Dataset for CDS adenoviridae of organism Human adenovirus 51

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


M0QVT4_E1B19K-01      atggatgtgtggactatccttgcagactttagcaagacacgccggcttgt
M0QVT4_E1B19K-02      --------------------------------------------------
                                                                        

M0QVT4_E1B19K-01      agaggatagttcagacgggtgctccgggttctggagacactggtttggaa
M0QVT4_E1B19K-02      --------------------------------------------------
                                                                        

M0QVT4_E1B19K-01      ctcctctatctcgcctggtgtacacagttaagaaggattataaagaggaa
M0QVT4_E1B19K-02      --------------------------------------------------
                                                                        

M0QVT4_E1B19K-01      tttgaaaatctttttgctgactgctctggcctgttagattctctgaatct
M0QVT4_E1B19K-02      --------------------------------------------------
                                                                        

M0QVT4_E1B19K-01      tggccaccagtcccttttccaggaaagggtactccacagccttgattttt
M0QVT4_E1B19K-02      --------------------------------------------------
                                                                        

M0QVT4_E1B19K-01      ccagcccagggcgcactacagccggggttgcttttgtggtttttctggtt
M0QVT4_E1B19K-02      --------------------------------------------------
                                                                        

M0QVT4_E1B19K-01      gacaaatggagccaggacacccaactgagcaggggctacatcctggactt
M0QVT4_E1B19K-02      -----atggagccaggacacccaactgagcaggggctacatcctggactt
                           *********************************************

M0QVT4_E1B19K-01      cgcagccatgcacctgtggagggcctggatcaggcagcggggacagagaa
M0QVT4_E1B19K-02      cgcagccatgcacctgtggagggcctggatcaggcagcggggacagagaa
                      **************************************************

M0QVT4_E1B19K-01      tcttgaattactggcttctacagccagcagctccgggtcttcttcgtcta
M0QVT4_E1B19K-02      tcttgaattactggcttctacagccagcagctccgggtcttcttcgtcta
                      **************************************************

M0QVT4_E1B19K-01      cacagacaaacatccatgttggaggaagaaatgaggcaggccatggacga
M0QVT4_E1B19K-02      cacagacaaacatccatgttggaggaagaaatgaggcaggccatggacga
                      **************************************************

M0QVT4_E1B19K-01      gaacccgaggagcggcctggaccctccgtcggaagaggagctggattga-
M0QVT4_E1B19K-02      gaacccgaggagcggcctggaccctccgtcggaagaggagctggattgaa
                      ************************************************* 

M0QVT4_E1B19K-01      --------------------------------------------------
M0QVT4_E1B19K-02      tcaggtagccagcctgtacccagagcttagcaaggtgctgacaaccatgg
                                                                        

M0QVT4_E1B19K-01      --------------------------------------------------
M0QVT4_E1B19K-02      ccaggggagtgaagagggagaggagtgatgggggcaataccgggatgatg
                                                                        

M0QVT4_E1B19K-01      --------------------------------------------------
M0QVT4_E1B19K-02      accgagctgactgccagcctgatgaatcgcaagcgcccagagcgcattac
                                                                        

M0QVT4_E1B19K-01      --------------------------------------------------
M0QVT4_E1B19K-02      ctggcacgagctacagcaggagtgcagggatgagataggcctgatgcagg
                                                                        

M0QVT4_E1B19K-01      --------------------------------------------------
M0QVT4_E1B19K-02      ataaatatgggctggagcagataaaaactcactggttgaacccagatgag
                                                                        

M0QVT4_E1B19K-01      --------------------------------------------------
M0QVT4_E1B19K-02      gattgggaggaggccataaagaaatatgccaagatagccctgcgcccaga
                                                                        

M0QVT4_E1B19K-01      --------------------------------------------------
M0QVT4_E1B19K-02      ttgcaagtacaaaatcaccaagacggtgaatatcagacatgcctgctaca
                                                                        

M0QVT4_E1B19K-01      --------------------------------------------------
M0QVT4_E1B19K-02      tctcagggaacggggcagaggtgatgatcgataccctggacaagtcagcc
                                                                        

M0QVT4_E1B19K-01      --------------------------------------------------
M0QVT4_E1B19K-02      ttcaggtgttgcatgatgggaatgagagccggtgtgatgaatatgaattc
                                                                        

M0QVT4_E1B19K-01      --------------------------------------------------
M0QVT4_E1B19K-02      catgatcttcatgaacatgaagttcaatggagagaagtttaatggggtgc
                                                                        

M0QVT4_E1B19K-01      --------------------------------------------------
M0QVT4_E1B19K-02      tgttcatggccaacagccacatgaccctgcatggctgcagcttcttcggt
                                                                        

M0QVT4_E1B19K-01      --------------------------------------------------
M0QVT4_E1B19K-02      ttcaacaacatgtgcgccgaggtctggggagctgctaagatcaggggctg
                                                                        

M0QVT4_E1B19K-01      --------------------------------------------------
M0QVT4_E1B19K-02      taagttttatggctgctggatgggagtggtcggaagacccaagagcgaga
                                                                        

M0QVT4_E1B19K-01      --------------------------------------------------
M0QVT4_E1B19K-02      tgtctgtgaagcagtgtgtgtttgagaagtgctacctgggggtgtctaca
                                                                        

M0QVT4_E1B19K-01      --------------------------------------------------
M0QVT4_E1B19K-02      gagggcaatgctagagtgagacattgctcttccctggagacgggctgctt
                                                                        

M0QVT4_E1B19K-01      --------------------------------------------------
M0QVT4_E1B19K-02      ctgcctggtgaagggcacagcttcgatcaagcataatgtggtgaaaggct
                                                                        

M0QVT4_E1B19K-01      --------------------------------------------------
M0QVT4_E1B19K-02      gcacggatgagcgcatgtacaacatgctgacctgcgactcaggggtctgt
                                                                        

M0QVT4_E1B19K-01      --------------------------------------------------
M0QVT4_E1B19K-02      catatcctgaagaacatccatgtgaccgcccactccagaaagaagtggcc
                                                                        

M0QVT4_E1B19K-01      --------------------------------------------------
M0QVT4_E1B19K-02      agtgtttgagaataacctgctaatcaagtgccatatgcacctgggagcca
                                                                        

M0QVT4_E1B19K-01      --------------------------------------------------
M0QVT4_E1B19K-02      gaaggggcaccttccagccgtaccagtgcaactttagccagaccaagctg
                                                                        

M0QVT4_E1B19K-01      --------------------------------------------------
M0QVT4_E1B19K-02      ctgctggagaacgatgccttctccagggtgaacctgaacggcatctttga
                                                                        

M0QVT4_E1B19K-01      --------------------------------------------------
M0QVT4_E1B19K-02      catggatgtctcggtgtacaagatcctgagatacgatgagaccaggtcca
                                                                        

M0QVT4_E1B19K-01      --------------------------------------------------
M0QVT4_E1B19K-02      gggtgcgcgcttgcgagtgtgggggcagacacaccaggatgcagcctgtg
                                                                        

M0QVT4_E1B19K-01      --------------------------------------------------
M0QVT4_E1B19K-02      gccctggatgtgacagaggagctgagaccagaccacctggtgatggcctg
                                                                        

M0QVT4_E1B19K-01      -------------------------------------------
M0QVT4_E1B19K-02      taccgggaccgagttcagctccagcggggaggacacagattag
                                                                 

© 1998-2020Legal notice