Dataset for CDS E1B19K of organism Human adenovirus B serotype 16

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q2KRU2_E1B19K-02      atggatccgccaaacccacttcagcaagggatacgttttggatttcatag
R4HLE1_E1B19K-02      atggatccgccaaactcacttcagcaagggatacgttttggatttcatag
Q2KRU2_E1B19K-01      atgga-----------------------------ggtttgggct------
R4HLE1_E1B19K-01      atgga-----------------------------ggtttgggct------
                      *****                             * *****  *      

Q2KRU2_E1B19K-02      cagcagctttgtggagaacatggaaggctcgcaggatgaggacaatctta
R4HLE1_E1B19K-02      cagcagctttgtggagaacatggaaggctcgcaggatgaggacaatctta
Q2KRU2_E1B19K-01      ----------------atcttggaagacctg--------agacagac-ta
R4HLE1_E1B19K-01      ----------------atcttggaagacctc--------aggcagac-ta
                                      * * ****** *            * **  * **

Q2KRU2_E1B19K-02      gattactggccagtgcagcctctg--ggagtagcagggatactgagacac
R4HLE1_E1B19K-02      gattactggccagtgcagcctcta--ggagtagcagggatattgagacac
Q2KRU2_E1B19K-01      ggctactgctagaaaacgcctcggacggagtctctggcttttggaga---
R4HLE1_E1B19K-01      ggctactgctagaaaacgcctcggacggagtctctggcctttggaga---
                      *  *****         *****    *****  * **  *   ****   

Q2KRU2_E1B19K-02      ccaccggccatgccagcggttctggaggaggagcagcaggaggacaatcc
R4HLE1_E1B19K-02      ccaccgaccatgccagcggttctgcaggaggagcagcaggaggacaatcc
Q2KRU2_E1B19K-01      -------------------ttctgg-------------------------
R4HLE1_E1B19K-01      -------------------ttctgg-------------------------
                                         *****                          

Q2KRU2_E1B19K-02      gagagccggcctggaccctccggtggaggagtagctgacttgtttcctga
R4HLE1_E1B19K-02      gagagccggcctggaccctccggtggaggagtagctgacctgtttcctga
Q2KRU2_E1B19K-01      ------------------ttcggtggcgatctagcta-------------
R4HLE1_E1B19K-01      ------------------ttcggtggtgatctagcta-------------
                                        * ****** *   *****              

Q2KRU2_E1B19K-02      actgcgacgggtgcttactaggtctacgtccagtggacaggacaggggca
R4HLE1_E1B19K-02      actgcgacgggtgcttactaggtctacgaccagtggacagaacaggggca
Q2KRU2_E1B19K-01      -----ggctagtgttta-----------------ggataaaacagga---
R4HLE1_E1B19K-01      -----ggctagtgttta-----------------ggataaaacagga---
                           * *  *** ***                 *** *  *****    

Q2KRU2_E1B19K-02      ttaagagggaaaggaatcctagtgggaataattcaagaaccgagttggct
R4HLE1_E1B19K-02      ttaagagggagaggaatcctagtgggaataattcaagaaccgagttggct
Q2KRU2_E1B19K-01      ------------------ctatagggaagaatttgaaaagttattggac-
R4HLE1_E1B19K-01      ------------------ctacagggaagaatttgaaaagttattggac-
                                        ***  ***** ****  * **   * * * * 

Q2KRU2_E1B19K-02      ttaagtttaatgagccgtaggcgtcctgaaactgtttggtggcatgaggt
R4HLE1_E1B19K-02      ttaagtttaatgagccgcaggcgtcctgaaactgtttggtggcatgaggt
Q2KRU2_E1B19K-01      ---------gacagtccaggactttttgaagctctt--------------
R4HLE1_E1B19K-01      ---------aacagtccaggactttttgaagctctt--------------
                                  ** *   * * *  **** ** **              

Q2KRU2_E1B19K-02      tcagagcgaaggcagggatgaagtttcaatattgcaggagaaatattcac
R4HLE1_E1B19K-02      tcagagcgaaggcagggatgaagtttcaatattgcaggagaaatattcac
Q2KRU2_E1B19K-01      --------------------------------------------------
R4HLE1_E1B19K-01      --------------------------------------------------
                                                                        

Q2KRU2_E1B19K-02      tagaacaacttaagacctgttggttggaacctgaggatgattgggaggtg
R4HLE1_E1B19K-02      tagaacaacttaagacctgttggttggaacctgaggatgattgggaagtg
Q2KRU2_E1B19K-01      ---------------------------aacttg----------------g
R4HLE1_E1B19K-01      ---------------------------aacttg----------------g
                                                 *** **                *

