K-02        gggcagaggttataatagatacacaagataaagcagcttttagatgttgt
Q2Y0J3_E1B19K-02        gggcagaggttataatagatacacaagataaagcagtttttagatgttgt
                                                                          

Q2Y0J3_E1B19K-01        ----------------------------------------------ttat
A0A8B0LCV0_E1B19K-      ----------------------------------------------ttat
A0A8B0LD36_E1B19K-      ----------------------------------------------ttat
A0A8B0LBX6_E1B19K-      ----------------------------------------------ttat
A0A8B0L9Y2_E1B19K-      ----------------------------------------------ttat
Q2KSL3_E1B19K-01        ----------------------------------------------ttat
Q2KSL3_E1B19K-02        atgatgggtatgtggccaggggttgtcggcatggaagcagtaacacttat
Q2Y0J3_E1B19K-02        atgatgggtatgtggccaggggttgtcggcatggaagcagtaacacttat
                                                                      ****

Q2Y0J3_E1B19K-01        cagttttagattt----------------------ttctactcctgg-ta
A0A8B0LCV0_E1B19K-      cagttttagattt----------------------ttctactcctgg-ta
A0A8B0LD36_E1B19K-      cagttttagattt----------------------ttctactcctgg-ta
A0A8B0LBX6_E1B19K-      cagttttagattt----------------------ttctactcctgg-ta
A0A8B0L9Y2_E1B19K-      cagttttagattt----------------------ttctactcctgg-ta
Q2KSL3_E1B19K-01        cagttttagattt----------------------ttctactcctgg-ta
Q2KSL3_E1B19K-02        gaatattaggtttagaggggatgggtataatggcattgtatttatggcta
Q2Y0J3_E1B19K-02        gaatattaggtttaaaggggatgggtataatggcattgtatttatggcta
                         * * **** ***                      ** ** *  *** **

Q2Y0J3_E1B19K-01        gaact--gctgct--------gctgtagcttttct---------------
A0A8B0LCV0_E1B19K-      gaact--gctgct--------gctgtagcttttct---------------
A0A8B0LD36_E1B19K-      gaact--gctgct--------gctgtagcttttct---------------
A0A8B0LBX6_E1B19K-      gaact--gctgct--------gctgtagcttttct---------------
A0A8B0L9Y2_E1B19K-      gaact--gctgct--------gctgtagcttttct---------------
Q2KSL3_E1B19K-01        gaact--gctgct--------gctgtagcttttct---------------
Q2KSL3_E1B19K-02        acactaagctgattctacatggttgtagcttttttgggtttaataatacg
Q2Y0J3_E1B19K-02        acactaagctgattctacatggttgtagcttttttgggtttaataatacg
                          ***  **** *        * ********** *               

Q2Y0J3_E1B19K-01        --------------------------------------tactttt-----
A0A8B0LCV0_E1B19K-      --------------------------------------tactttt-----
A0A8B0LD36_E1B19K-      --------------------------------------tattttt-----
A0A8B0LBX6_E1B19K-      --------------------------------------tactttt-----
A0A8B0L9Y2_E1B19K-      --------------------------------------tactttt-----
Q2KSL3_E1B19K-01        --------------------------------------tactttt-----
Q2KSL3_E1B19K-02        tgtgtagaagcttgggggcaagttagtgtgaggggttgtagtttttatgc
Q2Y0J3_E1B19K-02        tgtgtagaagcttgggggcaagttagtgtgaggggttgtagtttttatgc
                                                              ** ****     

Q2Y0J3_E1B19K-01        --------------------------------------------------
A0A8B0LCV0_E1B19K-      --------------------------------------------------
A0A8B0LD36_E1B19K-      --------------------------------------------------
A0A8B0LBX6_E1B19K-      --------------------------------------------------
A0A8B0L9Y2_E1B19K-      --------------------------------------------------
Q2KSL3_E1B19K-01        --------------------------------------------------
Q2KSL3_E1B19K-02        atgctggattgcaacatcaggtagggtgaagagtcagttgtctgtaaaga
Q2Y0J3_E1B19K-02        atgctggattgcaacatcaggtagggtcaagagtcagttgtctgtgaaga
                                                                          

Q2Y0J3_E1B19K-01        -----------------------------atattggataaat--------
A0A8B0LCV0_E1B19K-      -----------------------------atattggataaat--------
A0A8B0LD36_E1B19K-      -----------------------------atattggataaat--------
A0A8B0LBX6_E1B19K-      -----------------------------atattggataaat--------
A0A8B0L9Y2_E1B19K-      -----------------------------atattggataaat--------
Q2KSL3_E1B19K-01        -----------------------------atattggataaat--------
Q2KSL3_E1B19K-02        aatgcatgtttgagagatgtaatcttggcatactgaatgaaggtgaagca
Q2Y0J3_E1B19K-02        aatgcatgtttgagagatgtaatcttggcatactgaatgaaggtgaagca
                                                     *** ** ** **         

