Dataset for CDS adenoviridae of organism Human adenovirus 19

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

B9A5Q1_E1B19K-01      atggatgtgtggactatccttgcagactttagcaagacacgccggcttgt
B9A5T7_E1B19K-01      atggatgtgtggactatccttgcagactttagcaagacacgccggcttgt

B9A5Q1_E1B19K-01      agaggatagttcagacgggtgctccgggttctggagacactggtttggaa
B9A5T7_E1B19K-01      agaggatagttcagacgggtgctccgggttctggagacactggtttggaa

B9A5Q1_E1B19K-01      ctcctctatctcgcctggtgtacacagttaagaaggattataaagaggaa
B9A5T7_E1B19K-01      ctcctctatctcgactggtgtacacagttaagaaggattataacgaggaa
                      ************* ***************************** ******

B9A5Q1_E1B19K-01      tttgaaaatctttttgctgactgctctggcctgctagattctctgaatct
B9A5T7_E1B19K-01      tttgaaaatctttttgctgattgctctggcctgctagattctctgaatct
                      ******************** *****************************

B9A5Q1_E1B19K-01      tggccaccagtcccttttccaggaaagggtactccacagccttgattttt
B9A5T7_E1B19K-01      cggccaccagtcccttttccaggaaagggtactccacagccttgattttt

B9A5Q1_E1B19K-01      ccagcccagggcgcactacagccggggttgcttttgtggtttttctggtt
B9A5T7_E1B19K-01      ccagcccagggcgcactacagccggggttgcttttgtggtttttctggtt

B9A5Q1_E1B19K-01      gacaaatggagccaggacacccaactgagcaggggctacatcctggactt
B9A5T7_E1B19K-01      gacaaatggagccagaacacccaactgagcaggggctacattctggactt
                      *************** ************************* ********

B9A5Q1_E1B19K-01      cgcagccatgcacctgtggagggcctggatcaggcagcggggacagagaa
B9A5T7_E1B19K-01      cgcagccatgcacctgtggagggcatgggtgaggcagcggggacagagaa
                      ************************ *** * *******************

B9A5Q1_E1B19K-01      tcttgaactactggcttctacagccagcagctccgggtcttcttcgtcta
B9A5T7_E1B19K-01      tcttgaactactggcttatacagccagcagctccgggtcttcttcgtcta
                      ***************** ********************************

B9A5Q1_E1B19K-01      cacagacaaacatccatgttggaggaagaaatgaggcaggccatggacga
B9A5T7_E1B19K-01      cacagacaaacatccatgttggaggaagaaatgaggcaggccatggacga

B9A5Q1_E1B19K-01      gaacccgaggagcggcctggaccctccgtcggaagaggagctggattga
B9A5T7_E1B19K-01      gaacccgaggagcggcctggaccctccgtcggaagaggagctgaattga
                      ******************************************* *****

© 1998-2022Legal notice