Q2KRU2_E1B19K-02      gccattaggaattatgctaagatatctctgaggcctgataaacagtatag
R4HLE1_E1B19K-02      gccattaggaattatgctaagatatctctgaggcctgataaacaatatag
Q2KRU2_E1B19K-01      gccatcagg-ctcattttaag-----------------------------
R4HLE1_E1B19K-01      gtcatcagg-ctcattttaag-----------------------------
                      * *** ***  * **  ****                             

Q2KRU2_E1B19K-02      aattactaagaagattaatattagaaatgcatgctacatatcagggaatg
R4HLE1_E1B19K-02      aattactaagaagattaatattagaaatgcatgctacatatcagggaatg
Q2KRU2_E1B19K-01      -------gagaaggtt----------------------------------
R4HLE1_E1B19K-01      -------gagaaggtt----------------------------------
                              ***** **                                  

Q2KRU2_E1B19K-02      gggcagaggttataatagatacacaagataaagcagcttttagatgttgt
R4HLE1_E1B19K-02      gagcagaggttataatagatacacaagataaagcagcttttagatgttgt
Q2KRU2_E1B19K-01      --------------------------------------------------
R4HLE1_E1B19K-01      --------------------------------------------------
                                                                        

Q2KRU2_E1B19K-02      atgatgggtatgtggccaggggttgtcggcatggaagcagtaacatttat
R4HLE1_E1B19K-02      atgatgggtatgtggccaggggttgtcggcatggaagcagtaacacttat
Q2KRU2_E1B19K-01      ----------------------------------------------ttat
R4HLE1_E1B19K-01      ----------------------------------------------ttat
                                                                    ****

Q2KRU2_E1B19K-02      gaatattaggtttaaaggggatgggtataatggcattgtatttatggcta
R4HLE1_E1B19K-02      gaatattaggtttagaggggatgggtataatggcattgtatttatggcta
Q2KRU2_E1B19K-01      cagttttagattt----------------------ttctactcctgg-ta
R4HLE1_E1B19K-01      cagttttagattt----------------------ttctactcctgg-ta
                       * * **** ***                      ** ** *  *** **

Q2KRU2_E1B19K-02      acactaagctgattctacatggttgtagcttttttgggtttaataatact
R4HLE1_E1B19K-02      acactaagctgattctacatggttgtagcttttttgggtttaataatacg
Q2KRU2_E1B19K-01      gaact--gctgct--------gctgtagcttttct---------------
R4HLE1_E1B19K-01      gaact--gctgct--------gctgtagcttttct---------------
                        ***  **** *        * ********** *               

Q2KRU2_E1B19K-02      tgtgtagaagcttgggggcaagttagtgtgaggggttgtagtttttatgc
R4HLE1_E1B19K-02      tgtgtagaagcttgggggcaagttagtgtgaggggttgtagtttttatgc
Q2KRU2_E1B19K-01      --------------------------------------tactttt-----
R4HLE1_E1B19K-01      --------------------------------------tactttt-----
                                                            ** ****     

Q2KRU2_E1B19K-02      atgctggattgcaacatcaggtagggtcaagagtcagttgtctgtgaaga
R4HLE1_E1B19K-02      atgctggattgcaacatcaggtagggtcaagagtcagttgtctgtgaaga
Q2KRU2_E1B19K-01      --------------------------------------------------
R4HLE1_E1B19K-01      --------------------------------------------------
                                                                        

Q2KRU2_E1B19K-02      aatgcatgtttgagagatgtaatcttggcatactgaatgaaggtgaagca
R4HLE1_E1B19K-02      aatgcatgtttgagagatgtaatcttggcatactgaatgaaggtgaagca
Q2KRU2_E1B19K-01      -----------------------------atattggataaat--------
R4HLE1_E1B19K-01      -----------------------------atattggataaat--------
                                                   *** ** ** **         

Q2KRU2_E1B19K-02      agggtccgccactgcgcagctacagaaactggctgcttcattctaataaa
R4HLE1_E1B19K-02      agggtccgccactgcgcagctacagaaactggctgcttcattctaataaa
Q2KRU2_E1B19K-01      -ggatccgcc---------------aaac--------ccacttcagcaag
R4HLE1_E1B19K-01      -ggatccgcc---------------aaac--------tcacttcagcaag
                       ** ******               ****         ** *  *  ** 

