Dataset for CDS E1B19K of organism Human adenovirus 25

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

M0QUJ3_E1B19K-01      atgga---------------tgtgtggactatccttgcagactttagcaa
M0QUJ3_E1B19K-02      atggagccaggacacccaactgagcaggggatacatcctggacttcgc-a
                      *****               ** *  *   ** * * * *   ** ** *

M0QUJ3_E1B19K-01      gacacgcc---------ggcttgta---------gaggatag--------
M0QUJ3_E1B19K-02      gccatgcacctgtggagggcctggatcaggcagcggggacagagaatctt
                      * ** **          *** ** *         * *** **        

M0QUJ3_E1B19K-01      --------------ttcagacgggtgctccgggttct-------------
M0QUJ3_E1B19K-02      gaactactggcttctacagccagcagctccgggtcttcttcgtctacaca
                                    * *** * *  *********  *             

M0QUJ3_E1B19K-01      --------------------------------------------------
M0QUJ3_E1B19K-02      gacaaacatccatgttggaggaagaaatgaggcaggccatggacgagaac

M0QUJ3_E1B19K-01      -----------------------------ggagacactggtttggaac--
M0QUJ3_E1B19K-02      ccgaggagcggcctggaccctccgtcggaagaggagctggattgaatcag
                                                    ***   **** *** * *  

M0QUJ3_E1B19K-01      -------tcctctatct---------------------------------
M0QUJ3_E1B19K-02      gtatccagcctgtacccagagcttagcaaggtgctgacatccatggccag
                              *** ** *                                  

M0QUJ3_E1B19K-01      --------------------------------------------------
M0QUJ3_E1B19K-02      gggagtgaagagggagaggagcgatgggggcaataccgggatgatgaccg

M0QUJ3_E1B19K-01      -----------------------------cgcc-----------------
M0QUJ3_E1B19K-02      agctgactgccagcctgatgaatcgcaagcgcccagagcgcattacctgg

M0QUJ3_E1B19K-01      -------------tggtgtacacagttaaga-------------------
M0QUJ3_E1B19K-02      catgagctacagatggagtgcagggatgagataggcctgatgcaggataa
                                   *** ** **  * * ***                   

M0QUJ3_E1B19K-01      --------------------------------------------aggatt
M0QUJ3_E1B19K-02      atatggtctggagcagataaaaacccactggttaaacccagatgaggatt

M0QUJ3_E1B19K-01      ataaagagg-aatttgaaaatatttttgctgactgctctg----------
M0QUJ3_E1B19K-02      gggaggaggccattaagaaatatgccaa--gatagccctgcgcccagatt
                         * ****  ***   ******       **  ** ***          

M0QUJ3_E1B19K-01      --------------------------------------gcctgctagatt
M0QUJ3_E1B19K-02      gcaagtacagggtgaccaagacggtgaatatcagacatgcctgctacatc
                                                            ******** ** 

M0QUJ3_E1B19K-01      ctctgaatc---------ttggccaccagtccctt---------------
M0QUJ3_E1B19K-02      tcggggaacggggcagaggtggtcatcgataccctggacaaggccgcctt
                          * * *          *** ** *  * ** *               

M0QUJ3_E1B19K-01      ---------------------------------------------ttcca
M0QUJ3_E1B19K-02      caggtgttgcatgatgggaatgagagccggagtgatgaatatgaattcca

M0QUJ3_E1B19K-01      --------------------------ggaaag------------------
M0QUJ3_E1B19K-02      tgatcttcatgaacatgaagttcaatggagagaagtttaatggagtgatg
                                                *** **                  

M0QUJ3_E1B19K-01      --------------------ggtactccacagccttgatttttccagtcc
M0QUJ3_E1B19K-02      ttcatggccaacagccacatgaccctgcatggctgtagtttcttcggctt
                                          *   ** **  **  *  *** * * *   

M0QUJ3_E1B19K-01      agg------gcgcactacagccggggttgcttt-------------tgtg
M0QUJ3_E1B19K-02      caacaatatgtgcgcagaggtctggggcgcttccaagatcaggggatgta
                               * ** *    * * ***  ****              *** 

M0QUJ3_E1B19K-01      gtttttctggttgacaaatgg----agccaggacacccaa----------
M0QUJ3_E1B19K-02      agttttatggctgctggatgggcgtggtcggaagacccaagagcgagatg
                        **** *** **    ****     * * * * ******          

M0QUJ3_E1B19K-01      -ctg---agcag--------------------------------------
M0QUJ3_E1B19K-02      tctgtgaagcagtgtgtgtttgagaaatgctacctgggagtttctaccga
                       ***   *****                                      

M0QUJ3_E1B19K-01      -------------gggatacat--------cctgga--------------
M0QUJ3_E1B19K-02      gggcaatgctagagtgagacattgctcttccctggagacgggctgcttct
                                   * ** ****        ******              

M0QUJ3_E1B19K-01      ---------------------cttcgcagc--------------------
M0QUJ3_E1B19K-02      gcctggtgaagggtacagcctctctgaagcataatatggtgaagggatgc
                                           **  * ***                    

M0QUJ3_E1B19K-01      --------------------catgc--acctgtg----gagggcctg---
M0QUJ3_E1B19K-02      acggatgagcgcatgtacaacatgctgacctgcgactcgggagtctgtca
                                          *****  ***** *    * * * ***   

M0QUJ3_E1B19K-01      --------------------------------------------------
M0QUJ3_E1B19K-02      tatcctgaaaaacatccatgtgacctcccaccccagaaagaagtggccag

M0QUJ3_E1B19K-01      -------------------gatcagg------------------------
M0QUJ3_E1B19K-02      tgtttgagaataacctgctgatcaagtgccatatgcacctgggcgccaga
                                         ***** *                        

M0QUJ3_E1B19K-01      ------------cagcggggacagagaatcttga-------------act
M0QUJ3_E1B19K-02      aggggcaccttccagccgtaccagtgcaactttagtcagaccaagctgct
                                  **** *   *** * * *** *              **

M0QUJ3_E1B19K-01      actgg----------cttctacag-----------ccagcagctccg---
M0QUJ3_E1B19K-02      gttggagaacgatgccttctccagggtgaacctgaacggcatctttgaca
                        ***          ***** ***            * *** **  *   

M0QUJ3_E1B19K-01      -ggtcttcttcgtctacac-----------------agacaaacatccat
M0QUJ3_E1B19K-02      tggatgtctcggtgtacaagatcctgagatacgatgagaccaa-gtccag
                       **   ***  ** ****                  **** **  **** 

M0QUJ3_E1B19K-01      gtt----------------ggaggaaga--------aatgaggca---gg
M0QUJ3_E1B19K-02      ggtgcgcgcttgcgagtgcgggggcagacacaccagaatgcaaccagtgg
                      * *                ** ** ***        ****   *    **

M0QUJ3_E1B19K-01      ccatggacgagaacccgaggagc----------------------ggcct
M0QUJ3_E1B19K-02      ccctggatgtga--ccgaggagctgagaccagaccacctggtgatggcct
                      ** **** * **  *********                      *****

M0QUJ3_E1B19K-01      ggacc--------------ctccgtcggaagaggagctggattga
M0QUJ3_E1B19K-02      gtaccgggaccgagttcagctccagtgg-ggaggatacagattag
                      * ***              ****   **  *****    ****  

© 1998-2020Legal notice