Dataset for CDS BCL2L10 of organism Callithrix jacchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A5F4WGS2_BCL2L10      atggctgacccgctgcg---------------ggtggtggctgactacct
F7CT87_BCL2L10-01       atggctgacccgctgcggcagcgcaccgagcagctggtgacggactacct
                        *****************               * ***** * ********

A0A5F4WGS2_BCL2L10      ggagtgctgcttccgggagcccggcacccccgagtcgccgccgtccacgg
F7CT87_BCL2L10-01       ggagtactgctcccgggagcctggcacccccgagtcgccgccgtccaccg
                        ***** ***** ********* ************************** *

A0A5F4WGS2_BCL2L10      ccgaggccgctgtgctgcgcgccatggccgccggtgtacggaaactgtac
F7CT87_BCL2L10-01       ccgaggccgctgtgctgcgcgccgtggccgccagtgtgcggaaactctac
                        *********************** ******** **** ******** ***

A0A5F4WGS2_BCL2L10      cggtccttcttctccgcctacctcctctaccccgggaaccgcggcgagct
F7CT87_BCL2L10-01       cggtctttcttctccgcctacctcggctaccccgggaaccgcgtcgagct
                        ***** ******************  ***************** ******

A0A5F4WGS2_BCL2L10      ggtggcgaggatggcggaggccctgctctccgacagtcccggccccacct
F7CT87_BCL2L10-01       ggtggcgaggatggcggaggccctgctctccgacagtcccggccccacct
                        **************************************************

A0A5F4WGS2_BCL2L10      ggggcaacgtggtgatgctcctggccttcgcagggacgctgctagagagg
F7CT87_BCL2L10-01       ggggcaacgtggtgatgctcctggccttcgcggggacgctgctagagagg
                        ******************************* ******************

A0A5F4WGS2_BCL2L10      gggccgctggtgaccgcccggtggaagaagtggggcttccggtcgtggct
F7CT87_BCL2L10-01       gggccgctggtgaccgcccggtggaagaagtggggcttccagtctcggct
                        **************************************** ***  ****

A0A5F4WGS2_BCL2L10      gaaggagccggagggcgacgtcgcacgggactgccagcgcctggtggcct
F7CT87_BCL2L10-01       gaaggagccggaaggcgacgtcgcccgggactgccagcgcctggtggcct
                        ************ *********** *************************

A0A5F4WGS2_BCL2L10      tgatgagcccgcggctcgtgggacagcaccgtgcctggctggaggctcag
F7CT87_BCL2L10-01       tgctgagttcgcggctcgtggggcagcaccgtgcctggctggaggctcag
                        ** ****  ************* ***************************

A0A5F4WGS2_BCL2L10      ggcggctgggatggcttttgttacttcttcaggacctcctactcgctggc
F7CT87_BCL2L10-01       ggcggctgggatggcttttgttacttcttcaggacctcctccttgctggc
                        **************************************** ** ******

A0A5F4WGS2_BCL2L10      attatggagaaaactgctggtccaggttttcctgtcatggttgttaacag
F7CT87_BCL2L10-01       attatggagaaaagtgctggtccaggttttcctgtcatggttgttaacag
                        ************* ************************************

A0A5F4WGS2_BCL2L10      cagcattcatctacttctggacacgataa
F7CT87_BCL2L10-01       cagtattcatctacttctggacacgataa
                        *** *************************

© 1998-2020Legal notice