Q2KRU2_E1B19K-02      gggaaatgccagtgtgaagcataatatgatctgtggacattcgaatgaga
R4HLE1_E1B19K-02      gggaaatgccagtgtgaagcataatatgatctgtggacattcggatgaga
Q2KRU2_E1B19K-01      gg---------------------atacg--ttttggat-ttcatagcagc
R4HLE1_E1B19K-01      gg---------------------atacg--ttttggat-ttcatagcagc
                      **                     *** *   * ****  ***  *  ** 

Q2KRU2_E1B19K-02      ggccttatcagatgctgacctgcgctggtggacattgcaatattctggct
R4HLE1_E1B19K-02      ggccttatcagatgctgacctgcgctggtggacattgcaatattcttgct
Q2KRU2_E1B19K-01      agctttg------------------tggagaacatggaag----------
R4HLE1_E1B19K-01      agctttg------------------tggagaacatggaag----------
                       ** **                   *** * **** * *           

Q2KRU2_E1B19K-02      accgtgcatatcgtttcccatgcacgcaagaaatggcctgtatttgaaca
R4HLE1_E1B19K-02      accgtgcatatcgtttcacatgcacgcaagaaatggcctgtatttgaaca
Q2KRU2_E1B19K-01      ---------------------gctcgcagga-------------tgagga
R4HLE1_E1B19K-01      ---------------------gctcgcagga-------------tgagga
                                           ** **** **             ***  *

Q2KRU2_E1B19K-02      taatgt--gattaccaagtgcaccatgcacataggtggtcgcaggggaat
R4HLE1_E1B19K-02      taatgt--gattaccaagtgcaccatgcacataggtggtcgcaggggaat
Q2KRU2_E1B19K-01      caatcttagatta-------------------------------------
R4HLE1_E1B19K-01      caatcttagatta-------------------------------------
                       *** *  *****                                     

Q2KRU2_E1B19K-02      gtttatgccttaccagtgtaacatgaatcatgtgaaggtgatgttggaac
R4HLE1_E1B19K-02      gtttatgccttaccagtgtaacatgaatcatgtgaaggtaatgttggaac
Q2KRU2_E1B19K-01      --------ctggccagtgcagc----------------------------
R4HLE1_E1B19K-01      --------ctggccagtgcagc----------------------------
                              **  ****** * *                            

Q2KRU2_E1B19K-02      cagatgccttttccagagtaagcttaacaggaatctttgatatgaatatt
R4HLE1_E1B19K-02      cagatgccttttctagagtgagcttaacaggaatctttgatatgaatatt
Q2KRU2_E1B19K-01      --------------------------------------------------
R4HLE1_E1B19K-01      --------------------------------------------------
                                                                        

Q2KRU2_E1B19K-02      caactatggaagatcctgagatatgatgacactaaaccgagggtgc--gc
R4HLE1_E1B19K-02      caactatggaagatcctgagatatgatgacactaaatcgagggtgc--gc
Q2KRU2_E1B19K-01      ---ctctgggagtagcagggatactgagacacc-caccggccatgccagc
R4HLE1_E1B19K-01      ---ctctaggagtagcagggatattgagacacc-caccgaccatgccagc
                         ** * * **   * * ****    *****   * **    ***  **

Q2KRU2_E1B19K-02      gcatgcgaatgcggaggcaagcatgctagattccagccggtgtgcgtgga
R4HLE1_E1B19K-02      gcatgcgaatgcggaggcaagcatgctagattccagccggtgtgcgtgga
Q2KRU2_E1B19K-01      ggttctggaggaggag-----------------cagcaggag--------
R4HLE1_E1B19K-01      ggttctgcaggaggag-----------------cagcaggag--------
                      *  *  * * * ****                 **** ** *        

Q2KRU2_E1B19K-02      tgtgactgaagacctgagacccgatcatttggtgcttgcctgcactggag
R4HLE1_E1B19K-02      tgtgactgaagacctgagacccgatcatttggtgcttgcctgcactggag
Q2KRU2_E1B19K-01      -------gacaatccgagagccg--------------gcctggacc----
R4HLE1_E1B19K-01      -------gacaatccgagagccg--------------gcctggacc----
                             **  * * **** ***              ***** **     

Q2KRU2_E1B19K-02      cggagttcggttctagtggtgaagaaactgactaa
R4HLE1_E1B19K-02      cggagttcggttctagtggtgaagaaactgactaa
Q2KRU2_E1B19K-01      ----------ctccggtggaggag--------tag
R4HLE1_E1B19K-01      ----------ctccggtggaggag--------tag
                                 **  **** * **        ** 

© 1998-2022Legal notice