Dataset for CDS E1B19K of organism Human adenovirus 53

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q9FFS0_E1B19K-      atggagccagaacacccaactgagcaggggcta-cattctggactttg--
A0A3Q9FFS0_E1B19K-      atggat-----------------gtgtggagtatccttgcagactttagc
E5RWD9_E1B19K-01        atggat-----------------gtgtggactatccttgcagactttagc
E5RWL1_E1B19K-01        atggat-----------------gtgtggactatccttgcagactttagc
                        *****                  *   **  ** * **   ******   

A0A3Q9FFS0_E1B19K-      cagccatgc--acctgtggagggcatgggtgaggcagcggggacagagaa
A0A3Q9FFS0_E1B19K-      aagacacgccgacttgtagaggata-------------------------
E5RWD9_E1B19K-01        aagacacgccgacttgtagaggata-------------------------
E5RWL1_E1B19K-01        aagacacgccgacttgtagaggata-------------------------
                         ** ** **  ** *** ****  *                         

A0A3Q9FFS0_E1B19K-      tcttgaactactggcttatacagccagcagctccgggtcttcttcgtcta
A0A3Q9FFS0_E1B19K-      -----------------gttcagacgggtgctccgggttct---------
E5RWD9_E1B19K-01        -----------------gttcagacgggtgctccgggttct---------
E5RWL1_E1B19K-01        -----------------gttcagacgggtgctccgggttct---------
                                          * *** * *  *********  *         

A0A3Q9FFS0_E1B19K-      cacagacaaacatccatgttggaggaagaaatgaggcaggccatggacga
A0A3Q9FFS0_E1B19K-      --------------------------------------------------
E5RWD9_E1B19K-01        --------------------------------------------------
E5RWL1_E1B19K-01        --------------------------------------------------

A0A3Q9FFS0_E1B19K-      gaacccgaggagcggcctggaccctccgtcggaagaggagctggattgaa
A0A3Q9FFS0_E1B19K-      ---------------------------------ggagacactggtttgga
E5RWD9_E1B19K-01        ---------------------------------ggagacactggtttgga
E5RWL1_E1B19K-01        ---------------------------------ggagacactggtttgga
                                                          ***   **** *** *

A0A3Q9FFS0_E1B19K-      tcaggtatccagcttgtacccagagcttagcaaggtgctgacatccatgg
A0A3Q9FFS0_E1B19K-      ac--tcctctatctcgt--------------------ctggtgtacacag
E5RWD9_E1B19K-01        ac--tcctctatctcgt--------------------ctggtgtacacag
E5RWL1_E1B19K-01        ac--tcctctatctcgt--------------------ctggtgtacacag
                         *     ** * ** **                    ***   * **  *

A0A3Q9FFS0_E1B19K-      ccaggggagtgaagagggagaggagcgatgggggcaataccgggatgatg
A0A3Q9FFS0_E1B19K-      tta-----------------------------------------------
E5RWD9_E1B19K-01        tta-----------------------------------------------
E5RWL1_E1B19K-01        tta-----------------------------------------------

A0A3Q9FFS0_E1B19K-      accgagctgacggccagcctgatgaatcgcaagcgcccagagcgcattac
A0A3Q9FFS0_E1B19K-      --------------------------------------------------
E5RWD9_E1B19K-01        --------------------------------------------------
E5RWL1_E1B19K-01        --------------------------------------------------

A0A3Q9FFS0_E1B19K-      ctggcacgagctacagatggagtgcagggatgagttgggcctgatgcagg
A0A3Q9FFS0_E1B19K-      --------------agaaggattataacgaggaatt--------------
E5RWD9_E1B19K-01        --------------agaaggattataacgaggaatt--------------
E5RWL1_E1B19K-01        --------------agaaggattataacgaggaatt--------------
                                      *** *** *  *  ** ** **              

A0A3Q9FFS0_E1B19K-      ataaatatggcctggagcagataaaaacacattggttgaacccagatgag
A0A3Q9FFS0_E1B19K-      ---------------------tgaaaatctttttgct-------------
E5RWD9_E1B19K-01        ---------------------tgaaaatctttttgct-------------
E5RWL1_E1B19K-01        ---------------------tgaaaatctttttgct-------------
                                             * ****    ** * *             