Q2Y0J3_E1B19K-01        -ggatccgcc---------------aaac--------tcacttcagcaag
A0A8B0LCV0_E1B19K-      -ggatccgcc---------------aaac--------tcacttcagcaag
A0A8B0LD36_E1B19K-      -ggatccgcc---------------aaac--------tcacttcagcaag
A0A8B0LBX6_E1B19K-      -ggatccgcc---------------aaac--------tcacttcagcaag
A0A8B0L9Y2_E1B19K-      -ggatccgcc---------------aaac--------tcacttcagcaag
Q2KSL3_E1B19K-01        -ggatccgcc---------------aaac--------tcacttcagcaag
Q2KSL3_E1B19K-02        agggtccgccactgcgcggctacagaaactggctgcttcattctaataaa
Q2Y0J3_E1B19K-02        agggtccgccactgcgcagctacagaaactggctgcttcattctaataaa
                         ** ******               ****        *** *  *  ** 

Q2Y0J3_E1B19K-01        gg---------------------atacg--ttttggat-ttcatagcagc
A0A8B0LCV0_E1B19K-      gg---------------------atacg--ttttggat-ttcatagcagc
A0A8B0LD36_E1B19K-      gg---------------------atacg--ttttggat-ttcatagcagc
A0A8B0LBX6_E1B19K-      gg---------------------atacg--ttttggat-ttcatagcagc
A0A8B0L9Y2_E1B19K-      gg---------------------atacg--ttttggat-ttcatagcagc
Q2KSL3_E1B19K-01        gg---------------------atacg--ttttggat-ttcatagcagc
Q2KSL3_E1B19K-02        gggaaatgccagtgtaaagcataatatgatctgtggacattcggatgaga
Q2Y0J3_E1B19K-02        gggaaatgccagtgtgaagcataatatgatctgtggacattcggatgaga
                        **                     *** *   * ****  ***  *  ** 

Q2Y0J3_E1B19K-01        agctttg------------------tggagaacatggaag----------
A0A8B0LCV0_E1B19K-      agctttg------------------tggagaacatggaag----------
A0A8B0LD36_E1B19K-      agctttg------------------tggagaacatggaag----------
A0A8B0LBX6_E1B19K-      agctttg------------------tggagaacatggaag----------
A0A8B0L9Y2_E1B19K-      agctttg------------------tggagaacatggaag----------
Q2KSL3_E1B19K-01        agctttg------------------tggagaacatggaag----------
Q2KSL3_E1B19K-02        ggccttatcagatgctgacctgcgctggtggacattgcaatattcttgct
Q2Y0J3_E1B19K-02        ggccttatcagatgctgacctgcgctggtggacattgcaatattcttgct
                         ** **                   *** * **** * *           

Q2Y0J3_E1B19K-01        ---------------------gctcgcagga-------------tgagga
A0A8B0LCV0_E1B19K-      ---------------------gctcgcagga-------------tgagga
A0A8B0LD36_E1B19K-      ---------------------gctcgcagga-------------tgagga
A0A8B0LBX6_E1B19K-      ---------------------gctcgcagga-------------tgagga
A0A8B0L9Y2_E1B19K-      ---------------------gctcgcagga-------------tgagga
Q2KSL3_E1B19K-01        ---------------------gctcgcagga-------------tgagga
Q2KSL3_E1B19K-02        accgtgcatatcgtttcacatgcacgcaagaaatggcctgtatttgaaca
Q2Y0J3_E1B19K-02        accgtgcatatcgtttcacatgcacgcaaaaaatggcctgtatttgaaca
                                             ** ****  *             ***  *

Q2Y0J3_E1B19K-01        caatcttagatta-------------------------------------
A0A8B0LCV0_E1B19K-      caatcttagatta-------------------------------------
A0A8B0LD36_E1B19K-      caatcttagatta-------------------------------------
A0A8B0LBX6_E1B19K-      caatcttagatta-------------------------------------
A0A8B0L9Y2_E1B19K-      caatcttagatta-------------------------------------
Q2KSL3_E1B19K-01        caatcttagatta-------------------------------------
Q2KSL3_E1B19K-02        taatgt--gattaccaagtgcaccatgcacataggtggtcgcaggggaat
Q2Y0J3_E1B19K-02        taatgt--gattaccaagtgcaccatgcacataggtggtcgcaggggaat
                         *** *  *****                                     

