Dataset for CDS E1B19K of organism Human adenovirus 7d

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A897JQR0_E1B19K-      atgga-----------------------------ggtttgggct------
A0A897JQR0_E1B19K-      atggatccgccaaactcacttcagcaagggatacgttttggatttcatag
                        *****                             * *****  *      

A0A897JQR0_E1B19K-      ----------------atcttggaagac----------------------
A0A897JQR0_E1B19K-      cagcagctttgtggagaacatggaaggctcgcaggatgaggacaatctta
                                        * * ****** *                      

A0A897JQR0_E1B19K-      ---------------------------------------ctcagaca---
A0A897JQR0_E1B19K-      aattactggccagtgcagcctctaggagtagcagggatactgagacaccc
                                                               ** *****   

A0A897JQR0_E1B19K-      ---gactaggcta------ctgctagaaaa--------------------
A0A897JQR0_E1B19K-      accgaccatgccagcggttctgcaggaggagcagcaggaggacaatccga
                           *** * ** *      ****  **  *                    

A0A897JQR0_E1B19K-      ----cgcctcggac-----------ggagtctctggccttt---------
A0A897JQR0_E1B19K-      gagccggcctggaccctccggtggaggagtagctgacctgtttcctgaac
                            ** *  ****           *****  *** *** *         

A0A897JQR0_E1B19K-      --------------------------------------------------
A0A897JQR0_E1B19K-      tgcgacgggtgcttactaggtctacgaccagtggacagaacagaggcatt
                                                                          

A0A897JQR0_E1B19K-      -----ggaga----------------------------------------
A0A897JQR0_E1B19K-      aagagggagaggaatcctagtgggaataattcaagaaccgagttggcttt
                             *****                                        

A0A897JQR0_E1B19K-      ---------------------ttctg-----gttcggtggt----gatct
A0A897JQR0_E1B19K-      aagtttaatgagccgcaggcgtcctgaaactgtttggtggcatgaggttc
                                             * ***     *** *****     * *  

A0A897JQR0_E1B19K-      a--------gctaggctagtgttt---------agga-----------ta
A0A897JQR0_E1B19K-      agagcgaaggcagggatgaagtttcaatattgcaggagaaatattcacta
                        *        **  ** *   ****         ****           **

A0A897JQR0_E1B19K-      aaac------aggactacagcgtagaatttgaaaagttattggacgacag
A0A897JQR0_E1B19K-      gaacaacttaagacctgttggttggaacctgagga-tgattgggaggtgg
                         ***      **  **   *  * ***  ***  * * *****  *   *

A0A897JQR0_E1B19K-      tc--caggactt-------------tttgaagctc---------------
A0A897JQR0_E1B19K-      ccattaggaattatgctaagatatctctgaggcctgataaacaatataga
                         *   **** **             * *** **                 

A0A897JQR0_E1B19K-      -------------ttaacttgggtcat-caggct-cattttaagga----
A0A897JQR0_E1B19K-      attactaagaagattaatattagaaatgcatgctacatatcagggaatgg
                                     ****  *  *  ** ** *** *** * * ***    

A0A897JQR0_E1B19K-      ---gaaggtt----------------------------------------
A0A897JQR0_E1B19K-      ggcagaggttataatagatacacaagataaagcagcttttagatgttgta
                             *****                                        

A0A897JQR0_E1B19K-      ---------------------------------------------ttatc
A0A897JQR0_E1B19K-      tgatgggtatgtggccaggggttgtcggcatggaagcagtaacacttatg
                                                                     **** 

A0A897JQR0_E1B19K-      agttttagattt----------------------ttctactcctgg-tag
A0A897JQR0_E1B19K-      aatattaggtttagaggggatgggtataatggcattgtatttatggctaa
                        * * **** ***                      ** ** *  *** ** 

A0A897JQR0_E1B19K-      aact--gctgct--------gctgtagcttttct----------------
A0A897JQR0_E1B19K-      cactaagctgattctacatggttgtagcttttttgggtttaataatacgt
                         ***  **** *        * ********** *                

A0A897JQR0_E1B19K-      -------------------------------------tactttt------
A0A897JQR0_E1B19K-      gtgtagaagcttgggggcaagttagtgtgaggggttgtagtttttatgca
                                                             ** ****      

A0A897JQR0_E1B19K-      --------------------------------------------------
A0A897JQR0_E1B19K-      tgctggattgcaacatcaggtagggtcaagagtcagttgtctgtgaagaa
                                                                          

A0A897JQR0_E1B19K-      ----------------------------atattggataaat---------
A0A897JQR0_E1B19K-      atgcatgtttgagagatgtaatcttggcatactgaatgaaggtgaagcaa
                                                    *** ** ** **          

A0A897JQR0_E1B19K-      ggatccgcc---------------aaac--------tcacttcagcaagg
A0A897JQR0_E1B19K-      ggatccgccactgtgcagctacagaaactggctgcttcattctaataaag
                        *********               ****        *** *  *  ** *

A0A897JQR0_E1B19K-      g---------------------atacg--ttttggat-ttcatagcagca
A0A897JQR0_E1B19K-      ggaaatgccagtgtgaagcataatatgatctgtggacattcggatgagag
                        *                     *** *   * ****  ***  *  **  

A0A897JQR0_E1B19K-      gctttg------------------tggagaacatggaag-----------
A0A897JQR0_E1B19K-      gccttatcagatgctgacctgcgctggtggacattgcaatattcttgcta
                        ** **                   *** * **** * *            

A0A897JQR0_E1B19K-      --------------------gctcgcagga-------------tgaggac
A0A897JQR0_E1B19K-      ctgtgcatatcgtttcacatgcacgcaagaaatggcctgtatttgaacat
                                            ** **** **             ***  * 

A0A897JQR0_E1B19K-      aatcttaaatta--------------------------------------
A0A897JQR0_E1B19K-      aatgt--gattaccaagtgcaccatgcacataggtggtcgcaggggaatg
                        *** *   ****                                      

A0A897JQR0_E1B19K-      -------ctggccagtgcagc-----------------------------
A0A897JQR0_E1B19K-      tttatgccttaccagtgtaacatgaatcatgtgaaggtaatgttggaacc
                               **  ****** * *                             

A0A897JQR0_E1B19K-      ---------ctctag---gag--tagcagg--------------------
A0A897JQR0_E1B19K-      agatgccttttccagagtgagcttaacaggaatctttgatatgaatattc
                                  ** **   ***  ** ****                    

A0A897JQR0_E1B19K-      ----------gatactgagaca---------cccaccgaccatgccagcg
A0A897JQR0_E1B19K-      aactatggaagatcctgagatatgatgacactaaaccgagggtgc--gcg
                                  *** ****** *            *****   ***  ***

A0A897JQR0_E1B19K-      gttctgcaggaggag-----------------cagcaggag---------
A0A897JQR0_E1B19K-      catgcgaatgcggaggcaagcatgctagattccagccggtgtgcgtggat
                          *  * * * ****                 **** ** *         

A0A897JQR0_E1B19K-      ------gacaatccgagagccg--------------gcctggacc-----
A0A897JQR0_E1B19K-      gtgactgaagacctgagacccgatcatttggtgcttgcctgcactggagc
                              **  * * **** ***              ***** **      

A0A897JQR0_E1B19K-      ---------ctccggtggaggag--------tag
A0A897JQR0_E1B19K-      ggagttcggttccagtggtgaagaaactgactaa
                                  *** **** * **        ** 

© 1998-2022Legal notice