Dataset for CDS E1B19K of organism Human adenovirus 71

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

T1UHL7_E1B19K-01      atggat-----------------gtgtggactatccttgcagactt--ta
T1UHL7_E1B19K-02      atggagccaggacacccaactgagcaggggcta-catcctggacttcgca
                      *****                  *   ** *** * *    *****   *

T1UHL7_E1B19K-01      gcaagacac-----gccggcttgta---------gaggatag--------
T1UHL7_E1B19K-02      gccatgcacctgtggaggtcctggatcaggcagcggggacagagaatctt
                      ** *  ***     *  * * ** *         * *** **        

T1UHL7_E1B19K-01      --------------ttcagacgggtgctccgggttct-------------
T1UHL7_E1B19K-02      gaactactggcttctacagccagcagctccgggtcttcttcgtctacaca
                                    * *** * *  *********  *             

T1UHL7_E1B19K-01      --------------------------------------------------
T1UHL7_E1B19K-02      gacaaacatccatgttggaggaagaaatgaggcaggccatggacgagaac

T1UHL7_E1B19K-01      -----------------------------ggagacactggtttggaactc
T1UHL7_E1B19K-02      ccgaggagcggcctggaccctccgtcggaagaggagctggattgaa--tc
                                                    ***   **** *** *  **

T1UHL7_E1B19K-01      ctctatctcgcct------------------ggtgtacac----------
T1UHL7_E1B19K-02      aggtatccagcctgtacccagagcttagcaaggtgctgacatccatggcc
                         ****  ****                  ****   **          

T1UHL7_E1B19K-01      -----agttaaga--------------------------aggattataac
T1UHL7_E1B19K-02      aggggagtgaagagggagaggagcgatgggggcaataccgggatgatgac
                           *** ****                           **** ** **

T1UHL7_E1B19K-01      ------------------gaggaatt------------------------
T1UHL7_E1B19K-02      cgagctgacggccagcctgatgaatcgcaagcgtccagagcgcattacct
                                        ** ****                         

T1UHL7_E1B19K-01      --------------------------------------------------
T1UHL7_E1B19K-02      ggcacgagctacagatggagtgcagggatgaggtgggcctgatgcaggat

T1UHL7_E1B19K-01      -------------------tgaaaatctttttgctgact-----------
T1UHL7_E1B19K-02      aaatatggcctggagcagataaaaacccattggttgaacccagatgagga
                                         * **** *  ** * ***             

T1UHL7_E1B19K-01      ----------------------------------gctctg----------
T1UHL7_E1B19K-02      ttgggaggaggccattaagaaatatgccaagatagccctgcgtccagatt
                                                        ** ***          

T1UHL7_E1B19K-01      --------------------------------------gcctgctagatt
T1UHL7_E1B19K-02      gcaagtacagggtgaccaagacggtgaatatcagacatgcctgctacatc
                                                            ******** ** 

T1UHL7_E1B19K-01      ctctgaatc---------ttggccaccagtccctt---------------
T1UHL7_E1B19K-02      tcggggaacggggcagaggtggtcatcgataccctggacaaggccgcctt
                          * * *          *** ** *  * ** *               

T1UHL7_E1B19K-01      ---------------------------------------------ttcca
T1UHL7_E1B19K-02      caggtgttgcatgatgggaatgagagcaggagtgatgaatatgaattcca

T1UHL7_E1B19K-01      --------------------------ggaaa-----------gggtact-
T1UHL7_E1B19K-02      tgatcttcatgaacatgaagttcaatggagagaagtttaatggggtgctg
                                                *** *           **** ** 

T1UHL7_E1B19K-01      --------------ccaca------------gccttgatttttccagc--
T1UHL7_E1B19K-02      ttcatggccaacagccacatgaccctgcatggctgcaatttcttcggctt
                                    *****            **    **** * * **  

T1UHL7_E1B19K-01      ---------------------ccagggcg-cactacagccggggttgctt
T1UHL7_E1B19K-02      caacaatatgtgcgcagaggtctggggcgccgctaagatcaggg-----g
                                           *  ***** * ***    * ***      

T1UHL7_E1B19K-01      ttgtggtttttctggttgacaaatgg----agccaggacacccaa-----
T1UHL7_E1B19K-02      atgtaagttttatggctgctggatgggcgtggtcggaagacccaagagcg
                       ***   **** *** **    ****     * * * * ******     

T1UHL7_E1B19K-01      --------------------------------------------------
T1UHL7_E1B19K-02      agatgtctgtgaagcagtgtgtgtttgagaaatgctacctggcagtctct

T1UHL7_E1B19K-01      ------------------------------------ctgagcaggggct-
T1UHL7_E1B19K-02      accgagggcaatgctagagtgagacactgctcttccctggagacgggctg
                                                          ***   * ***** 

T1UHL7_E1B19K-01      --------------------------------------------------
T1UHL7_E1B19K-02      cttctgcctggtgaagggcacagcctctctgaagcataatatggtgaagg

T1UHL7_E1B19K-01      ------------------------acatcctggacttcg-----------
T1UHL7_E1B19K-02      gctgcacggatgagcgcatgtacaacatgctgacctgcgactcgggggtc
                                              **** ***  ** **           

T1UHL7_E1B19K-01      -----------------cagccatg--------cacc-------------
T1UHL7_E1B19K-02      tgccatatcctgaagaacatccatgtgacctcccaccccagaaagaagtg
                                       ** *****        ****             

T1UHL7_E1B19K-01      ---------tgtggaggtcctg--gatcagg-------------------
T1UHL7_E1B19K-02      gccagtgtttgagaataacctgctgatcaagtgccatatgcacctgggcg
                               ** * *   ****  ***** *                   

T1UHL7_E1B19K-01      -----------------cagcggggacagagaatcttgaacta-------
T1UHL7_E1B19K-02      ccagaaggggcaccttccagccgtaccagtgcaactttagccagaccaag
                                       **** *   *** * * *** * * *       

T1UHL7_E1B19K-01      ----------------ctggcttctacag-----------ccagcagctc
T1UHL7_E1B19K-02      ctgctgttggagaacgatgccttctccagggtgaacctgaacggcatctt
                                       ** ***** ***            * *** ** 

T1UHL7_E1B19K-01      cg----ggtcttcttcgtctacac-----------------agacaaaca
T1UHL7_E1B19K-02      tgacatggatgtctcggtgtacaagatcctgagatacgatgagaccaa-g
                       *    **   ***  ** ****                  **** **  

T1UHL7_E1B19K-01      tccatgtt----------------ggaggaagaaat-----gaggca---
T1UHL7_E1B19K-02      tccagggtgcgcgcttgcgagtgcgggggcagacacaccaggatgcagcc
                      **** * *                ** ** *** *      ** ***   

T1UHL7_E1B19K-01      ---ggccatggacgagaacccgaggagc----------------------
T1UHL7_E1B19K-02      agtggccctggatgtga--ccgaggagctgagacccgaccacctggtgat
                         **** **** * **  *********                      

T1UHL7_E1B19K-01      ggcctggacc--------------ctccgtcggaagaggagctggattga
T1UHL7_E1B19K-02      ggcctgtaccgggaccgagtttagctccagtgg-ggaggacacagattag
                      ****** ***              ****   **  *****    ****  

© 1998-2020Legal notice