Dataset for CDS E1B19K of organism Human adenovirus A serotype 12

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

P04492_E1B19K-02        atggagcgagaaatcccacctgagttgggattacatgctggattacatgt
A0A3G8WH01_E1B19K-      atggagttggaaa------ctgtgctgcaa---------agttttca---
P04492_E1B19K-01        atggagttggaaa------ctgtgctgcaa---------agttttca---
                        ******   ****      *** * **  *          * ** **   

P04492_E1B19K-02        caatgcagctgtggagggcatggctgaagaggagggtttgcatttactcg
A0A3G8WH01_E1B19K-      -------------------------------gagcgttcgc---------
P04492_E1B19K-01        -------------------------------gagcgttcgc---------
                                                       *** *** **         

P04492_E1B19K-02        ctggcgcggcctttgaccatgccgccgctgccgacgttgcaagaggagaa
A0A3G8WH01_E1B19K-      ------cagctctt------------------------------------
P04492_E1B19K-01        ------cagctctt------------------------------------
                              * **  **                                    

P04492_E1B19K-02        ggaggaggagcggaaccctgcggtggtggagaagtaaacatggaacaaca
A0A3G8WH01_E1B19K-      ------------------------------gcagtatacctctaagaac-
P04492_E1B19K-01        ------------------------------gcagtatacctctaaaaac-
                                                      * **** ** *  ** *** 

P04492_E1B19K-02        ggtgcaagaaggccatgtacttgagcgtggcgaagggcctagttgcgcag
A0A3G8WH01_E1B19K-      ------------------acttcag-------------------------
P04492_E1B19K-01        ------------------acttcag-------------------------
                                          **** **                         

P04492_E1B19K-02        atgatagagataagcaggaaaaaaaagaaagtttaaaggaagctgctgtt
A0A3G8WH01_E1B19K-      -----------------------------------------------gtt
P04492_E1B19K-01        -----------------------------------------------gtt

P04492_E1B19K-02        cttagtaggctaactgttaatctgatgtcccgcccgcgtttggaaactgt
A0A3G8WH01_E1B19K-      tttgg--agatatctgtt-------tggctctacc---------------
P04492_E1B19K-01        tttgg--aggtatctgtt-------tggctctacc---------------
                         ** *   * ** *****       ** * *  **               

P04492_E1B19K-02        atattggcaggagttgcaggatgaatttcagcggggtgatatgcatttac
A0A3G8WH01_E1B19K-      --------------------------ttaagcaaggtggta---------
P04492_E1B19K-01        --------------------------ttaagcaaggtggta---------
                                                  ** ***  **** **         

P04492_E1B19K-02        agtacaaatacagttttgaacaattaaaaacccactggttagagccatgg
A0A3G8WH01_E1B19K-      -------------------------------------aatagggtgaaag
P04492_E1B19K-01        -------------------------------------aatagggtgaaag
                                                               *** *  *  *

P04492_E1B19K-02        gaggatatggagtgtgctattaaagcttttgctaaattggccttacgtcc
A0A3G8WH01_E1B19K-      aagactatagagaggaatttgaaaac-------atattggcc--------
P04492_E1B19K-01        aagactatagagaggaatttgaaaac-------atattggcc--------
                         **  *** *** *   * * *** *       * *******        

P04492_E1B19K-02        tgattgtagctacagaattactaaaacagtaaccattacttcatgcgcct
A0A3G8WH01_E1B19K-      -gactgt-------------------------------------------
P04492_E1B19K-01        -gactgt-------------------------------------------
                         ** ***                                           

P04492_E1B19K-02        atattataggtaacggggcagaagttgaggtagatacaagcgacagagtt
A0A3G8WH01_E1B19K-      --------------------------------------------------
P04492_E1B19K-01        --------------------------------------------------

P04492_E1B19K-02        gcttttagatgtcgaatgcagggtatgggcccaggggtggtgggtttgga
A0A3G8WH01_E1B19K-      ------------------------------ccaggg--------------
P04492_E1B19K-01        ------------------------------ccaggg--------------

P04492_E1B19K-02        tggaattacatttataaatgttaggtttgctggagataagtttaaaggca
A0A3G8WH01_E1B19K-      -----------------cttttggcttcactag-----------------
P04492_E1B19K-01        -----------------cttttggcttcactag-----------------
                                          * ** * **  ** *                 

P04492_E1B19K-02        ttatgttcgaagctaatacctgtcttgtcttgcatggtgtttactttctt
A0A3G8WH01_E1B19K-      -----------------acctttgtcacc--acttggtgt----------
P04492_E1B19K-01        -----------------acttgtgttacc--acttggtgt----------
                                         ** * * *   *   * ******          

