Dataset for CDS E1B19K of organism Human adenovirus 33

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

M0QV08_E1B19K-01      atggag-----------------gtgtggactatccttgcagactt--ta
M0QV08_E1B19K-02      atggagccagaacacccaactgagcaggggcta-cattctggacttcgcg
                      ******                 *   ** *** * **   *****    

M0QV08_E1B19K-01      gcaagacac-----gccggcttgta---------gaggatag--------
M0QV08_E1B19K-02      gccatgcacctgtggagggcctgggtcaggcagcggggacagagaatctt
                      ** *  ***     *  *** **           * *** **        

M0QV08_E1B19K-01      --------------ttcagacgggtgctccgggttct-------------
M0QV08_E1B19K-02      gaactactggcttctacagccagcagctccgggtcttcttcgtctacaca
                                    * *** * *  *********  *             

M0QV08_E1B19K-01      --------------------------------------------------
M0QV08_E1B19K-02      gacaaacatccatgttggaggaagaaatgaggcaggccatggacgagaac

M0QV08_E1B19K-01      -----------------------------ggagacactggtttg------
M0QV08_E1B19K-02      ccgaggagcggcctggaccctccgtcggaagaggagctggattgaatcag
                                                    ***   **** ***      

M0QV08_E1B19K-01      ------------------gaactc--------------------------
M0QV08_E1B19K-02      gtatccagcctgtacccagagcttagcagggtgctgacatccatggccag
                                        ** **                           

M0QV08_E1B19K-01      --------------------------------------------------
M0QV08_E1B19K-02      gggagtgaagagggagaggagcgatgggggcaataccgggatgatgacag

M0QV08_E1B19K-01      ----------------------------------------ctctatctcg
M0QV08_E1B19K-02      agctgacggccagcctgatgaatcgcaagcgcccagagcgcattacctgg
                                                              *  ** ** *

M0QV08_E1B19K-01      cctggtgtaca---------------------------------------
M0QV08_E1B19K-02      catgagctacagatggagtgcagggatgaggtgggcctgatgcaggataa
                      * **   ****                                       

M0QV08_E1B19K-01      -------------cagttaaga----------------------aggatt
M0QV08_E1B19K-02      atatggcctggagcagataaaaacccactggttgaacccagatgaggatt
                                   *** *** *                      ******

M0QV08_E1B19K-01      ataacgagg-aatttgaaaat------------ctttttgcc--gactgc
M0QV08_E1B19K-02      gggaggaggccattaagaaatatgccaagatagccctacgcccagattgc
                         * ****  ***   ****            *  *  ***  ** ***

M0QV08_E1B19K-01      ----------------------------tctggcctgcttgat---tctc
M0QV08_E1B19K-02      aagtacagggtgaccaagacggtgcatatcagacatgcctgctacatctc
                                                  ** * * *** ** *   ****

M0QV08_E1B19K-01      tg----------aattttggccaccagtccctt-----------------
M0QV08_E1B19K-02      agggaacggggcagaggtggtcatcgataccctggacaaggccgccttca
                       *          *    *** ** *  * ** *                 

M0QV08_E1B19K-01      -------------------------------------------ttcca--
M0QV08_E1B19K-02      ggtgttgcatgatgggaatgagagccggagtgatgaatatgaattccatg

M0QV08_E1B19K-01      ------------------------ggaaag--------------------
M0QV08_E1B19K-02      atctttatgaacatgaagttcaatggagagaagtttaatggggtgctgtt
                                              *** **                    

M0QV08_E1B19K-01      ------------------ggtcctccacagccttgatttttccagcccag
M0QV08_E1B19K-02      catggccaacagccacatgaccctgcatggctgcgactttttcggcttta
                                        *  *** **  **   ** **** * **    

M0QV08_E1B19K-01      g------gcgcactacagccggggttgcttt-------------tgtggt
M0QV08_E1B19K-02      acaatatgtgcgcagaggtctggggcgcttccaagatcaggggatgtaag
                             * ** *    * * ***  ****              ***   

M0QV08_E1B19K-01      ttttctggttgacaaatgg----agccagaacacccaa------------
M0QV08_E1B19K-02      ttttatggctgctggatgggcgtggtcggaagacccaagagcgagatgtc
                      **** *** **    ****     * * *** ******            

M0QV08_E1B19K-01      --------------------------------------------------
M0QV08_E1B19K-02      tgtgaagcagtgtgtgtttgagaaatgctacctgggagtctctaccgagg

M0QV08_E1B19K-01      -----------------------------ctgagcaggggctacattct-
M0QV08_E1B19K-02      gcaatgctagagtgagacactgctcttccctggagacgggctgc-ttctg
                                                   ***   * ***** * **** 

M0QV08_E1B19K-01      ------------------------------------------ggacttcg
M0QV08_E1B19K-02      cctggtgaagggcacagcctctctgaagcataatatggtgaagggctgca
                                                                ** ** * 

M0QV08_E1B19K-01      cgg-----------------------------------------------
M0QV08_E1B19K-02      cggatgagcgcatgtacaacatgctgacatgcgactcgggggtctgccat

M0QV08_E1B19K-01      --------------ccatg--------cacctgtggagg-----------
M0QV08_E1B19K-02      attctgaagaacatccatgtgacctcccacccccggaagaagtggccagt
                                    *****        ****   *** *           

M0QV08_E1B19K-01      -----------------------------------gcctgggt--cagg-
M0QV08_E1B19K-02      gtttgagaataacctgcttatcaagtgccacgtgcacctgggtgccagaa
                                                          *******  ***  

M0QV08_E1B19K-01      -----------cagcggggacagagaatcttgaacta-------------
M0QV08_E1B19K-02      ggggcaccttccagccgtaccagtgtaactttagccagaccaagctgctg
                                 **** *   *** * * *** * * *             

M0QV08_E1B19K-01      ----------ctggcttctacag-----------ccagcagctccg----
M0QV08_E1B19K-02      ttggagaacgatgccttctccagggtgaacctgaacggcatctttgacat
                                 ** ***** ***            * *** **  *    

M0QV08_E1B19K-01      ggtcttcttcgtctacac-----------------agacaaacatccatg
M0QV08_E1B19K-02      ggatgtctcggtgtacaagatcctgagatacgatgagaccaa-gtccagg
                      **   ***  ** ****                  **** **  **** *

M0QV08_E1B19K-01      tt----------------ggaggaagaaat-----gaggca------ggc
M0QV08_E1B19K-02      gtgcgcgcttgcgagtgcgggggcagacacaccaggatgcagccagtggc
                       *                ** ** *** *      ** ***      ***

M0QV08_E1B19K-01      catggacgagaacccgaggagc----------------------ggcctg
M0QV08_E1B19K-02      cctggatgtga--ccgaggagctgagaccagaccacctggtgatggcctg
                      * **** * **  *********                      ******

M0QV08_E1B19K-01      gacc--------------ctccgtcggaagaggagctggattga
M0QV08_E1B19K-02      taccgggaccgagttcagctccagtgg-ggaggacacagattag
                       ***              ****   **  *****    ****  

© 1998-2020Legal notice