Dataset for CDS adenoviridae of organism Human adenovirus 38

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

M0QV47_E1B19K-01      atggaggt-gtggactatccttgc---------------ggactttaaca
M0QV47_E1B19K-02      atggagccagcaaacccacctaaccagggattacatcctggacttcacgg
                      ******   *   **   ***  *               ****** *   

M0QV47_E1B19K-01      agacacgcc-------ggcttgtg---------gaggatag---------
M0QV47_E1B19K-02      ccatgcatctgtggaaggcctgggtcaggcagcggggacagagaatcttg
                        *  *  *       *** ** *         * *** **         

M0QV47_E1B19K-01      -------------ttcagacgggtgctccggtttct--------------
M0QV47_E1B19K-02      aactactggcttctacagccagcagctccgggtcttcttcgtctacacag
                                   * *** * *  ******* *  *              

M0QV47_E1B19K-01      ------------------------------ggagacactggtttggaac-
M0QV47_E1B19K-02      acaaacatccatgttggaggaagagatgagggagaccatggacgagaacc
                                                    ******  ***    **** 

M0QV47_E1B19K-01      ----------------tcctc-----------------------------
M0QV47_E1B19K-02      cgaggagcggcctggaccctccgtcggaagaggagctggattgaatcagg

M0QV47_E1B19K-01      --------------------------------------------------
M0QV47_E1B19K-02      tatccagcctgtacccagagcttagcaaggtgctgacaaccatggccagg

M0QV47_E1B19K-01      --------------------------------------------------
M0QV47_E1B19K-02      ggagtgaagagggagaggagcgatgggggcaatactgggatgatgaccga

M0QV47_E1B19K-01      -----tagctcgcctggtg-------------------------------
M0QV47_E1B19K-02      gctgacagccagcctgatgaatcgcaggcgacctgagcgcattacctggc
                            ***  ***** **                               

M0QV47_E1B19K-01      ------taca----------------------------------------
M0QV47_E1B19K-02      atgagctacagcaggagtgcagggatgagataggcctgatgcaggataaa

M0QV47_E1B19K-01      ------------cagttaaga----------------------aggatta
M0QV47_E1B19K-02      tatggcctggagcagataaaaacccactggttgaacccagatgaggattg
                                  *** *** *                      ****** 

M0QV47_E1B19K-01      tcaggaggaatttgaaaatctttttgcc--gactgttctg----------
M0QV47_E1B19K-02      ggaggaggctattaagaa---atatgccaagatagccctgcgcccagatt
                        ******   ** * **    * ****  **  *  ***          

M0QV47_E1B19K-01      --------------------------------------------------
M0QV47_E1B19K-02      gcaagtacagggtgaccaagacggtgaatatcagacatgcctgctacatc

M0QV47_E1B19K-01      ---------------------------------------------gcctt
M0QV47_E1B19K-02      tcagggaacggggcagaggtgatcatcgataccctggataaggctgcctt

M0QV47_E1B19K-01      c----------------------------------------ttgattcac
M0QV47_E1B19K-02      caggtgttgcatgatgggaatgagagccggtgtgatgaatatgaattcaa
                      *                                        *  ***** 

M0QV47_E1B19K-01      tg--aatctcggccaccaggctctattccaggaa----------------
M0QV47_E1B19K-02      tgatattcatgaacatcaagttcaatggagagaagtttaatggggtgctg
                      **  * **  *  ** ** * ** **     ***                

M0QV47_E1B19K-01      ------------------agggtcctccacagccttgatttttccagccc
M0QV47_E1B19K-02      ttcatggccaacagccacatgaccctgcacggctgtaatttctttggctt
                                        * *  *** *** **  * **** *   **  

M0QV47_E1B19K-01      agg------gcgcactacagccggtgttgctt-------------ttgtg
M0QV47_E1B19K-02      taacaacatgtgtgcagaagtctggggtgcttccaagataaggggctgta
                               * *  *   ** * * * *****              *** 

M0QV47_E1B19K-01      gtgtttctggttgacaaatgg----agccagcaaaccca-----------
M0QV47_E1B19K-02      agttttatggctgctggatgggagtggtcggaagacccaagagcgagatg
                         *** *** **    ****     * * * * *****           

M0QV47_E1B19K-01      cct---aaccag-----------ggattacatcctggacttcac------
M0QV47_E1B19K-02      tctgtgaagcagtgtgtgtttgagaagtgctacctggccgtgtctaccga
                       **   ** ***           * * * *  ***** * *  *      

M0QV47_E1B19K-01      -ggccatg------------------catctgtggaag------gcctgg
M0QV47_E1B19K-02      gggcaatgctagagtgagacattgctcttccatggagacgggctgcttct
                       *** ***                  * **  ****        ** *  

M0QV47_E1B19K-01      gtcaggcagcggggacag------------agaatct----------tga
M0QV47_E1B19K-02      gcctggtgaagggcacagcttctatcaagcataatgtgatcaaggggtgt
                      * * **    *** ****            * *** *          ** 

M0QV47_E1B19K-01      actactg---gcttctacagccagcagctccgggtcttcttcgtctac--
M0QV47_E1B19K-02      actgatgagcgcatgtacaacatgctgacctgcgactctggggtctgcca
                      ***  **   ** * **** *  ** *  * * * **     **** *  

M0QV47_E1B19K-01      ---acagacaaacatccatgttg----------gaggaagagatg-----
M0QV47_E1B19K-02      tatcctgaagaacatccatgtgacctcccaccctaggaagaggtggccat
                          * **  ***********             ******** **     

M0QV47_E1B19K-01      --------------------------------------------------
M0QV47_E1B19K-02      catttgaaaataatgtcctgatcaagtgccatgtgcacctgggagccaga

M0QV47_E1B19K-01      --------------------------------------------------
M0QV47_E1B19K-02      aggggtaccttccagccgtaccagtgcaactttagccagaccaagctgct

M0QV47_E1B19K-01      ----------------------agggagaccatggacga-----------
M0QV47_E1B19K-02      gctggagaatgatgccttctccagggtgaacctgaacggtatctttgaca
                                            **** ** * ** ***            

M0QV47_E1B19K-01      --------------------------------------------------
M0QV47_E1B19K-02      tggatgtctcggtgtacaagatcctgagatacgatgagaccaggtccagg

M0QV47_E1B19K-01      --------------------------------------------------
M0QV47_E1B19K-02      gtgcgcgcttgcgagtgcgggggcagacacaccaggatgcagcctgtggc

M0QV47_E1B19K-01      -------gaacccgaggagc----------------------ggcctgga
M0QV47_E1B19K-02      tctggatgtaaccgaggagctgaggcccgaccacctggtgatggcctgta
                             * * *********                      ****** *

M0QV47_E1B19K-01      cc--------------ctccgtcggaagaggagctggattga
M0QV47_E1B19K-02      ccgggaccgagttcagctccagcgg-ggaggacacagattag
                      **              ****  ***  *****    ****  

© 1998-2023Legal notice