Dataset for CDS BCL2L2 of organism Sarcophilus harrisii

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G3WPT1_BCL2L2-01      catagctcaagccccattttcttctctctgccttttatagccagccagat
G3WPT1_BCL2L2-02      ------------------------------------------------at
                                                                      **

G3WPT1_BCL2L2-01      ggcgactccagcctcagccccagatactcgagccctggtggcagattttg
G3WPT1_BCL2L2-02      ggcgactccagcctcagccccagatactcgagccctggtggcagattttg
                      **************************************************

G3WPT1_BCL2L2-01      tgggttataagctaaggcagaagggctatgcctgtggaactggcccagga
G3WPT1_BCL2L2-02      tgggttataagctaaggcagaagggctatgcctgtggaactggcccagga
                      **************************************************

G3WPT1_BCL2L2-01      gagggccctacaaatgagcctctgcaccgggccatgcgagccgctggaga
G3WPT1_BCL2L2-02      gagggccctacaaatgagcctctgcaccgggccatgcgagccgctggaga
                      **************************************************

G3WPT1_BCL2L2-01      tgagtttgagtcccgtttccgacgcacattttctgatctggctgctcagt
G3WPT1_BCL2L2-02      tgagtttgagtcccgtttccgacgcacattttctgatctggctgctcagt
                      **************************************************

G3WPT1_BCL2L2-01      tgcatgtgactcctggctcagcccagcagcgctttacccaggtctcagat
G3WPT1_BCL2L2-02      tgcatgtgactcctggctcagcccagcagcgctttacccaggtctcagat
                      **************************************************

G3WPT1_BCL2L2-01      gagctcttccaggggggggccaactggggccgtcttgtggcattcttcgt
G3WPT1_BCL2L2-02      gagctcttccaggggggggccaactggggccgtcttgtggcattcttcgt
                      **************************************************

G3WPT1_BCL2L2-01      ctttggggcagcgctctgtgcagagagcgtcaacaaagagatggagccac
G3WPT1_BCL2L2-02      ctttggggcagcgctctgtgcagagagcgtcaacaaagagatggagccac
                      **************************************************

G3WPT1_BCL2L2-01      tggtgggacaagaaaaaagatatggggtgcacttgaagcagggaatttta
G3WPT1_BCL2L2-02      tggtgggacaggttcaggattggatggtgacctacctagagacacagctg
                      ********** *   *    *    ****  **      **  *    * 

G3WPT1_BCL2L2-01      gcaaggtatttaccaagcaaggctggagct--gcggaattcacggctctg
G3WPT1_BCL2L2-02      gcagactggatccacagca--gcgggggctgggcggaattcacggctctg
                      ***   *   * *  ****  ** ** ***  ******************

G3WPT1_BCL2L2-01      tacggggatggggccctggaggaggcaaggcgtctgcgggaggggaactg
G3WPT1_BCL2L2-02      tacggggatggggccctggaggaggcaaggcgtctgcgggaggggaactg
                      **************************************************

G3WPT1_BCL2L2-01      ggcctcagtgcgtacagtgctaacaggggctgtggcactgggggctctgg
G3WPT1_BCL2L2-02      ggcctcagtgcgtacagtgctaacaggggctgtggcactgggggctctgg
                      **************************************************

G3WPT1_BCL2L2-01      tgactgtgggggccttctttgccagcaagtga
G3WPT1_BCL2L2-02      tgactgtgggggccttctttgccagcaagtga
                      ********************************

© 1998-2020Legal notice