Dataset for CDS E1B19K of organism Human adenovirus 55

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A7G5FB98_E1B19K-      atggatcccgcagactcatttcagcaggggatacgttttggatttcgtag
C7SRS7_E1B19K-01        atgga-----------------------------ggtttgggc-------
A0A7G5FB98_E1B19K-      atgga-----------------------------ggtttgggc-------
A0A7G5F9T0_E1B19K-      atgga-----------------------------ggtttgggc-------
J7H4R9_E1B19K-01        atgga-----------------------------ggtttgggc-------
                        *****                             * *****         

A0A7G5FB98_E1B19K-      ccacagcattgtggagaacatggaaggttcgcaagatgaggacaatctta
C7SRS7_E1B19K-01        ------cattttggaagacc-------ttagaaagactagg---------
A0A7G5FB98_E1B19K-      ------cattttggaagacc-------ttagaaagactagg---------
A0A7G5F9T0_E1B19K-      ------cattttggaagacc-------ttagaaagactagg---------
J7H4R9_E1B19K-01        ------cattttggaagacc-------ttagaaagactagg---------
                              **** ****  **        ** * ****  ***         

A0A7G5FB98_E1B19K-      ggttactggccagtgcagcctttgggtgtagcgggaatcctgaggcatcc
C7SRS7_E1B19K-01        --------------------------------------------------
A0A7G5FB98_E1B19K-      --------------------------------------------------
A0A7G5F9T0_E1B19K-      --------------------------------------------------
J7H4R9_E1B19K-01        --------------------------------------------------

A0A7G5FB98_E1B19K-      accggtcatgccagcggttctggaggaggaacagcaagaggacaacccga
C7SRS7_E1B19K-01        -----------caactgtt-----------------agagaacgcttcg-
A0A7G5FB98_E1B19K-      -----------caactgtt-----------------agagagcgcttcg-
A0A7G5F9T0_E1B19K-      -----------caactgtt-----------------agagaacgcttcg-
J7H4R9_E1B19K-01        -----------caactgtt-----------------agagaacgcttcg-
                                   ** * ***                 ****  *    ** 

A0A7G5FB98_E1B19K-      gagccggcctggaccctccagtggaggaggcggagtagctgacttgtctc
C7SRS7_E1B19K-01        ----------------------------gacgga-----------gtctc
A0A7G5FB98_E1B19K-      ----------------------------gacgga-----------gtctc
A0A7G5F9T0_E1B19K-      ----------------------------gacgga-----------gtctc
J7H4R9_E1B19K-01        ----------------------------gacgga-----------gtctc
                                                    * ****           *****

A0A7G5FB98_E1B19K-      ctgaactgcaacgggtgcttactggatttacgtccactggacgggatagg
C7SRS7_E1B19K-01        c-------------------------------------------------
A0A7G5FB98_E1B19K-      c-------------------------------------------------
A0A7G5F9T0_E1B19K-      c-------------------------------------------------
J7H4R9_E1B19K-01        c-------------------------------------------------

A0A7G5FB98_E1B19K-      ggcgttaaaagggagagggcatctagtggtactgatgctagatctgagtt
C7SRS7_E1B19K-01        --------------------------------------------------
A0A7G5FB98_E1B19K-      --------------------------------------------------
A0A7G5F9T0_E1B19K-      --------------------------------------------------
J7H4R9_E1B19K-01        --------------------------------------------------

A0A7G5FB98_E1B19K-      ggctttaagtttaatgagtcgcagacgtcctgaaaccatttggtggcatg
C7SRS7_E1B19K-01        ggtttt--------------------------------------------
A0A7G5FB98_E1B19K-      ggtttt--------------------------------------------
A0A7G5F9T0_E1B19K-      ggtttt--------------------------------------------
J7H4R9_E1B19K-01        ggtttt--------------------------------------------
                        ** ***                                            

