Dataset for CDS BCL-2 of organism Esox lucius

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3P8YNB4_BCL2-01      atggcagacg---------acgataaccgttttatagtggaaaagtacat
A0A3P9AAB2_BCL2-01      atggcaaacgagaatccatatgacagtcgcgtcattgtcgaaaattacat
                        ****** ***         * ** *  **  * ** ** ***** *****

A0A3P8YNB4_BCL2-01      ttgtcacaaactcttaaaacggggatatgcatggg-atttcgaagatgca
A0A3P9AAB2_BCL2-01      ctatgataaactgttgaagaatggatttgtttgggaatttcaaa----ca
                         * * * ***** ** **    **** **  **** ***** **    **

A0A3P8YNB4_BCL2-01      gaggaggaagatggtgctaataatgg-gtcgatgatttctc---------
A0A3P9AAB2_BCL2-01      gagaaccaatctcg---aaataacgtctttgaggatccctctccccccaa
                        *** *  **  * *    ***** *   * ** ***  ***         

A0A3P8YNB4_BCL2-01      ctccgccggg--tttggtacggcggattca---tggggccagtaaagccg
A0A3P9AAB2_BCL2-01      ctcccccgaactttttgcacggaggctccaacctcccgcc------gctg
                        **** ***    *** * **** ** * **   *   ***      ** *

A0A3P8YNB4_BCL2-01      gacagggcagcgttccccatatttccaaatggctctcccaaccagacccg
A0A3P9AAB2_BCL2-01      gcgaggacaacgaccctcagttcgcaaataggatcccgcaaccggacccg
                        *  *** ** **  ** **  *  * **  ** ** * ***** ******

A0A3P8YNB4_BCL2-01      catgcagctattcacagagtgttgcgtgaggccggggacgaactcgaaag
A0A3P9AAB2_BCL2-01      cacgcccggctccacagagtcctccgcgatgccgggaacgagatcgaaag
                        ** **     * ********  * ** ** ****** ****  *******

A0A3P8YNB4_BCL2-01      actgtaccaacccgactttttggagatgtcacaccagctgtatctgacgt
A0A3P9AAB2_BCL2-01      aatgtatcagcgggactttgcagagatgtcggggcagttgcatattacgc
                        * **** ** *  ******   ********    *** ** ** * *** 

A0A3P8YNB4_BCL2-01      cctctgtggccgagaggagattcagagaggttatagacgagctgttcaga
A0A3P9AAB2_BCL2-01      ccagcacggcacatggacgatttaccgcagtaatagacgaactgttcagc
                        **     ***  *  *  **** *  *  ** ******** ******** 

A0A3P8YNB4_BCL2-01      gacggagttaactggggacgtattatcgctttcttcgagttcgggggcac
A0A3P9AAB2_BCL2-01      gacggtgtaaactggggtcggattgtggctttccttgagtttggagggac
                        ***** ** ******** ** *** * ****** * ***** ** ** **

A0A3P8YNB4_BCL2-01      aatatgcgtggaatgcgtgaacaaggaaatgacttcgcaggtggaccaca
A0A3P9AAB2_BCL2-01      aatgtgcgtggagagcgtcaaccgggagatgacgccccaggtgaacaaca
                        *** ********  **** ***  *** *****  * ****** ** ***

A0A3P8YNB4_BCL2-01      ttgccgggtggatgacagaatatctaaatggacccctgcacagctggatt
A0A3P9AAB2_BCL2-01      tcgtccattggatgacggagtacctgaatggacccctgcaaaactggatc
                        * * *   ******** ** ** ** ************** * ****** 

A0A3P8YNB4_BCL2-01      caagaaaacgggggatgggaggcctttgtggagctctatgacagacagag
A0A3P9AAB2_BCL2-01      caggagaatggtggatgggatgctttcgtggagatctatgggcagaagag
                        ** ** ** ** ******** ** ** ****** ******      ****

A0A3P8YNB4_BCL2-01      ggactctgtgttctgttcatggccctccatcaagactgtctttggcctgg
A0A3P9AAB2_BCL2-01      gggctctctcttccattcatggcctttcctcaagaccatgtttagcttgg
                        ** **** * ***  ********* * * *******  * *** ** ***

A0A3P8YNB4_BCL2-01      ctgcactgggggctgcaagcctcaccattggagcataccttacacagaag
A0A3P9AAB2_BCL2-01      ccgccctgggggcagctggagtcaccattggagccatgttcacccagaag
                        * ** ******** **  *  *************     * ** ******

A0A3P8YNB4_BCL2-01      tga
A0A3P9AAB2_BCL2-01      tga

© 1998-2020Legal notice