Dataset for CDS E1B19K of organism Human adenovirus 69

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

M0QU41_E1B19K-01      atggat-----------------gtgtggactatccttgcagactttagc
M0QU41_E1B19K-02      atggagccagaacacccaactgagcaggggcta-cattctggacttcg--
                      *****                  *   ** *** * **   *****    

M0QU41_E1B19K-01      aagacacgccggcttgtagaggata-------------------------
M0QU41_E1B19K-02      cagccatgc--acctgtggagggcatgggtgaggcagcggggacagagaa
                       ** ** **   * *** ****  *                         

M0QU41_E1B19K-01      -----------------gttcagacgggtgctccgggttct---------
M0QU41_E1B19K-02      tcttgaactactggcttatacagccagcagctccgggtcttcttcgtcta
                                        * *** * *  *********  *         

M0QU41_E1B19K-01      --------------------------------------------------
M0QU41_E1B19K-02      cacagacaaacatccatgttggaggaagaaatgaggcaggccatggacga

M0QU41_E1B19K-01      ---------------------------------ggagacactggtttgga
M0QU41_E1B19K-02      gaacccgaggagcggcctggaccctccgtcggaagaggagctggattgaa
                                                        ***   **** *** *

M0QU41_E1B19K-01      ac--tcctctatctcgt--------------------ctggtgtacacag
M0QU41_E1B19K-02      tcaggtatccagcttgtacccagagcttagcaaggtgctgacatccatgg
                       *     ** * ** **                    ***   * **  *

M0QU41_E1B19K-01      tta-----------------------------------------------
M0QU41_E1B19K-02      ccaggggagtgaagagggagaggagcgatgggggcaataccgggatgatg

M0QU41_E1B19K-01      --------------------------------------------------
M0QU41_E1B19K-02      accgagctgacggccagcctgatgaatcgcaagcgcccagagcgcattac

M0QU41_E1B19K-01      --------------agaaggattataacgaggaatt--------------
M0QU41_E1B19K-02      atggcacgagctacagatggagtgcagggatgagttgggcctgatgcagg
                                    *** *** *  *  ** ** **              

M0QU41_E1B19K-01      ---------------------tgaaaatctttttgct-------------
M0QU41_E1B19K-02      ataaatatggcctggagcagataaaaacacattggttgaacccagatgag
                                           * ****    ** * *             

M0QU41_E1B19K-01      --------------------------------gattgctctg--------
M0QU41_E1B19K-02      gattgggaggaggccattaagaaatatgccaagatagccctgcgcccaga
                                                      *** ** ***        

M0QU41_E1B19K-01      ----------------------------------------gcctgctaga
M0QU41_E1B19K-02      ttgcaagtacatagtgaccaagaccgtgaatattagacatgcctgctaca
                                                              ******** *

M0QU41_E1B19K-01      ttctctgaatctcggc---------caccagtccctt-------------
M0QU41_E1B19K-02      tttcgggtaacggggcagaggtggtcatcgataccctggacaaggccgcc
                      **    * * *  ***         ** *  * ** *             

M0QU41_E1B19K-01      --------ttccaggaaagg------------------------gtactc
M0QU41_E1B19K-02      ttcaggtgttgcatgatgggaatgagagcaggagtgatgaatatgaattc
                              ** ** **  **                        * * **

M0QU41_E1B19K-01      cacagccttgat--------------------------------------
M0QU41_E1B19K-02      catgatcttcatgaacatgaagttcaatggagagaagtttaatggggtgc
                      **    *** **                                      

M0QU41_E1B19K-01      ttttc--------cagcc-cagggcgcactacagccggggttgcttt---
M0QU41_E1B19K-02      tgttcatggccaacagccacatgaccctgcatggctgcagtttctttggc
                      * ***        ***** ** * * *   *  ** *  *** ****   

M0QU41_E1B19K-01      ------------------------------------------------tg
M0QU41_E1B19K-02      ttcaacaatatgtgcgccgaggtctggggcgcttccaagatcaggggatg

M0QU41_E1B19K-01      tggtttttctggttgacaaatgg----agccagaacacccaa--------
M0QU41_E1B19K-02      taagttttatggctgttggatgggcgtagtgggaagacccaagagtgaga
                      *   **** *** **    ****    **   *** ******        

M0QU41_E1B19K-01      --------------------------------------------------
M0QU41_E1B19K-02      tgtctgtgaagcagtgtgtgtttgagaaatgctacctgggagtctctacc

M0QU41_E1B19K-01      ---------------------------------ctgagcaggggct----
M0QU41_E1B19K-02      gagggcaatgctagagtgagacactgctcttccctggatacgggctgttt
                                                       ***   * *****    

M0QU41_E1B19K-01      --------------------------------------------------
M0QU41_E1B19K-02      ctgcctggtgaagggtacggcctctctgaagcataatatggtgaagggct

M0QU41_E1B19K-01      ---------------------acattctggacttcg--------------
M0QU41_E1B19K-02      gcacagatgagcgcatgtacaacatgctgacctgcgactcgggggtctgc
                                           **** ***  ** **              

M0QU41_E1B19K-01      --------------cagccatgc---------------------------
M0QU41_E1B19K-02      catatcctgaagaacatccatgtgacctcccaccccagaaagaagtggcc
                                    ** *****                            

M0QU41_E1B19K-01      --------------acctgtgga-------------gggcatgggtg---
M0QU41_E1B19K-02      agtgtttgagaataacctgctgatcaagtgccatatgcacctgggtgcca
                                    *****  **             *  * ******   

M0QU41_E1B19K-01      --agg---------cagcggggacagagaatcttgaacta----------
M0QU41_E1B19K-02      gaaggggcaccttccagccgtaccagtgcaactttagccagaccaagctg
                        ***         **** *   *** * * *** * * *          

M0QU41_E1B19K-01      -------------ctggcttatacag-----------ccagcagctccg-
M0QU41_E1B19K-02      ctgttggagaacgatgccttctccagggtgaacctgaacggcatctttga
                                    ** *** * ***            * *** **  * 

M0QU41_E1B19K-01      ---ggtcttcttcgtctaca-----cagacaaac-----------atcca
M0QU41_E1B19K-02      catggatgtctcggtgtacaagatcctgagatacgatgagaccaggtcca
                         **   ***  ** ****     * ** * **            ****

M0QU41_E1B19K-01      tgtt----------------ggaggaagaaat-----gaggca------g
M0QU41_E1B19K-02      gggtgcgcgcttgcgagtgcgggggcagacacaccaggatgcagcctgtg
                       * *                ** ** *** *      ** ***      *

M0QU41_E1B19K-01      gccatggacgagaacccgaggagc----------------------ggcc
M0QU41_E1B19K-02      gccctggatgtga--cagaggagctgagaccagaccacctggtgatggcc
                      *** **** * **  * *******                      ****

M0QU41_E1B19K-01      tggacc--------------ctccgtcggaagaggagctggattga
M0QU41_E1B19K-02      tgtaccgggaccgagttcagctccagcgg-ggaggacacagattag
                      ** ***              ****  ***  *****    ****  

© 1998-2022Legal notice