Dataset for CDS E1B19K of organism Human adenovirus 28

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

C4P207_E1B19K-01      atggat-----------------gtgtggactatccttgcagactt--ta
C4P207_E1B19K-02      atggagccaggacacccaactgagcaggggcta-catcctggacttcgca
                      *****                  *   ** *** * *    *****   *

C4P207_E1B19K-01      gcaagacac-----gccggcttgta---------gaggatag--------
C4P207_E1B19K-02      gccatgcacctgtggagggcctggatcaggcagcggggacagagaatctt
                      ** *  ***     *  *** ** *         * *** **        

C4P207_E1B19K-01      --------------ttcagacgggtgctccgggttct-------------
C4P207_E1B19K-02      gaactactggcttctacagccagcagctccgggtcttcttcgtctacaca
                                    * *** * *  *********  *             

C4P207_E1B19K-01      --------------------------------------------------
C4P207_E1B19K-02      gacaaacatccatgttggaggaagaaatgagacaggccatggacgagaac

C4P207_E1B19K-01      -----------------------------ggagacactggtttggaactc
C4P207_E1B19K-02      ccgaggagcggcctggaccctccgtcggaagaggagctggattgaa--tc
                                                    ***   **** *** *  **

C4P207_E1B19K-01      ctctatctcgcct------------------ggtgtacac----------
C4P207_E1B19K-02      aggtatccagcctgtacccagagcttagcaaggtgctgacatccatggcc
                         ****  ****                  ****   **          

C4P207_E1B19K-01      -----agttaaga-------------------------------------
C4P207_E1B19K-02      aggggagtgaagagggagaggagcgatgggggtaataccgggatgatgac
                           *** ****                                     

C4P207_E1B19K-01      --------------------------------------------------
C4P207_E1B19K-02      cgagctgacggccagcctgatgaatcggaagcgcccagagcgccttacct

C4P207_E1B19K-01      ---------------aggattataaagaggaatt----------------
C4P207_E1B19K-02      ggtacgagctacagcaggagtgcagggatgagttgggcctgatgcaggat
                                     **** *  *  ** ** **                

C4P207_E1B19K-01      -------------------tgaaaatctttttgctgact-----------
C4P207_E1B19K-02      aaatatggcctggagcagataaaaacccattggttgaacccagatgagga
                                         * **** *  ** * ***             

C4P207_E1B19K-01      ----------------------------------gctctg----------
C4P207_E1B19K-02      ttgggaggaggctattaagaagtatgccaagatagccctgcgcccagatt
                                                        ** ***          

C4P207_E1B19K-01      --------------------------------------gtctgctagatt
C4P207_E1B19K-02      gcaagtacatagtgaccaagaccgtgaatatcagacatgcctgctacatc
                                                            * ****** ** 

C4P207_E1B19K-01      ctctgaatc---------ttggccaccagtccctt---------------
C4P207_E1B19K-02      tcggggaacggggcagaggtggtcatcgataccctggacaaggccgcctt
                          * * *          *** ** *  * ** *               

C4P207_E1B19K-01      ---------------------------------------------ttcca
C4P207_E1B19K-02      caggtgttgcatgatgggaatgagagcaggagtgatgaatatgaattcca

C4P207_E1B19K-01      --------------------------ggaaa-----------gggtact-
C4P207_E1B19K-02      tgatcttcatgaacatgaagttcaatggagagaagtttaatggggtgctg
                                                *** *           **** ** 

C4P207_E1B19K-01      --------------ccaca------------gccttgatttttccagccc
C4P207_E1B19K-02      ttcatggccaacagccacatgaccctgcatggctgcagtttcttcggctt
                                    *****            **     *** * * **  

C4P207_E1B19K-01      agg------gcgcactacagccggggttgcttt-------------tgtg
C4P207_E1B19K-02      caacaatatgtgcgcagaggtctggggcgcttccaagatcaggggatgta
                               * ** *    * * ***  ****              *** 

C4P207_E1B19K-01      gtttttctggttgacaaatgg----agccaggacacccaa----------
C4P207_E1B19K-02      agttttatggctgctggatgggcgtggtcggaagacccaagagcgagatg
                        **** *** **    ****     * * * * ******          

C4P207_E1B19K-01      --------------------------------------------------
C4P207_E1B19K-02      tctgtgaagcagtgtgtgtttgagaaatgctacctgggagtctctaccga

C4P207_E1B19K-01      -------------------------------ctgagcaggggct------
C4P207_E1B19K-02      gggcaatgctagagtgagacactgctcttccctggagacgggctgcttct
                                                     ***   * *****      

C4P207_E1B19K-01      --------------------------------------------------
C4P207_E1B19K-02      gcctggtgaagggcacagcctctctgaagcataatatggtgaagggctgc

C4P207_E1B19K-01      -------------------acatcctggacttcg----------------
C4P207_E1B19K-02      acggatgagcgcatgtacaacatgctgacctgcgattcaggggtctgcca
                                         **** ***  ** **                

C4P207_E1B19K-01      ------------cagccatg--------cacc------------------
C4P207_E1B19K-02      tatcctgaagaacatccatgtgacctcccaccccagaaagaagtggccag
                                  ** *****        ****                  

C4P207_E1B19K-01      ----tgtggagggcctg--gatcagg------------------------
C4P207_E1B19K-02      tgtttgagaataacctgctgatcaagtgccatatgcacctgggcgccaga
                          ** * *   ****  ***** *                        

C4P207_E1B19K-01      ------------cagcggggacagagaatcttgaacta------------
C4P207_E1B19K-02      aggggcacctttcagccgtaccagtgcaactttagccagaccaagctgct
                                  **** *   *** * * *** * * *            

C4P207_E1B19K-01      -----------ctggcttctacag-----------ccagcagctccg---
C4P207_E1B19K-02      gttggagaacgatgccttctccagggtgaacctgaacggcatctttgaca
                                  ** ***** ***            * *** **  *   

C4P207_E1B19K-01      -ggtcttcttcgtctacac-----------------agacaaacatccat
C4P207_E1B19K-02      tggatgtctcggtgtacaagatcctgagatacgatgagaccaa-gtccag
                       **   ***  ** ****                  **** **  **** 

C4P207_E1B19K-01      gttg---------gaggaagaaatgagaca------------------gg
C4P207_E1B19K-02      ggtgcgcgcttgcgagtgcgggggcagacacaccaggatgcagccagtgg
                      * **         ***   *     *****                  **

C4P207_E1B19K-01      ccatggacgagaacccgaggagc----------------------ggcct
C4P207_E1B19K-02      ccctggatgtga--ccgaggagctgagaccagaccacctggtgatggcct
                      ** **** * **  *********                      *****

C4P207_E1B19K-01      ggacc--------------ctccgtcggaagaggagctggattga
C4P207_E1B19K-02      gtaccgggaccgagttcagctccagtgg-ggaggacacagattag
                      * ***              ****   **  *****    ****  

© 1998-2023Legal notice