Dataset for CDS adenoviridae of organism Human adenovirus 23

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

M0QUB4_E1B19K-01      atggatgtgtggactatccttgcagactttagcaagacacgccggcttgt
W8CZB0_E1B19K-01      atggaggtgtggactatccttggagactttaacaagacacgccggcttgt
                      ***** **************** ******** ******************

M0QUB4_E1B19K-01      agaggatagttcagacgggtgctccgggttctggagacactggtttggaa
W8CZB0_E1B19K-01      agaggatagttcagacgggtgctccgggttttggagacactggtttggaa
                      ****************************** *******************

M0QUB4_E1B19K-01      ctcctctatctcgcctggtgtacacagttaagaaggattataaagaggaa
W8CZB0_E1B19K-01      ctcctctatctcgcctggtgtacacagttaagaaggattataacgaggaa
                      ******************************************* ******

M0QUB4_E1B19K-01      tttgaaaatctttttgctgactgctctggcctgctagattctctgaatct
W8CZB0_E1B19K-01      tttgaaaatctttttgctgactgctctggcctgcttgattctctgaattt
                      *********************************** ************ *

M0QUB4_E1B19K-01      tggccaccagtcccttttccaggaaagggtactccacagccttgattttt
W8CZB0_E1B19K-01      tggccaccagtcccttttccaggaaagggtcctgcacagccttgattttt
                      ****************************** ** ****************

M0QUB4_E1B19K-01      ccagcccagggcgcactacagccggggttgcttttgtggtttttctggtt
W8CZB0_E1B19K-01      ccagcccagggcgcactacagccggggttgcttttgtggtttttctggtt

M0QUB4_E1B19K-01      gacaaatggagccaggacacccaactgagcaggggctacatcctggactt
W8CZB0_E1B19K-01      gacaaatggagccagaacacccaactgagcaggggctacattctggactt
                      *************** ************************* ********

M0QUB4_E1B19K-01      cgcagccatgcacctgtggagggcctggatcaggcagcggggacagagaa
W8CZB0_E1B19K-01      cgcagccatgcacctgtggagggcctgggtcaggcagcggggacagagaa
                      **************************** *********************

M0QUB4_E1B19K-01      tcttgaactactggcttctacagccagcagctccgggtcttcttcgtcta
W8CZB0_E1B19K-01      tcttgaactactggcttctacagccagcagctccgggtcttcttcgtcta

M0QUB4_E1B19K-01      cacagacaaacatccatgttggaggaagaaatgaggcaggccatggacga
W8CZB0_E1B19K-01      cacagacaaacatccatgttggaggaagaaatgaggcaggccatggacga

M0QUB4_E1B19K-01      gaacccgaggagcggcctggaccctccgtcggaagaggagctggattga
W8CZB0_E1B19K-01      gaacccgaggagcggcctggaccctccgtcggaagaggagctggattga

© 1998-2020Legal notice