Dataset for CDS BCL2L10 of organism Bos indicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4W2C0F3_BCL2L10      tcagctgactcacttcattccatggtggacccgtttagggagcgcaccgc
A0A4W2FG99_BCL2L10      tcagctgactcacttcattccatggtggacccgtttagggagcgcaccgc
                        **************************************************

A0A4W2C0F3_BCL2L10      ccggctgctgatggactacctggagttctgcgcccgggagccgggcactc
A0A4W2FG99_BCL2L10      ccggctgctgatggactacctggagttctgcgcccgggagccgggcactc
                        **************************************************

A0A4W2C0F3_BCL2L10      cagttcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggcc
A0A4W2FG99_BCL2L10      cagctcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggcc
                        *** **********************************************

A0A4W2C0F3_BCL2L10      gcacgtatccaggaagcaaatcgaaatgtcttgcccctataccgccgctg
A0A4W2FG99_BCL2L10      gcacgtatccaggaagcaaatcgaaatgtcttgcccctataccgccgctg
                        **************************************************

A0A4W2C0F3_BCL2L10      ccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctactcg
A0A4W2FG99_BCL2L10      ccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctactcg
                        **************************************************

A0A4W2C0F3_BCL2L10      acgaagaccctggccccagctggggccgcgtggcctcactcgtgaccttc
A0A4W2FG99_BCL2L10      acgaagaccctggccccagctggggccgcgtggcctcactcgtgaccttc
                        **************************************************

A0A4W2C0F3_BCL2L10      gcggggtcgctgctggagaggccgccgcagactacccgacggcagaagag
A0A4W2FG99_BCL2L10      gcggggtcgctgctggagaggccgccgcagactacccgacggcagaagag
                        **************************************************

A0A4W2C0F3_BCL2L10      agacgacgacggcgttagcagggactgtcggctcctggtggcccttctgt
A0A4W2FG99_BCL2L10      agacgacgacggcgttagcagggactgtcggctcctggtggcccttctgt
                        **************************************************

A0A4W2C0F3_BCL2L10      gtgctcagttctgcgaaaggcaccgcgcctggctgatggctaacggcggc
A0A4W2FG99_BCL2L10      gtgctcagttctgcgaaaggcaccgcgcctggctgatggctaacggcggc
                        **************************************************

A0A4W2C0F3_BCL2L10      tgggatggattttgtctctttttcagccagtcattccagccatcttggga
A0A4W2FG99_BCL2L10      tgggatggattttgtctctttttcagccagtcattccagccatcttggga
                        **************************************************

A0A4W2C0F3_BCL2L10      aagacagctggtctggtttttcctcgcatactggacagcaataatcataa
A0A4W2FG99_BCL2L10      aagacagctggtctggtttttcctcgcatactggacagcaataatcataa
                        **************************************************

A0A4W2C0F3_BCL2L10      tctacttctggataaaattattgtga
A0A4W2FG99_BCL2L10      tctacttctggataaaattattgtga
                        **************************

© 1998-2023Legal notice