A0A3Q9FFS0_E1B19K-      gattgggaggaggccattaagaaatatgccaagatagccctgcgcccaga
A0A3Q9FFS0_E1B19K-      --------------------------------gattgctctg--------
E5RWD9_E1B19K-01        --------------------------------gattgctctg--------
E5RWL1_E1B19K-01        --------------------------------gattgctctg--------
                                                        *** ** ***        

A0A3Q9FFS0_E1B19K-      ttgcaagtacatagtgaccaagaccgtgaatattagacatgcctgctaca
A0A3Q9FFS0_E1B19K-      ----------------------------------------gcctgctaga
E5RWD9_E1B19K-01        ----------------------------------------gcctgctaga
E5RWL1_E1B19K-01        ----------------------------------------gcctgctaga
                                                                ******** *

A0A3Q9FFS0_E1B19K-      tttcggggaacggggcagaggtggtcatcgataccctggacaaggccgcc
A0A3Q9FFS0_E1B19K-      ttctctgaatctcggc---------caccagtccctt-------------
E5RWD9_E1B19K-01        ttctctgaatctcggc---------caccagtccctt-------------
E5RWL1_E1B19K-01        ttctctgaatctcggc---------caccagtccctt-------------
                        **    * * *  ***         ** *  * ** *             

A0A3Q9FFS0_E1B19K-      ttcaggtgttgcatgatgggaatgagagcaggagtgatgaatatgaattc
A0A3Q9FFS0_E1B19K-      --------ttccaggaaagg------------------------gtactc
E5RWD9_E1B19K-01        --------ttccaggaaagg------------------------gtactc
E5RWL1_E1B19K-01        --------ttccaggaaagg------------------------gtactc
                                ** ** **  **                        * * **

A0A3Q9FFS0_E1B19K-      catgatcttcatgaacatgaagttcaatggagagaagtttaatggggtgt
A0A3Q9FFS0_E1B19K-      cacagccttga--------------------------------------t
E5RWD9_E1B19K-01        cacagccttga--------------------------------------t
E5RWL1_E1B19K-01        cacagccttga--------------------------------------t
                        **    *** *                                      *

A0A3Q9FFS0_E1B19K-      tgttcatggccaacagccacatgaccctgcatggctgcagtttctttggc
A0A3Q9FFS0_E1B19K-      ttttc--------cagcc-----------cagggc---------------
E5RWD9_E1B19K-01        ttttc--------cagcc-----------cagggc---------------
E5RWL1_E1B19K-01        ttttc--------cagcc-----------cagggc---------------
                        * ***        *****           ** ***               

A0A3Q9FFS0_E1B19K-      tttaacaatatgtgcgccgaggtctggggcgcttccaagatcaggggatg
A0A3Q9FFS0_E1B19K-      -------------gcactacagccggggttgcttt-------------tg
E5RWD9_E1B19K-01        -------------gcactacagccggggttgcttg-------------tg
E5RWL1_E1B19K-01        -------------gcactacagccggggttgcttt-------------tg
                                     ** *    * * ***  ****              **

A0A3Q9FFS0_E1B19K-      taagttttatggctgctggatgggcgtggtcggaagacccaagagcgaga
A0A3Q9FFS0_E1B19K-      tggtttttctggttgacaaatgg----agccagaacacccaa--------
E5RWD9_E1B19K-01        tggtttttctggttgacaaatgg----agccagaacacccaa--------
E5RWL1_E1B19K-01        tggtttttctggttgacaaatgg----agccagaacacccaa--------
                        *   **** *** **    ****     * * *** ******        

A0A3Q9FFS0_E1B19K-      tgtctgtaaagcagtgtgtgtttgagaaatgctacctgggagtctctacc
A0A3Q9FFS0_E1B19K-      --------------------------------------------------
E5RWD9_E1B19K-01        --------------------------------------------------
E5RWL1_E1B19K-01        --------------------------------------------------

A0A3Q9FFS0_E1B19K-      gagggcaatgctagagtgagacactgctcttccctggatacgggctgctt
A0A3Q9FFS0_E1B19K-      ---------------------------------ctgagcaggggct----
E5RWD9_E1B19K-01        ---------------------------------ctgagcaggggct----
E5RWL1_E1B19K-01        ---------------------------------ctgagcaggggct----
                                                         ***   * *****    

A0A3Q9FFS0_E1B19K-      ctgcctggtgaagggtacggcctctctaaagcataatatggtgaagggct
A0A3Q9FFS0_E1B19K-      --------------------------------------------------
E5RWD9_E1B19K-01        --------------------------------------------------
E5RWL1_E1B19K-01        --------------------------------------------------

