Dataset for CDS E1B19K of organism Human adenovirus 56

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

E1AI10_E1B19K-02        atggagccaggacacccaactgagcaggggcta-catcctggacttcgca
A0A1Y1BXT7_E1B19K-      atggat-----------------gtgtggactatccttgcagactt--ta
E1AI10_E1B19K-01        atggat-----------------gtgtggactatccttgcagactt--ta
                        *****                  *   ** *** * *    *****   *

E1AI10_E1B19K-02        gccatgcacctgtggagggcctggatcaggcagcggggacagagaatctt
A0A1Y1BXT7_E1B19K-      gcaagacac-----gccggcttgta---------gaggatag--------
E1AI10_E1B19K-01        gcaagacac-----gccggcttgta---------gaggatag--------
                        ** *  ***     *  *** ** *         * *** **        

E1AI10_E1B19K-02        gaattactggcttctacagccagcagctccgggtcttcttcgtctacaca
A0A1Y1BXT7_E1B19K-      --------------ttcagacgggtgctccgggttct-------------
E1AI10_E1B19K-01        --------------ttcagacgggtgctccgggttct-------------
                                      * *** * *  *********  *             

E1AI10_E1B19K-02        gacaaacatccatgttggaggaagaaatgaggcaggccatggacgagaac
A0A1Y1BXT7_E1B19K-      --------------------------------------------------
E1AI10_E1B19K-01        --------------------------------------------------

E1AI10_E1B19K-02        ccgaggagcggcctggaccctccgtcggaagaggagctggattgaa--tc
A0A1Y1BXT7_E1B19K-      -----------------------------ggagacactggtttggaactc
E1AI10_E1B19K-01        -----------------------------ggagacactggtttggaactc
                                                      ***   **** *** *  **

E1AI10_E1B19K-02        aggtatccagcctgtacccagagcttagcaaggtgctgacatccatggcc
A0A1Y1BXT7_E1B19K-      ctctatctcgcct------------------ggtgtacac----------
E1AI10_E1B19K-01        ctctatctcgcct------------------ggtgtacac----------
                           ****  ****                  ****   **          

E1AI10_E1B19K-02        aggggagttaagagggagaggagcgatgggggtaataccgggatgatgac
A0A1Y1BXT7_E1B19K-      -----agttaagaagga---------------------------------
E1AI10_E1B19K-01        -----agttaagaagga---------------------------------
                             ******** ***                                 

E1AI10_E1B19K-02        cgagctgacggccagcctgatgaatcggaagcgcccagagcgccttacct
A0A1Y1BXT7_E1B19K-      --------------------------------------------------
E1AI10_E1B19K-01        --------------------------------------------------

E1AI10_E1B19K-02        ggtacgagctacagcaggagtgcagggatgagttgggcctgatgcaggat
A0A1Y1BXT7_E1B19K-      --------------------------------------------------
E1AI10_E1B19K-01        --------------------------------------------------

E1AI10_E1B19K-02        aaatatggcctggagcagataaaaacccattggttgaacccagatgagga
A0A1Y1BXT7_E1B19K-      --------------------------------------------------
E1AI10_E1B19K-01        --------------------------------------------------

E1AI10_E1B19K-02        ttgggaggaggctattaagaagtatgccaagatagccctgcgcccagatt
A0A1Y1BXT7_E1B19K-      -----------ttataaagaggaatttgaaaatatttttgct----gact
E1AI10_E1B19K-01        -----------ttataaagaggaatttgaaaatatttttgct----gact
                                    *** **** * **   ** ***    ***     ** *

E1AI10_E1B19K-02        gcaagtacatagtgaccaagaccgtgaatatcagacatgcctgctacatc
A0A1Y1BXT7_E1B19K-      gc----------------------------tctg----gcctgctagatt
E1AI10_E1B19K-01        gc----------------------------tctg----gcctgctagatt
                        **                            ** *    ******** ** 

E1AI10_E1B19K-02        tcggggaacggggcagaggtggtcatcgataccctggacaaggccgcctt
A0A1Y1BXT7_E1B19K-      ctctgaatc---------ttggccaccagtccctt---------------
E1AI10_E1B19K-01        ctctgaatc---------ttggccaccagtccctt---------------
                            * * *          *** ** *  * ** *               

E1AI10_E1B19K-02        caggtgttgcatgatgggaatgagagcaggagtgatgaatatgaattcca
A0A1Y1BXT7_E1B19K-      ---------------------------------------------ttcca
E1AI10_E1B19K-01        ---------------------------------------------ttcca

E1AI10_E1B19K-02        tgatcttcatgaacatgaagttcaatggagagaagtttaatggggtgctg
A0A1Y1BXT7_E1B19K-      --------------------------ggaaa-----------gggtact-
E1AI10_E1B19K-01        --------------------------ggaaa-----------gggtact-
                                                  *** *           **** ** 