P04492_E1B19K-02        aactttagtaacatttgtgtagagtcttggaataaggtttctgctagggg
A0A3G8WH01_E1B19K-      ---ttcaggaaaaagtggtcagatccttagatt----tttcatctgtggg
P04492_E1B19K-01        ---ttcaggaaaaagtggtcagatccttagatt----tttcatctgtggg
                           ** ** ** *  **   ***  *** ** *    ****  **  ***

P04492_E1B19K-02        ctgtactttttatggatgttggaagggtttggtgggtagaccaaaaagta
A0A3G8WH01_E1B19K-      acgaac-------ggttgct------------------------------
P04492_E1B19K-01        acgaac-------ggttgct------------------------------
                          * **       ** ** *                              

P04492_E1B19K-02        aactgtctgtaaaaaagtgtttgtttgaaaaatgtgtacttgctatactg
A0A3G8WH01_E1B19K-      -----tctat-------tgcttttttggcaa-----------ccatattg
P04492_E1B19K-01        -----tctat-------tgcttttttggcaa-----------ccatattg
                             *** *       ** ** ****  **           * *** **

P04492_E1B19K-02        aatgagggggatgcacatattaggcataatgcagcttcagaaaatgcctg
A0A3G8WH01_E1B19K-      gataaatggag--------------------------cgagaaatccc--
P04492_E1B19K-01        gataaatggag--------------------------cgagaaatccc--
                         ** *  **                            *   **** **  

P04492_E1B19K-02        ttttgtattattgaagggaatggctattttaaagcataatatggtttgtg
A0A3G8WH01_E1B19K-      --------------------------------------------------
P04492_E1B19K-01        --------------------------------------------------

P04492_E1B19K-02        gggtgtctgatcaaactatgcgacgttttgttacctgtgctgatggaaat
A0A3G8WH01_E1B19K-      --------------------------------acttgagttg--------
P04492_E1B19K-01        --------------------------------acctgagttg--------
                                                        ** ** * **        

P04492_E1B19K-02        tgtcataccttaaaaactgttcatattgtgagccacagtagacattgttg
A0A3G8WH01_E1B19K-      -----------------------------ggattaca--------tgctg
P04492_E1B19K-01        -----------------------------ggattaca--------tgctg
                                                     *    ***        ** **

P04492_E1B19K-02        gcctgtatgtgatcataacatgtttatgc-gctgtaccatacatttaggc
A0A3G8WH01_E1B19K-      g-------------attacatgtcaatgcagctgtggagggcat---ggc
P04492_E1B19K-01        g-------------attacatgtcaatgcagctgtggagggcat---ggc
                        *             ** ******  **** *****      ***   ***

P04492_E1B19K-02        ttaaggcggggtatgtttagaccttcccaatgtaacttcagccactcaaa
A0A3G8WH01_E1B19K-      tgaagaggagg---gtttgcatttactc----------------------
P04492_E1B19K-01        tgaagaggagg---gtttgcatttactc----------------------
                        * ***  * **   ****  *  * * *                      

P04492_E1B19K-02        cattatgctggaacctgaagtgttttctagagtgtgtttaaatggggtat
A0A3G8WH01_E1B19K-      ------gctggcgc-------------------------------ggcct
P04492_E1B19K-01        ------gctggcgc-------------------------------ggcct
                              *****  *                               **  *

P04492_E1B19K-02        ttgatttatctgtggaattatgtaaggttataagatataatgatgatact
A0A3G8WH01_E1B19K-      ttgac-------------------------------------------ca
P04492_E1B19K-01        ttgac-------------------------------------------ca
                        ****                                            * 

P04492_E1B19K-02        cgacatcgttgccgacagtgtgagtgtggtagcagtcatctagaacttcg
A0A3G8WH01_E1B19K-      tgcccccgctgccgacgttgcaagaggagaaggag---------------
P04492_E1B19K-01        tgccgccgctgccgacgttgcaagaggagaaggag---------------
                         * *  ** *******  **  ** *  * ** **               

P04492_E1B19K-02        tcccattgtgctaaatgtaactgaggagctgagaagtgaccaccttaccc
A0A3G8WH01_E1B19K-      ----------------------gaggagcgga--------------accc
P04492_E1B19K-01        ----------------------gaggagcgga--------------accc
                                              ******* **              ****

P04492_E1B19K-02        tgtcttgcctgcggactgactatgagtcaagtgatgaagacgacaactga
A0A3G8WH01_E1B19K-      tgc--------------------------ggtggtggagaag-----taa
P04492_E1B19K-01        tgc--------------------------ggtggtggagaag-----taa
                        **                            *** ** *** *     * *

© 1998-2022Legal notice