Dataset for CDS BCL-2-like of organism Anser cygnoid

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B9E009_BCL2A1-      atgg----------------------------------------------
A0A8B9EU67_MCL1-01      gctcttcggtcccgccg---------------------------------
A0A8B9DB39_BCL2L1-      atg------tccggcag------------caaccgggacctggtgattga
A0A8B9E2U6_BCL2-01      atggctcatcccgggagaagaggctacgataaccgggagatagtgctgaa
                                                                          

A0A8B9E009_BCL2A1-      -------------aaactgct------gagttctattacgtttattattt
A0A8B9EU67_MCL1-01      -----ccccccgctcgccgccgttgtggagcccc----------------
A0A8B9DB39_BCL2L1-      ctttgtttcctacaagctgtcgcagaagggctacagctgga--gccagct
A0A8B9E2U6_BCL2-01      gtacatccactataaactctcgcagaggggatacgactgggctgccggcg
                                        *          * *                    

A0A8B9E009_BCL2A1-      agctcaagatta--------------------------tctgcag-----
A0A8B9EU67_MCL1-01      -gaggaggagctggacg---------------------gttgc-gaaccc
A0A8B9DB39_BCL2L1-      ggaggaggaggaggatgagaacaggactgacttc----gcggcggaggcc
A0A8B9E2U6_BCL2-01      aggacagggcgcccgcgcctacggctctcgctcctgctgctgctgcggtt
                         *   * *                                 ** *     

A0A8B9E009_BCL2A1-      ---------------------------------tatgtgcttcaggaatc
A0A8B9EU67_MCL1-01      gaaaccgagaggggaccc---------------gggggg-----gactcg
A0A8B9DB39_BCL2L1-      gacacggacggggtgctc---------------aacgggagcccgtcctg
A0A8B9E2U6_BCL2-01      gctgctgctgggactccctcccgccaccgccctgccgggctgctgtcccc
                                                            * *     *     

A0A8B9E009_BCL2A1-      acatctcggaccagcc--------------------------------ca
A0A8B9EU67_MCL1-01      atgcccgggacccccc----------------------------------
A0A8B9DB39_BCL2L1-      gcaccc---gcccgccagccagg-------tagtgaacggcgccgccgtg
A0A8B9E2U6_BCL2-01      gcaccccgagccccccggctcggctgctgctagcga--ggcgcccccggg
                            *     **  **                                  

A0A8B9E009_BCL2A1-      aaccagagttgctcat-gtcttgcgaaacatt--------gcatctt---
A0A8B9EU67_MCL1-01      ---cggagctgcccg----ccgacgaaaagcgctgg--------------
A0A8B9DB39_BCL2L1-      caccggagcagcctggaggtccacgaaatcgttcggtcggccgccgtgag
A0A8B9E2U6_BCL2-01      cg-aggggctgc-----gccccgcg----ccccccgtggtccacctt---
                             * *  **           **                         

A0A8B9E009_BCL2A1-      -----cgctgcaagatcaaacagagga-----------------------
A0A8B9EU67_MCL1-01      --aaacgctgcgga---gggtcggggacggagtcctggagaaacacgagc
A0A8B9DB39_BCL2L1-      gcaggcgctgcgag---aagccggggacgagttcgagctgcggtaccgcc
A0A8B9E2U6_BCL2-01      ----gccctgcgcc---aggccggggacgagttctcccgccgctaccagc
                             * ****           * ***                       

A0A8B9E009_BCL2A1-      -ggctctcagacccttcctggacaggattgatattacttctgtagatg-t
A0A8B9EU67_MCL1-01      tggccttccaaggaatgcttcgcaagctagaaatcaag---aaggaggaa
A0A8B9DB39_BCL2L1-      gggccttcagcgacctcacctcccagctccacatcacccccggcacggcg
A0A8B9E2U6_BCL2-01      gggacttcgcccagatgtccggccagctgcacctgacgcctttcacgg--
                         **   **       *      *  * *  *  * *           *  

A0A8B9E009_BCL2A1-      tgccaagagaattttcaatggtgtcatggatgagaaatttgctgatggaa
A0A8B9EU67_MCL1-01      gacctgcagtcggtgggcg-aggtggcagcccacgtcttcagcgacggag
A0A8B9DB39_BCL2L1-      taccaga----gcttcgagcaggtggtgaacgaactcttccgcgacggag
A0A8B9E2U6_BCL2-01      --ccagaggccgcttcgtggccgtggtggaggagctcttccgagacgggg
                          **         *        **        *    **    ** **  

A0A8B9E009_BCL2A1-      atactaattggggaagaattatgaccatatttacttttgggggtcttctc
A0A8B9EU67_MCL1-01      tgacgaactgggggcgagtcgtcacgctcatctccttcggtgcctttgtc
A0A8B9DB39_BCL2L1-      t---gaactgggggcgcgtcgtggctttcttctccttcgg------aggg
A0A8B9E2U6_BCL2-01      t---gaactggggccggatcgtggccttcttcgagttcgg------cggc
                             ** *****  *  *  *  *  *  *    ** **          

A0A8B9E009_BCL2A1-      actaagaagcttcaagaacatggagttcagctcactggagagga------
A0A8B9EU67_MCL1-01      gccaag-cacctgaagagcataaag---------caggagaagt------
A0A8B9DB39_BCL2L1-      gcgctg-tgcgtggagagcgtcgac---------aaggagatgcgggtac
A0A8B9E2U6_BCL2-01      gtgatg-tgcgtcgagagcgtcaac---------cgggagatgtctcccc
                             *   * *  *** * *  *            ***** *       

