Dataset for CDS adenoviridae of organism Human adenovirus 62

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G1FBW4_E1B19K-01      atggaggt-gtggactatccttgc---------------ggactttaaca
G1FBW4_E1B19K-02      atggagccagcaaacccacctaaccagggattacatcctggacttcacgg
                      ******   *   **   ***  *               ****** *   

G1FBW4_E1B19K-01      agacacgcc-------ggcttgta---------gaggatag---------
G1FBW4_E1B19K-02      ccatgcacctgtggaaggcctgggtcaggcagcggggacagagaatcttg
                        *  * **       *** **           * *** **         

G1FBW4_E1B19K-01      -------------ttcagacgggtgctccggtttct--------------
G1FBW4_E1B19K-02      aactactggcttctacagccagcagctccgggtcttcttcgtctacacag
                                   * *** * *  ******* *  *              

G1FBW4_E1B19K-01      --------------------------------------------------
G1FBW4_E1B19K-02      acaaacatccatgttggaggaagagatgagggaggccatggacgagaacc
                                                                        

G1FBW4_E1B19K-01      ----------------------------ggaggcactggtttggatc---
G1FBW4_E1B19K-02      cgaggagcggcctggaccctccgtcggaagaggagctggattgaatcagg
                                                   ****  **** *** ***   

G1FBW4_E1B19K-01      ------tcctctatc-----------------------------------
G1FBW4_E1B19K-02      tatccagcctgtatccagagcttagcaaggtgctgacaaccatggccagg
                             *** ****                                   

G1FBW4_E1B19K-01      --------------------------------------------------
G1FBW4_E1B19K-02      ggagtgaagagggagaggagcgatgggggcaataccgggatgatgaccga
                                                                        

G1FBW4_E1B19K-01      --------------------------------------------------
G1FBW4_E1B19K-02      gctgacagccagcctgatgaatcgcaggcgacctgagcgcattacctggc
                                                                        

G1FBW4_E1B19K-01      --------------------------------------------------
G1FBW4_E1B19K-02      acgagctacagcaggagtgcagggatgagataggcctgatgcaggataaa
                                                                        

G1FBW4_E1B19K-01      --tcgcctggtgta----------cactgtt--------aagaaggatta
G1FBW4_E1B19K-02      tatggcctggagcagataaaaacccactggttgaacccagatgaggattg
                        * ****** * *          ***** *         *  ****** 

G1FBW4_E1B19K-01      tcaggaggaatttgaaaatctttttgcc--gattgctctg----------
G1FBW4_E1B19K-02      ggaggaggccattaagaa---atatgccaagatagccctgcgcccagatt
                        ******   ** * **    * ****  *** ** ***          

G1FBW4_E1B19K-01      --------------------------------------gcctgc------
G1FBW4_E1B19K-02      gcaagtacagggtgaccaagacggtgaatatcagacatgcctgctacatc
                                                            ******      

G1FBW4_E1B19K-01      -------------------------ttgattcactgaatc--tcggccac
G1FBW4_E1B19K-02      tcagggaacggggcagaggtgatcattgataccctggataaggctgcctt
                                               ***** * *** **    * ***  

G1FBW4_E1B19K-01      caggctct------------------------------------------
G1FBW4_E1B19K-02      caggtgttgcatgatgggaatgagagccggtgtgatgaatatgaattcca
                      ****   *                                          

G1FBW4_E1B19K-01      ---tttccaggaa----------------------------agggta---
G1FBW4_E1B19K-02      tgatcttcatgaacatcaagttcaatggagagaagtttaatggggtgctg
                         * * ** ***                             ****    

G1FBW4_E1B19K-01      ------------------------ctccacagccttgatttttccagccc
G1FBW4_E1B19K-02      ttcatggccaacagccatatgaccctgcatggctgtaatttctttggctt
                                              ** **  **  * **** *   **  

G1FBW4_E1B19K-01      aggccgca------ctacagccggtgttgcatt-------------tgtg
G1FBW4_E1B19K-02      taacaacatgtgtgcagaagtctggggtgcttccaagatcaggggatgta
                         *  **      *   ** * * * *** *              *** 

G1FBW4_E1B19K-01      gtgtttctggttgacaaatgg----agccagcaaaccca-----------
G1FBW4_E1B19K-02      agttttttggctgctggatgggagtggtcggaaggcccaagagcgagatg
                         *** *** **    ****     * * * *  ****           

G1FBW4_E1B19K-01      ------------------------------------------cctaacca
G1FBW4_E1B19K-02      tctgtgaagcagtgtgtgtttgagaagtgctacctggccgtgtctaccga
                                                                 *** * *

G1FBW4_E1B19K-01      ggg-----------------------------------------------
G1FBW4_E1B19K-02      gggcaatgctagagtgagacattgctcttccatggagacgggttgcttct
                      ***                                               

G1FBW4_E1B19K-01      --------------------------------------------------
G1FBW4_E1B19K-02      gcctggtgaagggtacagcctcgatcaagcataatgtgatcaaggggtgt
                                                                        

G1FBW4_E1B19K-01      ----------------attacatcctggacttc-----------------
G1FBW4_E1B19K-02      actgatgagcgcatgtataacatgctgacctgcgactcgggggtctgcca
                                      ** **** ***  ** *                 

G1FBW4_E1B19K-01      -----------acggccatg--------cacctgtggaag----------
G1FBW4_E1B19K-02      tatcctgaagaacatccatgtgacctcccaccccaggaagaggtggccat
                                 **  *****        ****   *****          

G1FBW4_E1B19K-01      --------------gcctgggtcagg------------------------
G1FBW4_E1B19K-02      catttgaaaataatgtcctgatcaagtgccacgtgcacctgggagccaga
                                    * *  * *** *                        

G1FBW4_E1B19K-01      ------------cagcggggacagagaatcttga-------------act
G1FBW4_E1B19K-02      aggggcaccttccagccgtaccagtgcaactttagccagaccaagctgct
                                  **** *   *** * * *** *              **

G1FBW4_E1B19K-01      actgg----------cttctacag-----------ccagcagctccg---
G1FBW4_E1B19K-02      gctggagaacgatgccttctccagggtgaacctgaacggcatctttgaca
                       ****          ***** ***            * *** **  *   

G1FBW4_E1B19K-01      -ggtcttcttcgtctaca-----cagacaaac-----------atccatg
G1FBW4_E1B19K-02      tggatgtctcggtgtacaagatcctgagatacgatgagaccaggtccagg
                       **   ***  ** ****     * ** * **            **** *

G1FBW4_E1B19K-01      tt----------------ggaggaag--------agatgagg---gaggc
G1FBW4_E1B19K-02      gtgcgcgcttgcgagtgcgggggcaggcacaccaggatgcagcctgtggc
                       *                ** ** **         ****  *   * ***

G1FBW4_E1B19K-01      catggacgagaacccgaggagc----------------------ggcctg
G1FBW4_E1B19K-02      cctggatgtga--cagaggagctgagaccagaccacctggtgatggcctg
                      * **** * **  * *******                      ******

G1FBW4_E1B19K-01      gacc--------------ctccgtcggaagaggagctggattga
G1FBW4_E1B19K-02      taccggaaccgagttcagctccagcgg-ggaggacacagattag
                       ***              ****  ***  *****    ****  

© 1998-2020Legal notice