Dataset for CDS E1B19K of organism Human adenovirus 45

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


M0QVP5_E1B19K-01      atggatgt-gtggactatccttgc---------------ggactttaaca
M0QVP5_E1B19K-02      atggagccagcaaacccacctaaccagggattacatcctggacttcacgg
                      *****    *   **   ***  *               ****** *   

M0QVP5_E1B19K-01      agacacgcc-------ggcttgta---------gaggatag---------
M0QVP5_E1B19K-02      ccatgcacctgtggaaggcctgggtcaggcagcggggacagagaatcttg
                        *  * **       *** **           * *** **         

M0QVP5_E1B19K-01      -------------ttcagacgggtgctccggtttct--------------
M0QVP5_E1B19K-02      aactactggcttctacagccagcagctccgggtcttcttcgtctacacag
                                   * *** * *  ******* *  *              

M0QVP5_E1B19K-01      ------------------------------ggagacactggtttggaac-
M0QVP5_E1B19K-02      acaaacatccatgttggaggaagagatgagggaggccatggacgagaacc
                                                    **** *  ***    **** 

M0QVP5_E1B19K-01      ----------------tcctc-----------------------------
M0QVP5_E1B19K-02      cgaggagcggtctggaccctccgtcggaagaggagctggattgaatcagg
                                       ****                             

M0QVP5_E1B19K-01      tatctcgcct------------------ggtgtacac-------------
M0QVP5_E1B19K-02      tatccagcctgtacccagagcttagcaaggtgctgacaaccatggccagg
                      ****  ****                  ****   **             

M0QVP5_E1B19K-01      --agttaagaagg-------------------------------------
M0QVP5_E1B19K-02      ggagtgaagagggagaggagcgatgggggcaatactgggatgatgaccga
                        *** **** **                                     

M0QVP5_E1B19K-01      ----------------------------------------attat-----
M0QVP5_E1B19K-02      gctgacagccagcctgatgaatcgcaggcgacctgagcgcattacctggc
                                                              ****      

M0QVP5_E1B19K-01      -----------------------------------------caggaggaa
M0QVP5_E1B19K-02      acgagctacagcaggagtgcagggatgagataggcctgatgcaggataaa
                                                               *****  **

M0QVP5_E1B19K-01      tttg--------------aaaatctttttgccgact--------------
M0QVP5_E1B19K-02      tatggcctggagcagataaaaacccattggttgaatccagatgaggattg
                      * **              **** *  ** *  ** *              

M0QVP5_E1B19K-01      -------------------------------gttctg-------------
M0QVP5_E1B19K-02      ggaggaggccattaagaaatatgccaagatagccctgcgcccagattgca
                                                     *  ***             

M0QVP5_E1B19K-01      -----------------------------------gcctgc---------
M0QVP5_E1B19K-02      agtacaggatcaccaagacggtgaatatcagacatgcctgctacatctca
                                                         ******         

M0QVP5_E1B19K-01      ----------------------ttgattcactgaa---------------
M0QVP5_E1B19K-02      gggaacggggcagaggtgatcatcgataccctggataaggctgccttcag
                                            * *** * *** *               

M0QVP5_E1B19K-01      --------------------------------------------------
M0QVP5_E1B19K-02      gtgttgcatgatgggaatgagagccggtgtgatgaatatgaattcaatga
                                                                        

M0QVP5_E1B19K-01      ---tctcggccaccaggctctattccaggaa-------------------
M0QVP5_E1B19K-02      tattcatgaacatcaagttcaatggagagaagtttaatggggtgctgttc
                         **  *  ** ** * ** **     ***                   

M0QVP5_E1B19K-01      ---------------agggtcctccacagccttgatttttccagcccagg
M0QVP5_E1B19K-02      atggccaacagtcatatgaccctacacggctgtaatttctttggctttaa
                                     * *  *** *** **  * **** *   **     

M0QVP5_E1B19K-01      ------gcgtactacagccggggttgcatt-------------tgtggtg
M0QVP5_E1B19K-02      caacatgtgtgcagaagtctggggtgcttccaagatcaggggatgtaagt
                            * ** *   ** * *** *** *              ***    

M0QVP5_E1B19K-01      tttctggttgacaaatgg----agccagcaaaccca--------------
M0QVP5_E1B19K-02      tttttggctgctggatgggagtggtcggaaggcccaagagcgagatgtct
                      *** *** **    ****     * * * *  ****              

M0QVP5_E1B19K-01      ---------------------------------------cctaaccaggg
M0QVP5_E1B19K-02      gtgaagcagtgtgtgtttgagaagtgctacctggccgtgtctaccgaggg
                                                              *** * ****

M0QVP5_E1B19K-01      --------------------------------------------------
M0QVP5_E1B19K-02      caatgctagagtgagacattgctcttccatggagacgggttgcttctgcc
                                                                        

M0QVP5_E1B19K-01      --------------------------------------------------
M0QVP5_E1B19K-02      tggtgaagggcacagcttcgattaagcataatgtgatcaaggggtgtacg
                                                                        

M0QVP5_E1B19K-01      -------------attacatcctggacttc--------------------
M0QVP5_E1B19K-02      gatgagcgcatgtacaacatgctgacctgcgactcgggggtctgccatat
                                   *  **** ***  ** *                    

M0QVP5_E1B19K-01      --------acggccatg--------cacctgtggaag-------------
M0QVP5_E1B19K-02      cctgaagaacatccatgtgacctcccaccccaggaagaggtggccatcat
                              **  *****        ****   *****             

M0QVP5_E1B19K-01      -----------gcctgggtcagg---------------------------
M0QVP5_E1B19K-02      ttgaaaataatgtcctgatcaagtgccacgtgcacctgggagccagaagg
                                 * *  * *** *                           

M0QVP5_E1B19K-01      ---------cagcggggacagagaatcttga-------------actact
M0QVP5_E1B19K-02      ggtaccttccagccgtaccagtgcaactttagccagaccaagctgctgct
                               **** *   *** * * *** *              ** **

M0QVP5_E1B19K-01      gg----------cttctacag-----------ccagcagctccg----gg
M0QVP5_E1B19K-02      ggagaacgatgccttttccagggtgaacctgaacggcatctttgacatgg
                      **          *** * ***            * *** **  *    **

M0QVP5_E1B19K-01      tcttcttcgtctaca-----cagacaaac-----------atccatgtt-
M0QVP5_E1B19K-02      atgtctcggtgtacaagatcctgagatacgatgagaccaggtccagggtg
                         ***  ** ****     * ** * **            **** * * 

M0QVP5_E1B19K-01      ---------------ggaggaaga--------gatgagg---gaggccat
M0QVP5_E1B19K-02      cgcgcttgcgagtgcgggggcagacacaccaggatgcagcctgtggccct
                                     ** ** ***        ****  *   * **** *

M0QVP5_E1B19K-01      ggacgagaacccgaggagc----------------------ggtctggac
M0QVP5_E1B19K-02      ggatgtga--ccgaggagctgaggcccgaccacctggtgatggcctgtac
                      *** * **  *********                      ** *** **

M0QVP5_E1B19K-01      c--------------ctccgtcggaagaggagctggattga
M0QVP5_E1B19K-02      cgggaccgagttcagctccagcgg-ggaggacacagattag
                      *              ****  ***  *****    ****  

© 1998-2020Legal notice