A0A7G5FB98_E1B19K-      aggtccagaaagagggaagggatgaagtttctgtattgcaggagaaatat
C7SRS7_E1B19K-01        ----------------------tggagattctggttcgctagtgaaata-
A0A7G5FB98_E1B19K-      ----------------------tggagattctggttcgctagtgaatta-
A0A7G5F9T0_E1B19K-      ----------------------tggagattctggttcgctagtgaatta-
J7H4R9_E1B19K-01        ----------------------tggagattctggttcgctagtgaatta-
                                              ** ** *****  * **  * *** ** 

A0A7G5FB98_E1B19K-      tcactggaacaggtgaaaacatgttggttggagcctgaggatgattggga
C7SRS7_E1B19K-01        --------------------------------------------------
A0A7G5FB98_E1B19K-      --------------------------------------------------
A0A7G5F9T0_E1B19K-      --------------------------------------------------
J7H4R9_E1B19K-01        --------------------------------------------------

A0A7G5FB98_E1B19K-      ggtggccattaaaaattatgccaagatagctttgaggcctgataaacagt
C7SRS7_E1B19K-01        -------------------gctagggtagtttttag----gataaa----
A0A7G5FB98_E1B19K-      -------------------gctagggtagtttttag----gataaa----
A0A7G5F9T0_E1B19K-      -------------------gctagggtagtttttag----gataaa----
J7H4R9_E1B19K-01        -------------------gctagggtagtttttag----gataaa----
                                           ** * * *** *** **    ******    

A0A7G5FB98_E1B19K-      ataagattactagacggattaatatccggaatgcttgttacatatctgga
C7SRS7_E1B19K-01        acaggactataaagaaga-------------------------atttgaa
A0A7G5FB98_E1B19K-      acaggactataaagaaga-------------------------atttgaa
A0A7G5F9T0_E1B19K-      acaggactataaagaaga-------------------------atttgaa
J7H4R9_E1B19K-01        acaggactataaagaaga-------------------------atttgaa
                        * * ** **  *    **                         ** ** *

A0A7G5FB98_E1B19K-      aatggggctgaggtggtaatagatactccagacaagacagttattagatg
C7SRS7_E1B19K-01        a---------agttgttggtagattgcccag-------gactttttgaag
A0A7G5FB98_E1B19K-      a---------agttgttggtagattgcccag-------gactttttgaag
A0A7G5F9T0_E1B19K-      a---------agttgttggtagattgcccag-------gactttttgaag
J7H4R9_E1B19K-01        a---------agttgttggtagattgcccag-------gactttttgaag
                        *         ** ** *  *****   ****          * ** ** *

A0A7G5FB98_E1B19K-      ctgcatgatggatatgtggcctggagtagtcggtatggaagcagtaactt
C7SRS7_E1B19K-01        ct-----cttaatttgggtcatcaagttcactttaaagaaaaag----tt
A0A7G5FB98_E1B19K-      ct-----cttaatttgggtcatcaagttcactttaaagaaaaag----tt
A0A7G5F9T0_E1B19K-      ct-----cttaatttgggtcatcaagttcactttaaagaaaaag----tt
J7H4R9_E1B19K-01        ct-----cttaatttgggtcatcaagttcactttaaagaaaaag----tt
                        **      *  ** ** * * *  ***   *  **  ***  **    **

A0A7G5FB98_E1B19K-      ttgtaaatgttaagtttaggggagatggttataatggaatagtgtttatg
C7SRS7_E1B19K-01        ttatcagttttagact----------------------------tttcga
A0A7G5FB98_E1B19K-      ttatcagttttagact----------------------------tttcga
A0A7G5F9T0_E1B19K-      ttatcagttttagact----------------------------tttcga
J7H4R9_E1B19K-01        ttatcagttttagact----------------------------tttcga
                        ** * * * ***   *                            ***   

