Dataset for CDS E1B19K of organism Human adenovirus 34

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q3ZL02_E1B19K-01      atgga-----------------------------ggtttgggc-------
Q3ZL02_E1B19K-02      atggatcccgcagactcatttcagcaggggatacgttttggatttcgtag
                      *****                             * *****         

Q3ZL02_E1B19K-01      ------cattttggaagacc-------ttagaaagactagg---------
Q3ZL02_E1B19K-02      ccacagcattgtggagaacatggaaggttcgcaagatgaggacaatctta
                            **** ****  **        ** * ****  ***         

Q3ZL02_E1B19K-01      --------------------------------------------------
Q3ZL02_E1B19K-02      ggttactggccagtgcagcctttgggtgtagcgggaatcctgaggcatcc
                                                                        

Q3ZL02_E1B19K-01      -----------caactgtt-----------------agaggacgcttcg-
Q3ZL02_E1B19K-02      accggtcatgccagcggttctggaggaggaacagcaagaggacaacccga
                                 ** * ***                 *******    ** 

Q3ZL02_E1B19K-01      ----------------------------gacgga-----------gtctc
Q3ZL02_E1B19K-02      gagccggcctggaccctccagtggaggaggcggagtagctgacttgtctc
                                                  * ****           *****

Q3ZL02_E1B19K-01      c-------------------------------------------------
Q3ZL02_E1B19K-02      ctgaactgcaacgggtgcttactggatctacgtccactggacgggatagg
                      *                                                 

Q3ZL02_E1B19K-01      --------------------------------------------------
Q3ZL02_E1B19K-02      ggcgttaagagggagagggcatctagtggtactgatgctagatctgagtt
                                                                        

Q3ZL02_E1B19K-01      ggtttt--------------------------------------------
Q3ZL02_E1B19K-02      ggctttaagtttaatgagtcgcagacgtcctgaaaccatttggtggcatg
                      ** ***                                            

Q3ZL02_E1B19K-01      ----------------------tggagattctggttcgctagtgaatta-
Q3ZL02_E1B19K-02      aggtccagaaagagggaagggatgaagtttctgtattgcaggagaaatat
                                            ** ** *****  * **  * *** ** 

Q3ZL02_E1B19K-01      --------------------------------------------------
Q3ZL02_E1B19K-02      tcactggaacaggtgaaaacatgttggttggagcctgaggatgattggga
                                                                        

Q3ZL02_E1B19K-01      -------------------gctagggtagtttttag----gataaa----
Q3ZL02_E1B19K-02      ggtggccattaaaaattatgccaagatagctttgaggcctgataaacagt
                                         ** * * *** *** **    ******    

Q3ZL02_E1B19K-01      acaggactataaagaaga-------------------------atttgaa
Q3ZL02_E1B19K-02      ataagattactagacggattaatatccggaatgcttgttacatatctgga
                      * * ** **  *    **                         ** ** *

Q3ZL02_E1B19K-01      a---------agttgttggtagattgcccaggac--------tttttgaa
Q3ZL02_E1B19K-02      aatggggctgaggtggtaataga-tactcaagacaaggcagttattagat
                      *         ** ** *  **** * * ** ***        * ** ** 

Q3ZL02_E1B19K-01      gct-----cttaatttgggccatcaagttcactttaaagaaaaag----t
Q3ZL02_E1B19K-02      gctgcatgatggatatgtggcctggagtagtcggtatggaagcagtaact
                      ***      *  ** ** * * *  ***   *  **  ***  **    *

Q3ZL02_E1B19K-01      tttatcagttttagactt--------------------------------
Q3ZL02_E1B19K-02      tttgtaaatgttaagtttaggggagatggttataatggaatagtgtttat
                      *** * * * ***   **                                

Q3ZL02_E1B19K-01      -ttcaaccccaggtagaactgccgctgctgtggcttttcttacttttata
Q3ZL02_E1B19K-02      ggccaataccaaacttatattgcatggttgtagcttttttggtttcaaca
                         ***  ***     *  *  *   * *** ****** *   **  * *

Q3ZL02_E1B19K-01      ttagataaatggat-cccgcagactcatttcagcagggg-----------
Q3ZL02_E1B19K-02      atacctgtgtagatgcctggggacaggttagtgtacggggatgtagtttc
                       **  *   * *** ** *  ***   **   * * ***           

Q3ZL02_E1B19K-01      -atacgttttggatttc---------------------------------
Q3ZL02_E1B19K-02      tatgcgtgttggattgccacagctggcagaaccaagagtcaattgtctct
                       ** *** ******* *                                 

Q3ZL02_E1B19K-01      -----------------------gtagccacagcattgtggagaacatgg
Q3ZL02_E1B19K-02      gaagaaatgcatattccaaagatgtaacctgggcattctgaatgaaggcg
                                             *** **   ***** ** *  *    *

Q3ZL02_E1B19K-01      aa-----ggttcgcaa--------------------gatg----------
Q3ZL02_E1B19K-02      aagcaagggtccgccactgcgcttctacagatactggatgttttatttta
                      **     *** *** *                    ****          

Q3ZL02_E1B19K-01      ----aggacaat--------------------------------------
Q3ZL02_E1B19K-02      attaagggcaatgccagcgtaaagcataacatgatttgcggtgcttccga
                          *** ****                                      

Q3ZL02_E1B19K-01      --------ctta--------------------------------------
Q3ZL02_E1B19K-02      tgagaggccttatcaaatgctcacttgtgccggtgggcattgtaatatgc
                              ****                                      

Q3ZL02_E1B19K-01      -ggttactg-----------------------------------------
Q3ZL02_E1B19K-02      tggctactgtgcatattgtttcccatcaacgcaaaaaatggcctgttttt
                       ** *****                                         

Q3ZL02_E1B19K-01      --------------------------------------------------
Q3ZL02_E1B19K-02      gatcacaatgtgttgaccaagtgtaccatgcatgcaggtgggcgtagagg
                                                                        

Q3ZL02_E1B19K-01      --------------gccagtgca---------------------------
Q3ZL02_E1B19K-02      aatgtttatgccttaccagtgtaacatgaatcatgtgaaagtgttgttgg
                                     ****** *                           

Q3ZL02_E1B19K-01      --------gcctt--------tgggtgtagcggga---------------
Q3ZL02_E1B19K-02      aaccagatgccttttccagaatgagcctaacaggaatctttgacatgaac
                              *****        ** *  ** * ***               

Q3ZL02_E1B19K-01      ---------------atcctgaggcat------------ccaccggt-ca
Q3ZL02_E1B19K-02      atgcaaatctggaagatcctgaggtatgatgatacgagatcgagggtgcg
                                     ********* **             *   *** * 

Q3ZL02_E1B19K-01      tgccagcggttctggagg-aggaa----------cagcaagag-------
Q3ZL02_E1B19K-02      cgcatgcgaatgcggaggcaagcatgccaggttccagccggtgtgtgtag
                       **  ***  *  ***** * * *          ****  * *       

Q3ZL02_E1B19K-01      --------gacaacccgaga------------------gccggc-ctgga
Q3ZL02_E1B19K-02      atgtgactgaagatctgagaccggatcatttggttattgcccgcactgga
                              **  * * ****                  *** ** *****

Q3ZL02_E1B19K-01      cc---------ctccagtggag--gaggcggagtag
Q3ZL02_E1B19K-02      gcagagttcggatccagtggagaagaaactgactaa
                       *          **********  **  * ** ** 

© 1998-2020Legal notice