E1AI10_E1B19K-02        ttcatggccaacagccacatgaccctgcatggctgcagtttcttcggctt
A0A1Y1BXT7_E1B19K-      --------------ccaca------------gccttgatttttccagccc
E1AI10_E1B19K-01        --------------ccaca------------gccttgatttttccagccc
                                      *****            **     *** * * **  

E1AI10_E1B19K-02        caacaatatgtgcgcagaggtctggggcgcttccaagatcaggggatgta
A0A1Y1BXT7_E1B19K-      agg------gcgcactacagccggggttgcttt-------------tgtg
E1AI10_E1B19K-01        agg------gcgcactacagccggggttgcttt-------------tgtg
                                 * ** *    * * ***  ****              *** 

E1AI10_E1B19K-02        agttttatggctgctggatgggcgtggtcggaagacccaagagcgagatg
A0A1Y1BXT7_E1B19K-      gtttttctggttgacaaatgg----agccaggacacccaa----------
E1AI10_E1B19K-01        gtttttctggttgacaaatgg----agccaggacacccaa----------
                          **** *** **    ****     * * * * ******          

E1AI10_E1B19K-02        tctgtgaagcagtgtgtgtttgagaaatgctacctgggagtctctaccga
A0A1Y1BXT7_E1B19K-      --------------------------------------------------
E1AI10_E1B19K-01        --------------------------------------------------

E1AI10_E1B19K-02        gggcaatgctagagtgagacactgctcttccctggagacgggctgcttct
A0A1Y1BXT7_E1B19K-      -------------------------------ctgagcaggggctacatcc
E1AI10_E1B19K-01        -------------------------------ctgagcaggggctacatcc
                                                       ***   * ***** * ** 

E1AI10_E1B19K-02        gcctggtgaagggcacagcctctctgaagcataatatggtgaagggctgc
A0A1Y1BXT7_E1B19K-      ------tggacttcgcagc-------------------------------
E1AI10_E1B19K-01        ------tggacttcgcagc-------------------------------
                              ** *   * ****                               

E1AI10_E1B19K-02        acggatgagcgcatgtacaacatgctgacctgcgattcgggggtctgcca
A0A1Y1BXT7_E1B19K-      --------------------catgc--acctgtg----gagggcctg---
E1AI10_E1B19K-01        --------------------catgc--acctgtg----gagggcctg---
                                            *****  ***** *    * *** ***   

E1AI10_E1B19K-02        tatcctgaagaacatccatgtgacctcccaccccagaaagaagtggccag
A0A1Y1BXT7_E1B19K-      --------------------------------------------------
E1AI10_E1B19K-01        --------------------------------------------------

E1AI10_E1B19K-02        tgtttgagaataacctgctgatcaagtgccatatgcacctgggagccaga
A0A1Y1BXT7_E1B19K-      -------------------gatcagg------------------------
E1AI10_E1B19K-01        -------------------gatcagg------------------------
                                           ***** *                        

E1AI10_E1B19K-02        aggggcaccttccagccgtaccagtgcaactttagccagaccaagctgct
A0A1Y1BXT7_E1B19K-      ------------cagcggggacagaaaatcttgaatta------------
E1AI10_E1B19K-01        ------------cagcggggacagagaatcttgaatta------------
                                    **** *   ***   * *** *   *            

E1AI10_E1B19K-02        gttggagaacgatgccttctccagggtgaacctgaacggcatctttgaca
A0A1Y1BXT7_E1B19K-      -----------ctggcttctacag-----------ccagcagctccg---
E1AI10_E1B19K-01        -----------ctggcttctacag-----------ccagcagctccg---
                                    ** ***** ***            * *** **  *   

E1AI10_E1B19K-02        tggatgtctcggtgtacaagatcctgagatacgatgagaccaa-gtccag
A0A1Y1BXT7_E1B19K-      -ggtcttcttcgtctacac-----------------agacaaacatccat
E1AI10_E1B19K-01        -ggtcttcttcgtctacac-----------------agacaaacatccat
                         **   ***  ** ****                  **** **  **** 

E1AI10_E1B19K-02        ggtgcgcgcttgcgagtgcgggggaagacacaccaggatgcagccagtgg
A0A1Y1BXT7_E1B19K-      gtt----------------ggaggaagaaat-----gaggca------gg
E1AI10_E1B19K-01        gtt----------------ggaggaagaaat-----gaggca------gg
                        * *                ** ****** *      ** ***      **

E1AI10_E1B19K-02        ccctggatgtga--ccgaggagctgagaccagaccacctggtgatggcct
A0A1Y1BXT7_E1B19K-      ccatggacgagaacccgaggagc----------------------ggcct
E1AI10_E1B19K-01        ccatggacgagaacccgaggagc----------------------ggcct
                        ** **** * **  *********                      *****

E1AI10_E1B19K-02        gtaccgggaccgagttcagctccagtgg-ggaggacacagattag
A0A1Y1BXT7_E1B19K-      ggacc--------------ctccgtcggaagaggagctggattga
E1AI10_E1B19K-01        ggacc--------------ctccgtcggaagaggagctggattga
                        * ***              ****   **  *****    ****  

© 1998-2022Legal notice