A0A7G5FB98_E1B19K-      gccaataccaaacttatattgcatggttgtagcttttttggttttaacaa
C7SRS7_E1B19K-01        ccccaggtagaactgctgctgc-----tgtggcttttcttacttttatat
A0A7G5FB98_E1B19K-      ccccaggtagaactgccgctgc-----tgtggcttttcttacttttatat
A0A7G5F9T0_E1B19K-      ccccaggtagaactgccgctgc-----tgtggcttttcttacttttatat
J7H4R9_E1B19K-01        ccccaggtagaactgccgctgc-----tgtggcttttcttacttttatat
                         ** *     ****     ***     *** ****** *   *** * * 

A0A7G5FB98_E1B19K-      tacctgtgtagatgcctggggacaggttagtgtacggggatgtagtttct
C7SRS7_E1B19K-01        tagataaatggat-cccgcagactcatttcagcagggg------------
A0A7G5FB98_E1B19K-      tagataaatggat-cccgcagactcatttcagcagggg------------
A0A7G5F9T0_E1B19K-      tagataaatggat-cccgcagactcatttcagcagggg------------
J7H4R9_E1B19K-01        tagataaatggat-cccgcagactcatttcagcagggg------------
                        **  *   * *** ** *  ***   **   * * ***            

A0A7G5FB98_E1B19K-      atgcgtgttggatt-----gccacagctggcagaaccaagagtcaattgt
C7SRS7_E1B19K-01        atacgttttggatttcgtagccacagc------------------attg-
A0A7G5FB98_E1B19K-      atacgttttggatttcgtagccacagc------------------attg-
A0A7G5F9T0_E1B19K-      atacgttttggatttcgtagccacagc------------------attg-
J7H4R9_E1B19K-01        atacgttttggatttcgtagccacagc------------------attg-
                        ** *** *******     ********                  **** 

A0A7G5FB98_E1B19K-      ctctgaagaaatgcatattccaaagatgtaacctgggcattcttaatgaa
C7SRS7_E1B19K-01        ---tggag---------------------aacatgg--------------
A0A7G5FB98_E1B19K-      ---tggag---------------------aacatgg--------------
A0A7G5F9T0_E1B19K-      ---tggag---------------------aacatgg--------------
J7H4R9_E1B19K-01        ---tggag---------------------aacatgg--------------
                           ** **                     *** ***              

A0A7G5FB98_E1B19K-      ggcgaagcaagggtccgccactgcgcttctacagatactggatgttttat
C7SRS7_E1B19K-01        ---------aaggttcgcaa--------------------gatg------
A0A7G5FB98_E1B19K-      ---------aaggttcgcaa--------------------gatg------
A0A7G5F9T0_E1B19K-      ---------aaggttcgcaa--------------------gatg------
J7H4R9_E1B19K-01        ---------aaggttcgcaa--------------------gatg------
                                 * *** *** *                    ****      

A0A7G5FB98_E1B19K-      tttaattaagggcaatgccagcgtaaagcataacatgatttgcggtgctt
C7SRS7_E1B19K-01        --------aggacaat----------------------------------
A0A7G5FB98_E1B19K-      --------aggacaat----------------------------------
A0A7G5F9T0_E1B19K-      --------aggacaat----------------------------------
J7H4R9_E1B19K-01        --------aggacaat----------------------------------
                                *** ****                                  

A0A7G5FB98_E1B19K-      ccgatgagaggccttatcaaatgctcacttgtgccggtgggcattgtaac
C7SRS7_E1B19K-01        ------------ctta----------------------------------
A0A7G5FB98_E1B19K-      ------------ctta----------------------------------
A0A7G5F9T0_E1B19K-      ------------ctta----------------------------------
J7H4R9_E1B19K-01        ------------ctta----------------------------------

A0A7G5FB98_E1B19K-      atgctggctactgtgcatattgtttctcatcaacgcaaaaaatggcctgt
C7SRS7_E1B19K-01        -----ggttactg-------------------------------------
A0A7G5FB98_E1B19K-      -----ggttactg-------------------------------------
A0A7G5F9T0_E1B19K-      -----ggttactg-------------------------------------
J7H4R9_E1B19K-01        -----ggttactg-------------------------------------
                             ** *****                                     

