Dataset for CDS BAX of Organism Bos indicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4W2H091_BAX-01      ----atgagacc------ccattctgattctgtatccccg-caactccg-
A0A4W2CIX3_BAX-01      atggacgggtccggggagcaacccagaggcggggggcccaccagctctga
A0A4W2H091_BAX-02      atggacgggtccggggagcaacccagaggcggggggcccaccagctctga
A0A4W2CIX3_BAX-02      atggacgggtccggggagcaacccagaggcggggggcccaccagctctga
                           * * * **      * *  * **  * *    ***  ** *** * 

A0A4W2H091_BAX-01      ------------------------ttcccaccctagtttcatccaggatc
A0A4W2CIX3_BAX-01      gcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatc
A0A4W2H091_BAX-02      gcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatc
A0A4W2CIX3_BAX-02      gcagatcatgaagacaggggcccttttgcttcagg---------------
                                               **  *  *                  

A0A4W2H091_BAX-01      gagcagggcgaatggggggagagacacccgagctgggcttggagcaggtg
A0A4W2CIX3_BAX-01      gagcagggcgaatggggggagagacacccgagctgggcttggagcaggtg
A0A4W2H091_BAX-02      gagcagggcgaatggggggagagacacccgagctgggcttggagcaggtg
A0A4W2CIX3_BAX-02      --------------------------------------------------
                                                                         

A0A4W2H091_BAX-01      ccccaggatgcatccaccaagaagctgagcgagtgtctgaagcgcatcgg
A0A4W2CIX3_BAX-01      ccccaggatgcatccaccaagaagctgagcgagtgtctgaagcgcatcgg
A0A4W2H091_BAX-02      ccccaggatgcatccaccaagaagctgagcgagtgtctgaagcgcatcgg
A0A4W2CIX3_BAX-02      --------------------------------------------------
                                                                         

A0A4W2H091_BAX-01      agatgaattggacagtaacatggagctgcagaggatgatcgcagctgtgg
A0A4W2CIX3_BAX-01      agatgaattggacagtaacatggagctgcagaggatgatcgcagctgtgg
A0A4W2H091_BAX-02      agatgaattggacagtaacatggagctgcagaggatgatcgcagctgtgg
A0A4W2CIX3_BAX-02      --------------------------------ggatgatcgcagctgtgg
                                                       ******************

A0A4W2H091_BAX-01      acacagactctccccgagaggtctttttccgagtggcggctgaaatgttt
A0A4W2CIX3_BAX-01      acacagactctccccgagaggtctttttccgagtggcggctgaaatgttt
A0A4W2H091_BAX-02      acacagactctccccgagaggtctttttccgagtggcggctgaaatgttt
A0A4W2CIX3_BAX-02      acacagactctccccgagaggtctttttccgagtggcggctgaaatgttt
                       **************************************************

A0A4W2H091_BAX-01      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgc
A0A4W2CIX3_BAX-01      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgc
A0A4W2H091_BAX-02      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgc
A0A4W2CIX3_BAX-02      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgc
                       **************************************************

A0A4W2H091_BAX-01      cagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagttgatca
A0A4W2CIX3_BAX-01      cagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagttgatca
A0A4W2H091_BAX-02      cagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagttgatca
A0A4W2CIX3_BAX-02      cagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagttgatca
                       **************************************************

A0A4W2H091_BAX-01      ggaccatcatgggctggacattggacttccttcgagagcggctgctgggc
A0A4W2CIX3_BAX-01      ggaccatcatgggctggacattggacttccttcgagagcggctgctgggc
A0A4W2H091_BAX-02      ggaccatcatgggctggacattggacttccttcgagagcggctgctgggc
A0A4W2CIX3_BAX-02      ggaccatcatgggctggacattggacttccttcgagagcggctgctgggc
                       **************************************************

A0A4W2H091_BAX-01      tggatccaggaccagggtggttgggacggcctcctctcctactttgggac
A0A4W2CIX3_BAX-01      tggatccaggaccagggtggttgggacggcctcctctcctactttgggac
A0A4W2H091_BAX-02      tggatccaggaccagggtggttgggacggcctcctctcctactttgggac
A0A4W2CIX3_BAX-02      tggatccaggaccagggtggttgggacggcctcctctcctactttgggac
                       **************************************************

A0A4W2H091_BAX-01      acccacatggcagacagtgaccatctttgtggctggagtgctcaccgcct
A0A4W2CIX3_BAX-01      acccacatggcagacagtgaccatctttgtggctggagtgctcaccgcct
A0A4W2H091_BAX-02      acccacatggcagacagtgaccatctttgtggctggagtgctcaccgcct
A0A4W2CIX3_BAX-02      acccacatggcagacagtgaccatctttgtggctggagtgctcaccgcct
                       **************************************************

A0A4W2H091_BAX-01      cgctcaccatctggaagaagatgggctga
A0A4W2CIX3_BAX-01      cgctcaccatctggaagaagatgggctga
A0A4W2H091_BAX-02      cgctcaccatctggaagaagatgggctga
A0A4W2CIX3_BAX-02      cgctcaccatctggaagaagatgggctga
                       *****************************

© 1998-2023Legal notice