Dataset for CDS MCL-1 of organism Cebus capucinus imitator

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5R5E2_MCL1-03      atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgg
A0A2K5R5E2_MCL1-04      atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgg
                        **************************************************

A0A2K5R5E2_MCL1-03      gggggccggcttgggggctggcagcggcggcgccacccctccgggagggc
A0A2K5R5E2_MCL1-04      gggggccggcttgggggctggcagcggcggcgccacccctccgggagggc
                        **************************************************

A0A2K5R5E2_MCL1-03      ggcttttggccacggagaaggaggcctcggc-ccagcgagaggtaggggg
A0A2K5R5E2_MCL1-04      ggcttttggcgac--------------cggcgccaaggacacaaagccaa
                        ********** **              **** ***  ** *   **    

A0A2K5R5E2_MCL1-03      aggggaggccggcgcggtgattggcggaagcgtcggcgctagccccccgg
A0A2K5R5E2_MCL1-04      tgggcaggtc--------------cggggccgccagcaggaaggctctgg
                         *** *** *              ***   ** * **   *   * * **

A0A2K5R5E2_MCL1-03      ccgccctcacgcctgacgcccggagggtcgtgcggccgccgcccattggc
A0A2K5R5E2_MCL1-04      --------agaccttacgacgggtggg------ggacggcgtgca-----
                                *  *** *** * ** ***      ** ** **  **     

A0A2K5R5E2_MCL1-03      gccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgc
A0A2K5R5E2_MCL1-04      -------------gcgcaaccacga-------------gacggccttc--
                                      **  *** ***             *  *  ****  

A0A2K5R5E2_MCL1-03      gcccacccgccgcgcggcgccgcttgaggagatggaagccccggccgccg
A0A2K5R5E2_MCL1-04      ------------caaggca-tgcttcggaaactggacatcaaaaacgaag
                                    *  ***   ****  * *  ****   *     **  *

A0A2K5R5E2_MCL1-03      acgccatcatgtctcccgaagaagagctggacgggtacgagccagagcct
A0A2K5R5E2_MCL1-04      acgatgtcaaatctt--------------------------------tgt
                        ***   ***  ***                                   *

A0A2K5R5E2_MCL1-03      ctcgggaagcggccggctgtcctgcccctgctggagttggtcggggagcc
A0A2K5R5E2_MCL1-04      ctcgagtgatggtc------------------------------------
                        **** *    ** *                                    

A0A2K5R5E2_MCL1-03      tggtaatggctccagtacggacgggtcactaccctcgacgccgccgccag
A0A2K5R5E2_MCL1-04      ----catgttttcag--------------------cgacggcgtaacaaa
                             ***  * ***                    ***** **   * * 

A0A2K5R5E2_MCL1-03      cagagg-aggaggaggacgagttgtaccggcagtcgctggagattatctc
A0A2K5R5E2_MCL1-04      ctggggtagga----------ttgt---gactctcatt--------tatt
                        * * ** ****          ****   * *  **  *        * * 

A0A2K5R5E2_MCL1-03      tcggtaccttcgggagcaggcgaccggcgccaaggacacaaagccaatgg
A0A2K5R5E2_MCL1-04      ttggtgcctttgtggccaaacacttg-----aagaccataaa-ccaagaa
                        * *** **** * *  **  *    *     ***  ** *** ****   

A0A2K5R5E2_MCL1-03      gcaggtccggggccgccagcaggaaggctctggagacctt------acga
A0A2K5R5E2_MCL1-04      agctgcattgaaccattagcagaaagtatc-acagacgttctcgtaagga
                            *    *  **   ***** ***  **   **** **      * **

A0A2K5R5E2_MCL1-03      cgggtgggggacggcgtgcagcgcaaccacgagacggccttccaaggatg
A0A2K5R5E2_MCL1-04      caaaacgggactggc---tagttaaacaaagaggctg--------ggatg
                        *     ***   ***    **   *** * *** * *        *****

A0A2K5R5E2_MCL1-03      ggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaat
A0A2K5R5E2_MCL1-04      ggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaat
                        **************************************************

A0A2K5R5E2_MCL1-03      gtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
A0A2K5R5E2_MCL1-04      gtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
                        **************************************************

A0A2K5R5E2_MCL1-03      tctaataagatagccttgtaa
A0A2K5R5E2_MCL1-04      tctaataagatag--------
                        *************        

© 1998-2020Legal notice