Dataset for CDS E1B19K of organism Human adenovirus 56

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A1Y1BXT7_E1B19K-      atggatgtgtggactatccttgcagactttagcaagacacgccggcttgt
E1AI10_E1B19K-01        atggatgtgtggactatccttgcagactttagcaagacacgccggcttgt

A0A1Y1BXT7_E1B19K-      agaggatagttcagacgggtgctccgggttctggagacactggtttggaa
E1AI10_E1B19K-01        agaggatagttcagacgggtgctccgggttctggagacactggtttggaa

A0A1Y1BXT7_E1B19K-      ctcctctatctcgcctggtgtacacagttaagaaggattataaagaggaa
E1AI10_E1B19K-01        ctcctctatctcgcctggtgtacacagttaagaaggattataaagaggaa

A0A1Y1BXT7_E1B19K-      tttgaaaatatttttgctgactgctctggcctgctagattctctgaatct
E1AI10_E1B19K-01        tttgaaaatatttttgctgactgctctggcctgctagattctctgaatct

A0A1Y1BXT7_E1B19K-      tggccaccagtcccttttccaggaaagggtactccacagccttgattttt
E1AI10_E1B19K-01        tggccaccagtcccttttccaggaaagggtactccacagccttgattttt

A0A1Y1BXT7_E1B19K-      ccagcccagggcgcactacagccggggttgcttttgtggtttttctggtt
E1AI10_E1B19K-01        ccagcccagggcgcactacagccggggttgcttttgtggtttttctggtt

A0A1Y1BXT7_E1B19K-      gacaaatggagccaggacacccaactgagcaggggctacatcctggactt
E1AI10_E1B19K-01        gacaaatggagccaggacacccaactgagcaggggctacatcctggactt

A0A1Y1BXT7_E1B19K-      cgcagccatgcacctgtggagggcctggatcaggcagcggggacagaaaa
E1AI10_E1B19K-01        cgcagccatgcacctgtggagggcctggatcaggcagcggggacagagaa
                        *********************************************** **

A0A1Y1BXT7_E1B19K-      tcttgaattactggcttctacagccagcagctccgggtcttcttcgtcta
E1AI10_E1B19K-01        tcttgaattactggcttctacagccagcagctccgggtcttcttcgtcta

A0A1Y1BXT7_E1B19K-      cacagacaaacatccatgttggaggaagaaatgaggcaggccatggacga
E1AI10_E1B19K-01        cacagacaaacatccatgttggaggaagaaatgaggcaggccatggacga

A0A1Y1BXT7_E1B19K-      gaacccgaggagcggcctggaccctccgtcggaagaggagctggattga
E1AI10_E1B19K-01        gaacccgaggagcggcctggaccctccgtcggaagaggagctggattga

© 1998-2020Legal notice