Q2Y0J3_E1B19K-01        --------ctggccagtgca------------------------------
A0A8B0LCV0_E1B19K-      --------ctggccagtgca------------------------------
A0A8B0LD36_E1B19K-      --------ctggccagtgca------------------------------
A0A8B0LBX6_E1B19K-      --------ctggccagtgca------------------------------
A0A8B0L9Y2_E1B19K-      --------ctggccagtgca------------------------------
Q2KSL3_E1B19K-01        --------ctggccagtgca------------------------------
Q2KSL3_E1B19K-02        gtttatgccttaccagtgtaacatgaatcatgtgaaggtgatgttggaac
Q2Y0J3_E1B19K-02        gtttatgccttaccagtgtaacatgaatcatgtgaaggtaatgttggaac
                                **  ****** *                              

Q2Y0J3_E1B19K-01        -----gcctc--------tgggagtagcagg-------------------
A0A8B0LCV0_E1B19K-      -----gcctc--------tgggagtagcagg-------------------
A0A8B0LD36_E1B19K-      -----gcctc--------tgggagtagcagg-------------------
A0A8B0LBX6_E1B19K-      -----gcctc--------tgggagtagcagg-------------------
A0A8B0L9Y2_E1B19K-      -----gcctc--------tgggagtagcagg-------------------
Q2KSL3_E1B19K-01        -----gcctc--------tgggagtagcagg-------------------
Q2KSL3_E1B19K-02        cagatgccttttccagagtgagcttaacaggaatctttgatatgaatatt
Q2Y0J3_E1B19K-02        cagatgccttttccagagtgagcttaacaggaatctttgatatgaatatt
                             ****         ** *  ** ****                   

Q2Y0J3_E1B19K-01        -----------gatactgagacacccaccgaccatgccagcggttc----
A0A8B0LCV0_E1B19K-      -----------gatactgagacacccaccgaccatgccagcggttc----
A0A8B0LD36_E1B19K-      -----------gatactgagacacccaccgaccatgccagcggttc----
A0A8B0LBX6_E1B19K-      -----------gatactgagacacccaccgaccatgccagtggttc----
A0A8B0L9Y2_E1B19K-      -----------gatactgagacacccacc------gccagcggttc----
Q2KSL3_E1B19K-01        -----------gatactgagacacccaccgaccatgccagcggttc----
Q2KSL3_E1B19K-02        caactatggaagatcctgagatatgatgacactaaaccaagggtgcgcgc
Q2Y0J3_E1B19K-02        caactatggaagatcctgagatatgatgacactaaaccaagggtgcgcgc
                                   *** ****** *             ***  *** *    

Q2Y0J3_E1B19K-01        -------tgcaggaggag-------------cagcaggag----------
A0A8B0LCV0_E1B19K-      -------tgcaggaggag-------------cagcaggag----------
A0A8B0LD36_E1B19K-      -------tgcaggaggag-------------cagcaggag----------
A0A8B0LBX6_E1B19K-      -------tgcaggaggag-------------cagcaggag----------
A0A8B0L9Y2_E1B19K-      -------tgcaggaggag-------------cagcaggag----------
Q2KSL3_E1B19K-01        -------tgcaggaggag-------------cagcaggag----------
Q2KSL3_E1B19K-02        atgcgaatgcggaggcaagcatgctagattccagccggtgtgcgtggatg
Q2Y0J3_E1B19K-02        atgcgaatgcggaggcaagcatgctagattccagccggtgtgcgtggatg
                               *** *  * *              **** ** *          

Q2Y0J3_E1B19K-01        -----gacaatccgagagccg--------------gcctggacc------
A0A8B0LCV0_E1B19K-      -----gacaatccgagagccg--------------gcctggacc------
A0A8B0LD36_E1B19K-      -----gacaatccgagagccg--------------gcctggacc------
A0A8B0LBX6_E1B19K-      -----gacaatccgagagccg--------------gcctggacc------
A0A8B0L9Y2_E1B19K-      -----gacaatccgagagccg--------------gcctggacc------
Q2KSL3_E1B19K-01        -----gacaatccgagagccg--------------gcctggacc------
Q2KSL3_E1B19K-02        tgactgaagacctgagacccgatcatttggtgcttgcctgcactggagcg
Q2Y0J3_E1B19K-02        tgactgaagacttgagacccgatcatttggtgcttgcctgcactggagcg
                             **  *   **** ***              ***** **       

Q2Y0J3_E1B19K-01        --------ctccggtggaggag--------tag
A0A8B0LCV0_E1B19K-      --------ctccggtggaggag--------tag
A0A8B0LD36_E1B19K-      --------ctccggtggaggag--------tag
A0A8B0LBX6_E1B19K-      --------ctccggtggaggag--------tag
A0A8B0L9Y2_E1B19K-      --------ctccggtggaggag--------tag
Q2KSL3_E1B19K-01        --------ctccggtggaggag--------tag
Q2KSL3_E1B19K-02        gagtttggttctagtggtgaagaaactgactaa
Q2Y0J3_E1B19K-02        gagttcggttctagtggtgaagaaactgactaa
                                 **  **** * **        ** 

© 1998-2022Legal notice