Dataset for CDS BCL2L1 of organism Bos indicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4W2D608_BCL2L1-      atgtctcagagcaatcgggaactagtggttgactttctctcttacaagct
A0A4W2F845_BCL2L1-      atgtctcagagcaatcgggaactagtggttgactttctctcttacaagct
                        **************************************************

A0A4W2D608_BCL2L1-      ttcccagaaaggatacagctggagtcagtttagtggtatgaaagaacaca
A0A4W2F845_BCL2L1-      ttcccagaaaggatacagctggagtcagtttagtgt------------ca
                        ***********************************             **

A0A4W2D608_BCL2L1-      gaactgagaccccagaagggagagagtcagatatggaaaccc--------
A0A4W2F845_BCL2L1-      gatatggaaacccccagtgga-----tcag---tggcaacccatcctggc
                        **  **  * ***  *  ***     ****   *** *****        

A0A4W2D608_BCL2L1-      ------ccaatagccccacagtgaatggagccactggccacagcagaagc
A0A4W2F845_BCL2L1-      acctggcagatagccccacagtgaatggagccactggccacagcagaagc
                              *  *****************************************

A0A4W2D608_BCL2L1-      ttggatgcccggaaaatgatccccatgacaacagtaaagcaagccctgag
A0A4W2F845_BCL2L1-      ttggatgcccggaaaatgatccccatgacaacagtaaagcaagccctgag
                        **************************************************

A0A4W2D608_BCL2L1-      ggaggcaagcaatgagtttaaactttggtaccaacagacattcagcgacc
A0A4W2F845_BCL2L1-      ggaggcaagcaatgagtttaaactgaggtaccaacagacattcagcgacc
                        ************************  ************************

A0A4W2D608_BCL2L1-      tgacgtcccagctccgcatcaccccagggacagcatgtcagagctttgaa
A0A4W2F845_BCL2L1-      tgatgtcccagctccgcatcaccccagggacagcatgtcagagctttgaa
                        *** **********************************************

A0A4W2D608_BCL2L1-      caggtaataaatgaactcttccgggacagggtgaagtggggtcacgttgt
A0A4W2F845_BCL2L1-      caggtaataaatgaactcttccgggacagggtgaagtggggtcacgttgt
                        **************************************************

A0A4W2D608_BCL2L1-      ggcctttttctccttcagtgggacaatatgcatgaaaagcatagacaagg
A0A4W2F845_BCL2L1-      ggcctttttctccttcagtgggacactatgcatgaaaagcatagacaagg
                        ************************* ************************

A0A4W2D608_BCL2L1-      agatacacgtattggtgagtcaggtcacaacttcaatggccacttaccta
A0A4W2F845_BCL2L1-      agatacacgtattggtgagtcaggtcacaacttcaacggccacttaccta
                        ************************************ *************

A0A4W2D608_BCL2L1-      aataaccacctcaagccttggatccaagagaacggcgggtgggacacttt
A0A4W2F845_BCL2L1-      aataaccacctcaagccttggatccaagagaacggcgggtgggacacttt
                        **************************************************

A0A4W2D608_BCL2L1-      tgtggaactctacgaaagcaatacaacaaacgagagccagaagggccagg
A0A4W2F845_BCL2L1-      tgtggaactctacgaaagcaatacaacaaacgagagccagaagggccaag
                        ************************************************ *

A0A4W2D608_BCL2L1-      agcgcttcaactccatttacactactgctgctgtcgcaggcctcgcaaac
A0A4W2F845_BCL2L1-      agtgtttcaactccatttacactactgctgctgtcgcaggcctcacaaac
                        ** * *************************************** *****

A0A4W2D608_BCL2L1-      ctcatttcaaacacaaaactttattcaaaattagaccaaagatgcccata
A0A4W2F845_BCL2L1-      ctcatttcaaacacaaaactttattcaaaattagaccaaagatgcccata
                        **************************************************

A0A4W2D608_BCL2L1-      ctatgtgggccactcaggctcagatagatga
A0A4W2F845_BCL2L1-      ctatgtgggccactcaggctcagatagatga
                        *******************************

© 1998-2023Legal notice