Dataset for CDS E1B19K of organism Human adenovirus 44

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

M0QVK6_E1B19K-01      atggat-----------------gtgtggactatccttgcagactt--ta
M0QVK6_E1B19K-02      atggagccaggacacccaactgagcaggggcta-catcctggacttcgca
                      *****                  *   ** *** * *    *****   *

M0QVK6_E1B19K-01      gcaagacac-----gccggcttgta---------gaggatag--------
M0QVK6_E1B19K-02      gccatgcacctgtggagggcctggatcaggcagcggggacagagaatctt
                      ** *  ***     *  *** ** *         * *** **        

M0QVK6_E1B19K-01      --------------ttcagacgggtgctccgggttct-------------
M0QVK6_E1B19K-02      gaactactggcttctacagccagcagctccgggtcttcttcgtctacaca
                                    * *** * *  *********  *             

M0QVK6_E1B19K-01      --------------------------------------------------
M0QVK6_E1B19K-02      gacaaacatccatgttggaggaagaaatgaggcaggccatggacgagaac

M0QVK6_E1B19K-01      -----------------------------ggagacactggtttggaactc
M0QVK6_E1B19K-02      ccgaggagcggcctggaccctccgtcggaagaggagctggattgaa--tc
                                                    ***   **** *** *  **

M0QVK6_E1B19K-01      ctctatctcgcctggtgtacacagttaagaaggatt--------------
M0QVK6_E1B19K-02      aggtatccagcct-gtacccagagcttagcaaggtgctgacatccatggc
                         ****  **** **   ** ** * ** * * *               

M0QVK6_E1B19K-01      -------ataaagaggaa---------------------tttgaaaatct
M0QVK6_E1B19K-02      caggggagtgaagagggagaggagcgatgggggcaataccgggatgatga
                              * ****** *                        **  **  

M0QVK6_E1B19K-01      ttttgctgactgc-------------------------------------
M0QVK6_E1B19K-02      ccgagctgactgccagtctgatgaatcgcaagcgcccagagcgccttacc

M0QVK6_E1B19K-01      --------------------------------------------------
M0QVK6_E1B19K-02      tggtacgagctacagcaggagtgcagggatgagataggcctgatgcagga

M0QVK6_E1B19K-01      ----tctggcctg-------------------------------------
M0QVK6_E1B19K-02      taaatatggcctggagcagataaaaacccactggttgaacccagatgagg
                          * *******                                     

M0QVK6_E1B19K-01      --------------------------------------------ctagat
M0QVK6_E1B19K-02      attgggaggaggccattaagaaatatgccaagatagccctgcgcccagat
                                                                  * ****

M0QVK6_E1B19K-01      t---------------------ctctgaatcttggcca--ccagtccctt
M0QVK6_E1B19K-02      tgcaagtacatagtgaccaagaccgtgaatatcagacatgcctgctacat
                      *                     *  ***** *  * **  ** *   * *

M0QVK6_E1B19K-01      ttccaggaaagggt------------------------------------
M0QVK6_E1B19K-02      ctcggggaacggggcagaggtgatcattgataccctggacaaggccgcct
                       **  **** ***                                     

M0QVK6_E1B19K-01      ---------------------------------------------actcc
M0QVK6_E1B19K-02      tcaggtgttgcatgatgggaatgagagccggagtgatgaatatgaattcc
                                                                   * ***

M0QVK6_E1B19K-01      acagccttgat--------------------------------------t
M0QVK6_E1B19K-02      atgatcttcatgaacatgaagttcaatggagagaagtttaatggggtgct
                      *    *** **                                      *

M0QVK6_E1B19K-01      tttc--------cagcc-cagggcgcactacagccggggttgcttt----
M0QVK6_E1B19K-02      gttcatggccaacagccacatgaccctgcatggctgcagtttctttggct
                       ***        ***** ** * * *   *  ** *  *** ****    

M0QVK6_E1B19K-01      -----------------------------------------------tgt
M0QVK6_E1B19K-02      tcaacaatatgtgtgcagaggtctggggcgctgctaagatcaggggatgt

M0QVK6_E1B19K-01      ggtttttctggttgacaaatgg----agccaggacacccaa---------
M0QVK6_E1B19K-02      aagttttatggctgctggatgggcgtggtcggaagacccaagagcgagat
                         **** *** **    ****     * * * * ******         

M0QVK6_E1B19K-01      --ctg---agcaggg--------------gctacat--------------
M0QVK6_E1B19K-02      gtctgtgaagcagtgtgtgtttgagaaatgctacctgggagtctctaccg
                        ***   ***** *              ***** *              

M0QVK6_E1B19K-01      -------------------------------cctgga-------------
M0QVK6_E1B19K-02      agggcaatgctagagtgagacactgctcttccctggagacgggctgcttc

M0QVK6_E1B19K-01      ----------------------cttcgcagc-------------------
M0QVK6_E1B19K-02      tgcctggtgaagggtacagcctctctgaagcataatatggtgaagggctg
                                            **  * ***                   

M0QVK6_E1B19K-01      ---------------------catgc--acctgtg----gagggcctg--
M0QVK6_E1B19K-02      cacggatgagcgcatgtacaacatgctgacctgcgattcgggggtctgcc
                                           *****  ***** *    * *** ***  

M0QVK6_E1B19K-01      --------------------------------------------------
M0QVK6_E1B19K-02      atatcctgaagaacatccatgtgacctcccaccccagaaagaagtggcca

M0QVK6_E1B19K-01      --------------------gatcagg-----------------------
M0QVK6_E1B19K-02      gtgtttgagaataacctgctgatcaagtgccatatgcacctgggcgccag
                                          ***** *                       

M0QVK6_E1B19K-01      -------------cagcggggacagagaatcttgaacta-----------
M0QVK6_E1B19K-02      aaggggcaccttccagccgtaccagtgcaactttagccagaccaagctgc
                                   **** *   *** * * *** * * *           

M0QVK6_E1B19K-01      ------------ctggcttctacag-----------ccagcagctccg--
M0QVK6_E1B19K-02      tgttggagaacgatgccttctccagggtgaacctgaacggcatctttgac
                                   ** ***** ***            * *** **  *  

M0QVK6_E1B19K-01      --ggtcttcttcgtctacac-----------------agacaaacatcca
M0QVK6_E1B19K-02      atggatgtctcggtgtacaagatcctgagatacgatgagaccaa-atcca
                        **   ***  ** ****                  **** ** *****

M0QVK6_E1B19K-01      tgtt----------------ggaggaagaaat-----gaggca------g
M0QVK6_E1B19K-02      gggtgcgtgcttgcgagtgcgggggcagacacaccaggatgcaaccagtg
                       * *                ** ** *** *      ** ***      *

M0QVK6_E1B19K-01      gccatggacgagaacccgaggagc----------------------ggcc
M0QVK6_E1B19K-02      gccctggatgtga--ccgaggagctgagacccgaccacctggtgatggcc
                      *** **** * **  *********                      ****

M0QVK6_E1B19K-01      tggacc--------------ctccgtcggaagaggagctggattga
M0QVK6_E1B19K-02      tgtaccgggaccgagttcagctccagtgg-ggaggacacagattag
                      ** ***              ****   **  *****    ****  

© 1998-2023Legal notice