A0A3Q9FFS0_E1B19K-      gcacagatgagcgcatgtacaacatgctgacctgcgactcgggggtctgc
A0A3Q9FFS0_E1B19K-      ---------------------acattctggactttg--------------
E5RWD9_E1B19K-01        ---------------------acattctggacttcg--------------
E5RWL1_E1B19K-01        ---------------------acattctggacttcg--------------
                                             **** ***  **  *              

A0A3Q9FFS0_E1B19K-      catatcctgaagaacatccatgtgacctcccaccccagaaagaagtggcc
A0A3Q9FFS0_E1B19K-      --------------cagccatgc---------------------------
E5RWD9_E1B19K-01        --------------cagccatgc---------------------------
E5RWL1_E1B19K-01        --------------cagccatgc---------------------------
                                      ** *****                            

A0A3Q9FFS0_E1B19K-      agtgtttgagaataacctgctgatcaagtgccatatgcacctgggtgcca
A0A3Q9FFS0_E1B19K-      --------------acctgtgga-------------gggcatgggtg---
E5RWD9_E1B19K-01        --------------acctgtgga-------------gggcatgggtg---
E5RWL1_E1B19K-01        --------------acctgtgga-------------gggcatgggtg---
                                      *****  **             *  * ******   

A0A3Q9FFS0_E1B19K-      gaaggggcaccttccagccgtaccagtgcaactttagccagaccaagctg
A0A3Q9FFS0_E1B19K-      --agg---------cagcggggacagagaatcttgaacta----------
E5RWD9_E1B19K-01        --agg---------cagcggggacagagaatcttgaacta----------
E5RWL1_E1B19K-01        --agg---------cagcggggacagagaatcttgaacta----------
                          ***         **** *   *** * * *** * * *          

A0A3Q9FFS0_E1B19K-      ctgttggagaacgatgccttctccagggtgaacctgaacggcatctttga
A0A3Q9FFS0_E1B19K-      -------------ctggcttatacag-----------ccagcagctccg-
E5RWD9_E1B19K-01        -------------ctggcttatacag-----------ccagcagctccg-
E5RWL1_E1B19K-01        -------------ctggcttatacag-----------ccagcagctccg-
                                      ** *** * ***            * *** **  * 

A0A3Q9FFS0_E1B19K-      catggatgtctcggtgtacaagatcctgagatacgatgagaccaa-gtcc
A0A3Q9FFS0_E1B19K-      ---ggtcttcttcgtctacac-----------------agacaaacatcc
E5RWD9_E1B19K-01        ---ggtcttcttcgtctacac-----------------agacaaacatcc
E5RWL1_E1B19K-01        ---ggtcttcttcgtctacac-----------------agacaaacatcc
                           **   ***  ** ****                  **** **  ***

A0A3Q9FFS0_E1B19K-      agggtgcgcgcttgcgagtgcgggggcagacacaccaggatgcagccagt
A0A3Q9FFS0_E1B19K-      atgtt----------------ggaggaagaaat-----gaggca------
E5RWD9_E1B19K-01        atgtt----------------ggaggaagaaat-----gaggca------
E5RWL1_E1B19K-01        atgtt----------------ggaggaagaaat-----gaggca------
                        * * *                ** ** *** *      ** ***      

A0A3Q9FFS0_E1B19K-      ggccctggatgtga--ccgaggagctgagaccagaccacctggtgatggc
A0A3Q9FFS0_E1B19K-      ggccatggacgagaacccgaggagc----------------------ggc
E5RWD9_E1B19K-01        ggccatggacgagaacccgaggagc----------------------ggc
E5RWL1_E1B19K-01        ggccatggacgagaacccgaggagc----------------------ggc
                        **** **** * **  *********                      ***

A0A3Q9FFS0_E1B19K-      ctgtaccgggaccgagttcagctccagtgg-ggaggacacagattag
A0A3Q9FFS0_E1B19K-      ctggacc--------------ctccgtcggaagaggagctggattga
E5RWD9_E1B19K-01        ctggacc--------------ctccgtcggaagaggagctggattga
E5RWL1_E1B19K-01        ctggacc--------------ctccgtcggaagaggagctggattga
                        *** ***              ****   **  *****    ****  

© 1998-2022Legal notice