A0A7G5FB98_E1B19K-      ttttgatcacaatgtgttgaccaagtgtaccatgcatgcaggtgggcgta
C7SRS7_E1B19K-01        --------------------------------------------------
A0A7G5FB98_E1B19K-      --------------------------------------------------
A0A7G5F9T0_E1B19K-      --------------------------------------------------
J7H4R9_E1B19K-01        --------------------------------------------------

A0A7G5FB98_E1B19K-      gaggaatgtttatgccttaccagtgtaacatgaatcatgtaaaagtgttg
C7SRS7_E1B19K-01        ------------------gccagtgca-----------------------
A0A7G5FB98_E1B19K-      ------------------gccagtgca-----------------------
A0A7G5F9T0_E1B19K-      ------------------gccagtgca-----------------------
J7H4R9_E1B19K-01        ------------------gccagtgca-----------------------
                                           ****** *                       

A0A7G5FB98_E1B19K-      ttagaaccagatgccttttccagaatgagtctaacaggaatgtttgacat
C7SRS7_E1B19K-01        ------------gcctt--------tgggtgtagcggga-----------
A0A7G5FB98_E1B19K-      ------------gcctt--------tgggtgtagcggga-----------
A0A7G5F9T0_E1B19K-      ------------gcctt--------tgggtgtagcggga-----------
J7H4R9_E1B19K-01        ------------gcctt--------tgggtgtagcggga-----------
                                    *****        ** ** ** * ***           

A0A7G5FB98_E1B19K-      gaacatgcaaatctggaagatcctgaggtatgatgatacaagatcgaggg
C7SRS7_E1B19K-01        -------------------atcctgaggc-------------atccaccg
A0A7G5FB98_E1B19K-      -------------------atcctgaggc-------------atccaccg
A0A7G5F9T0_E1B19K-      -------------------atcctgaggc-------------atctaccg
J7H4R9_E1B19K-01        -------------------atcctgaggc-------------atccaccg
                                           *********              *** *  *

A0A7G5FB98_E1B19K-      tgcgcgcatgcgaatgcggaggcaagcatgccaggttccagccggtgtgt
C7SRS7_E1B19K-01        gtcatgccagcggttctggagg-aggaa----------cagcaagag---
A0A7G5FB98_E1B19K-      gtcatgccagcggttctggagg-aggaa----------cagcaagag---
A0A7G5F9T0_E1B19K-      gtcatgccagcggttctggagg-aggaa----------cagcaagag---
J7H4R9_E1B19K-01        gtcatgccagcggttctggagg-aggaa----------cagcaagag---
                          *  **  ***  *  ***** * * *          ****  * *   

A0A7G5FB98_E1B19K-      gtagatgtgactgaagatctgagaccggatcatttggttattgcccgcac
C7SRS7_E1B19K-01        ------------gacaacccgaga------------------gccggc-c
A0A7G5FB98_E1B19K-      ------------gacaacccgaga------------------gccggc-c
A0A7G5F9T0_E1B19K-      ------------gacaacccgaga------------------gccggc-c
J7H4R9_E1B19K-01        ------------gacaacccgaga------------------gccggc-c
                                    **  * * ****                  *** ** *

A0A7G5FB98_E1B19K-      tggagcagagttcggatccagtggagaagaaactgactaa
C7SRS7_E1B19K-01        tggacc---------ctccagtggag--gaggcggagtag
A0A7G5FB98_E1B19K-      tggacc---------ctccagtggag--gaggcggagtag
A0A7G5F9T0_E1B19K-      tggacc---------ctccagtggag--gaggcggagtag
J7H4R9_E1B19K-01        tggacc---------ctccagtggag--gaggcggagtag
                        **** *          **********  **  * ** ** 

© 1998-2022Legal notice