A0A8B9E009_BCL2A1-      -gaaggagcagatctcttatttc------attacagagtacatcataaa-
A0A8B9EU67_MCL1-01      ---------gcatcggctccttggccaggatcatcacggacgcgctcgtc
A0A8B9DB39_BCL2L1-      tggtggggcgcatcg------tggcgtggatgaccacgtacttgaccgac
A0A8B9E2U6_BCL2-01      tggtggacagcatcg------ccgcctggatgaccgagtacctgaaccgg
                                   ***               ** *    * **         

A0A8B9E009_BCL2A1-      -caacaaagc-cgaatggatagatgcaaatggtggctgggaaaa------
A0A8B9EU67_MCL1-01      tcgtccaagcgcgagtggctgctgagccagggaggctgggaggg------
A0A8B9DB39_BCL2L1-      -catct--agacccctggatccaggagaacggcggatgggagcg------
A0A8B9E2U6_BCL2-01      -cacct--gcacaactggatccaggacaacggaggctgggtacgtgccct
                         *  *      *   *** *        * ** ** ****          

A0A8B9E009_BCL2A1-      ---------tggcttcctaaca----------------------------
A0A8B9EU67_MCL1-01      ---ctttgtcgacttcttccga----------------------------
A0A8B9DB39_BCL2L1-      --------------------------------------------------
A0A8B9E2U6_BCL2-01      gcgctttgctttcctcctccgatggcccacggctttgggggctctggggt
                                                                          

A0A8B9E009_BCL2A1-      ---------------------------------aagtttgaaagaagatc
A0A8B9EU67_MCL1-01      ----gtggaag----------------------acctagaaggcagcatc
A0A8B9DB39_BCL2L1-      gtttgtgg-------------------------acctctacgggaacgac
A0A8B9E2U6_BCL2-01      gtctctggggctcacgggtgcccacgtgtgctcacctcagtgtgagcgtc
                                                         *  *       *    *

A0A8B9E009_BCL2A1-      a---------------ctactgt---------------------------
A0A8B9EU67_MCL1-01      agga----------------------------------------------
A0A8B9DB39_BCL2L1-      g---------------ctgctgcgg-------------------------
A0A8B9E2U6_BCL2-01      gggacgcgaggtttgcctgctgcgtcttttgtaccggtgtgggccttctg
                                                                          

A0A8B9E009_BCL2A1-      --------------------------------------------------
A0A8B9EU67_MCL1-01      --------------------------------------------------
A0A8B9DB39_BCL2L1-      --------------------------------------------------
A0A8B9E2U6_BCL2-01      ccggctcctctgctgtcgggtgtcacctgatggtggggctgcagtgaaat
                                                                          

A0A8B9E009_BCL2A1-      --------------------------------------------------
A0A8B9EU67_MCL1-01      ----------------------------------------------acgt
A0A8B9DB39_BCL2L1-      ----------------------------------------------aggt
A0A8B9E2U6_BCL2-01      ggtgttgtttttttttgtggaggggggcagctgcagctccctcgtcaggt
                                                                          

A0A8B9E009_BCL2A1-      --------------------------------------------------
A0A8B9EU67_MCL1-01      gctgatgg------------------------------------------
A0A8B9DB39_BCL2L1-      gaggaagggcca--------------------ggag--------------
A0A8B9E2U6_BCL2-01      gccgaaaggccaagcaaggtgtcctttccatcggagagctctgctttccc
                                                                          

A0A8B9E009_BCL2A1-      ----ctttctccaaa-----------------------------------
A0A8B9EU67_MCL1-01      ----cgttcgc---------------------------------------
A0A8B9DB39_BCL2L1-      ---accttcaacaaatggc--------tcctgaccggggc----------
A0A8B9E2U6_BCL2-01      atcaccttcgcccactggtggcatcagccctggccaaggcttgttccagc
                            * ***                                         

A0A8B9E009_BCL2A1-      --------------------------------------------attaca
A0A8B9EU67_MCL1-01      ----------------------------------------gggggtggca
A0A8B9DB39_BCL2L1-      ----------------------------------------gacggtggcc
A0A8B9E2U6_BCL2-01      gcagcatgggaaggggttgcagaggctggggatgggcacagggggtggca
                                                                     *  * 

A0A8B9E009_BCL2A1-      ga----------------catattcgtagctctt-------------ttt
A0A8B9EU67_MCL1-01      ggactggg----agcgagcttgg-------cctaca-----------tga
A0A8B9DB39_BCL2L1-      gg----------agtgctcctgctgggatccctgc------------tga
A0A8B9E2U6_BCL2-01      ggtcctggatgtggggaccatgtggacatccctgcatgttggggtggtgc
                        *                 * *          **              *  

A0A8B9E009_BCL2A1-      tccttgttcagagagtac----------tactga
A0A8B9EU67_MCL1-01      tcc----------ggtga----------------
A0A8B9DB39_BCL2L1-      gcc-------gcaagtga----------------
A0A8B9E2U6_BCL2-01      accgggcacggcgagtgtggggacatggtgctag
                         **           **                  

© 1998-2022Legal notice