Dataset for CDS E1B19K of organism Human adenovirus 24

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

M0QUF3_E1B19K-01      atggat-----------------gtgtggactatccttgcagactttagc
M0QUF3_E1B19K-02      atggagccagaacacccaactgagcaggggcta-cattctggacttcg--
                      *****                  *   ** *** * **   *****    

M0QUF3_E1B19K-01      aagacacgccggcttgtagaggata-------------------------
M0QUF3_E1B19K-02      cagccatgc--acctgtggagggcatgggtgaggcagcggggacagagaa
                       ** ** **   * *** ****  *                         

M0QUF3_E1B19K-01      -----------------gttcagacgggtgctccgggttct---------
M0QUF3_E1B19K-02      tcttgaactactggcttatacagccagcagctccgggtcttcttcgtcta
                                        * *** * *  *********  *         

M0QUF3_E1B19K-01      --------------------------------------------------
M0QUF3_E1B19K-02      cacagacaaacatccatgttggaggaagaaatgaggcaggccatggacga

M0QUF3_E1B19K-01      ---------------------------------ggagacactggtttgga
M0QUF3_E1B19K-02      gaacccgaggagcggcctggaccctccgtcggaagaggagctggattgaa
                                                        ***   **** *** *

M0QUF3_E1B19K-01      ac---------tcctctatct-----------------------------
M0QUF3_E1B19K-02      tcaggtatccagcctgtacccagagcttagcagggtgctgacatccatgg
                       *          *** ** *                              

M0QUF3_E1B19K-01      --------------------------------------------------
M0QUF3_E1B19K-02      ccaggggagtgaagagggagaggagcgatgggggcaataccgggatgatg

M0QUF3_E1B19K-01      ---------------------------------cgtctggtgtacac---
M0QUF3_E1B19K-02      accgagctgacggccagcctgatgaatcgcaagcgtccagagcgcattac
                                                       ****  * *  **    

M0QUF3_E1B19K-01      --------agtta-agaaggattataacgaggaatt--------------
M0QUF3_E1B19K-02      ctggcacgagctacagatggagtgtagggatgaggtgggcctgatgcagg
                              ** ** *** *** * **  ** **  *              

M0QUF3_E1B19K-01      ---------------------tgaaaatctttttgct-------------
M0QUF3_E1B19K-02      ataaatatggcctggagcagataaaaacccactggttgaacccagatgag
                                           * **** *   * * *             

M0QUF3_E1B19K-01      --------------------------------gattgctctg--------
M0QUF3_E1B19K-02      gattgggaggaggccattaagaaatatgccaagatagccctgcgcccaga
                                                      *** ** ***        

M0QUF3_E1B19K-01      ----------------------------------------gcctgcta--
M0QUF3_E1B19K-02      ttgcaagtacagggtgaccaagacggtgaatatcagacatgcctgctaca

M0QUF3_E1B19K-01      ----------------------gattctctaaatctcggccaccagtccc
M0QUF3_E1B19K-02      tctcggggaacggggcagaggtggtcatcgataccctgg--acaaggccg
                                            * *  ** * * *  **  ** ** ** 

M0QUF3_E1B19K-01      ttttccag--------------------------------gaaagggtac
M0QUF3_E1B19K-02      ccttcaggtgttgcatgatgggaatgagagccggagtgatgaatatgaat
                        ***  *                                ***   * * 

M0QUF3_E1B19K-01      tccacagccttgat------------------------------------
M0QUF3_E1B19K-02      tccatgattttcatgaacatgaagttcaatggagagaagtttaatggggt
                      ****     ** **                                    

M0QUF3_E1B19K-01      --ttttcaagcccag---------ggcgcactacagccggggttgcttt-
M0QUF3_E1B19K-02      gatgttcatggccaacagtcacatgaccctgcacggctgcagtttcttcg
                        * **** * ***          * * *   ** ** *  *** ***  

M0QUF3_E1B19K-01      --------------------------------------------------
M0QUF3_E1B19K-02      gcttcaacaatatgtgcgcagaggtctggggcgctgctaagatcagggga

M0QUF3_E1B19K-01      tgtggtttttctggttgacaaatgg----agccagaacacccaa------
M0QUF3_E1B19K-02      tgtaagttttatggctgctggatgggcgtggtcggaagacccaagagcga
                      ***   **** *** **    ****     * * *** ******      

M0QUF3_E1B19K-01      --------------------------------------------------
M0QUF3_E1B19K-02      gatgtctgtgaagcagtgtgtgtttgagaaatgctacctgggagtctcta

M0QUF3_E1B19K-01      -----------------------------------ctgagcaggggct--
M0QUF3_E1B19K-02      ccgagggcaatgctagagtgagacattgctcttccctggagacgggctgc
                                                         ***   * *****  

M0QUF3_E1B19K-01      --------------------------------------------------
M0QUF3_E1B19K-02      ttctgcctggtgaagggcacagcctctctgaagcataatatggtgaaggg

M0QUF3_E1B19K-01      -----------------------acattctg------gacttcg------
M0QUF3_E1B19K-02      ctgcacggatgagcgcatgtacaacatgctgacatgcgactcgggggtct
                                             **** ***      ****  *      

M0QUF3_E1B19K-01      ----------------cagccatg--------cacctgtggagggcatgg
M0QUF3_E1B19K-02      gccatatcctgaagaacatccatgtgacctcccacccccggaagaagtgg
                                      ** *****        ****   *** *   ***

M0QUF3_E1B19K-01      --------------------------------------------gtgagg
M0QUF3_E1B19K-02      ccagtgtttgagaataacctactgatcaagtgccacatgcacctgggcgc
                                                                  * * * 

M0QUF3_E1B19K-01      cagcgggga----------------cagagaatcttga------------
M0QUF3_E1B19K-02      cagaaggggcaccttccagccgtaccagtgcaactttagccagaccaagc
                      ***  ***                 *** * * *** *            

M0QUF3_E1B19K-01      -actactgg----------cttatacag-----------ccagcagctcc
M0QUF3_E1B19K-02      tgctgctggagaacgatgccttctccagggtgaacctgaacggcatcttt
                        ** ****          *** * ***            * *** **  

M0QUF3_E1B19K-01      g----ggtcttcttcgtctacac-----------------agacaaacat
M0QUF3_E1B19K-02      gacatggatgtctcggtgtacaagatcctgagatacgatgagaccaa-gt
                      *    **   ***  ** ****                  **** **  *

M0QUF3_E1B19K-01      ccatgtt----------------ggaggaagaaat-----gaggca----
M0QUF3_E1B19K-02      ccagggtgcgcgcttgcgagtgcgggggcagacacaccaggatgcaacca
                      *** * *                ** ** *** *      ** ***    

M0QUF3_E1B19K-01      --ggccatggacgagaacccgaggagc----------------------g
M0QUF3_E1B19K-02      gtggccctggatgtga--ccgaggagctgaggcccgaccacctggtgatg
                        **** **** * **  *********                      *

M0QUF3_E1B19K-01      gcctggacc--------------ctccgtcggaagaggagctggattga
M0QUF3_E1B19K-02      gcttgtaccgggaccgagttcagctccagtgg-ggaggacacagattag
                      ** ** ***              ****   **  *****    ****  

© 1998-2020Legal notice