Dataset for CDS adenoviridae of organism Human adenovirus 47

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


M0QUW8_E1B19K-01      atggaggt-gtggactatccttgc---------------ggactttaaca
M0QUW8_E1B19K-02      atggagccagcaaacccacctaaccagggattacatcctggacttcacgg
                      ******   *   **   ***  *               ****** *   

M0QUW8_E1B19K-01      agacacgcc-------ggcttgtg---------gaggatag---------
M0QUW8_E1B19K-02      ccatgcacctgtggaaggcctgggtcaggcagcggggacagagaatcttg
                        *  * **       *** ** *         * *** **         

M0QUW8_E1B19K-01      -------------ttcagacgggtgctccggtttct--------------
M0QUW8_E1B19K-02      aactactggcttctacagccagcagctccgggtcttcttcgtctacacag
                                   * *** * *  ******* *  *              

M0QUW8_E1B19K-01      ------------------------------ggagacactggtttggaac-
M0QUW8_E1B19K-02      acaaacatccatgttggaggaagagatgagggaggccatggacgagaacc
                                                    **** *  ***    **** 

M0QUW8_E1B19K-01      ----------------tcctc-----------------------------
M0QUW8_E1B19K-02      cgaggagcggcctggaccctccgtcggaagaggagctggattgaatcagg
                                       ****                             

M0QUW8_E1B19K-01      --------------------------------------------------
M0QUW8_E1B19K-02      tatccagcctgtacccagagcttagcaaggtgttgacatccatggccagg
                                                                        

M0QUW8_E1B19K-01      --------------------------------------------------
M0QUW8_E1B19K-02      ggagtgaagagggagaggagcgatgggggcaataccgggatgatgaccga
                                                                        

M0QUW8_E1B19K-01      -----tagctcgcctggtg-------------------------------
M0QUW8_E1B19K-02      gctgacagccagcctgatgaatcgcaggcgacctgagcgcattacctggc
                            ***  ***** **                               

M0QUW8_E1B19K-01      ------taca----------------------------------------
M0QUW8_E1B19K-02      acgagctacagcaggagtgcagggatgagataggcctgatgcaggataaa
                            ****                                        

M0QUW8_E1B19K-01      ------------cagttaaga----------------------aggatta
M0QUW8_E1B19K-02      tatggcctggagcagataaaaacccactggttgaacccagatgaggattg
                                  *** *** *                      ****** 

M0QUW8_E1B19K-01      tcaggaggaatttgaaaatctttttgcc--gattgctctg----------
M0QUW8_E1B19K-02      ggaggaggccattaagaa---atatgccaagatagccctgcgtccagatt
                        ******   ** * **    * ****  *** ** ***          

M0QUW8_E1B19K-01      --------------------------------------gcctgc------
M0QUW8_E1B19K-02      gcaagtacagggtgaccaagacgataaatatcagacatgcctgctacatc
                                                            ******      

M0QUW8_E1B19K-01      -------------------------tcgattcactgaatc--tcggccac
M0QUW8_E1B19K-02      tcagggaacggggcagaggtgatcattgataccctggataaggctgcctt
                                               * *** * *** **    * ***  

M0QUW8_E1B19K-01      caggctct------------------------------------------
M0QUW8_E1B19K-02      caggtgttgcatgatgggaatgagagctggtgtgatgaatatgaattcca
                      ****   *                                          

M0QUW8_E1B19K-01      ---tttccaggaa-------------------------------------
M0QUW8_E1B19K-02      tgatcttcatgaacatcaagttcaatggagagaagtttaatggggtgctg
                         * * ** ***                                     

M0QUW8_E1B19K-01      ------------------agggtcctccacagccttgattt------ttc
M0QUW8_E1B19K-02      ttcatggccaacagccatatgaccctgcatggctgtaatttctttggttt
                                        * *  *** **  **  * ****      ** 

M0QUW8_E1B19K-01      cagcccagggcgcactacagccggggttgcttt-------------tgtg
M0QUW8_E1B19K-02      taacaacatgtgtgcagaagtctggggtgcttccaagatcaggggatgta
                       * *     * *  *   ** * *** *****              *** 

M0QUW8_E1B19K-01      gtgtttctggttgacaaatgg----agccagcaaaccca-----------
M0QUW8_E1B19K-02      agttttatggctgctggatgggagtggtcggaaggcccaagagcgagatg
                         *** *** **    ****     * * * *  ****           

M0QUW8_E1B19K-01      ------------------------------------------cctaacca
M0QUW8_E1B19K-02      tctgtgaagcagtgtgtgtttgagaagtgctacctggccgtgtctaccga
                                                                 *** * *

M0QUW8_E1B19K-01      ggg----------attacatcctggacttc-------acggccatgcacc
M0QUW8_E1B19K-02      gggcaatgctagagtgagacattgctcttccatggagacgggc-tgcttc
                      ***           * * *   **  ****       **** * ***  *

M0QUW8_E1B19K-01      tgt----------ggaaggcctgggtcaggc--agcggggacagagaatc
M0QUW8_E1B19K-02      tgtctggtgaagggtacagcctcgatcaagcataatgtgatcaagggg--
                      ***          * *  **** * *** **  *  * *  **  *    

M0QUW8_E1B19K-01      ttgaactactg---gcttctaca--------gccagcagctcc-gggtct
M0QUW8_E1B19K-02      -tgtactgatgagcgcatgtacaacatgttgacctgcgactctggggtct
                       ** ***  **   ** * ****         ** **  ***  ******

M0QUW8_E1B19K-01      tcttcgtctacacagacaaacatccatgt---------------------
M0QUW8_E1B19K-02      gccatatc----ctgaagaacatccatgtgacctcccaccccaggaagag
                       *    **    * **  ***********                     

M0QUW8_E1B19K-01      --------------------------------------------------
M0QUW8_E1B19K-02      gtggccatcatttgaaaataatgtcctgatcaagtgccatgtgcacctgg
                                                                        

M0QUW8_E1B19K-01      --------------------------------------------------
M0QUW8_E1B19K-02      gagccagaaggggtaccttccagccgtaccagtgcaactttagtcagacc
                                                                        

M0QUW8_E1B19K-01      ----------tggaggaaga------------------------------
M0QUW8_E1B19K-02      aagctgctgctggagaacgatgccttctccagggtgaacctgaacggtat
                                ***** * **                              

M0QUW8_E1B19K-01      ----------------------------------------gatgagg---
M0QUW8_E1B19K-02      ctttgacatggatgtctcggtgtacaagatcctgagatacgatgagacca
                                                              ******    

M0QUW8_E1B19K-01      --------------------------------------------------
M0QUW8_E1B19K-02      ggtccagggtgcgcgcttgcgagtgcggtggcagacacaccaggatgcag
                                                                        

M0QUW8_E1B19K-01      ---gaggccatggacgagaacccgaggagc--------------------
M0QUW8_E1B19K-02      cctgtggccctggatgtaa--ccgaggagctgagaccagaccacctggtg
                         * **** **** *  *  *********                    

M0QUW8_E1B19K-01      --ggcctggacc--------------ctccgtcggaagaggagctggatt
M0QUW8_E1B19K-02      atggcctgtaccgggaccgagttcagctccagcgg-ggaggacacagatt
                        ****** ***              ****  ***  *****    ****

M0QUW8_E1B19K-01      ga
M0QUW8_E1B19K-02      ag
                        

© 1998-2020Legal notice