Dataset for CDS PMAIP1 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

73 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
A0A4W4H0G9_PMAIP1-      --------------------------------------------------
A0A452J430_PMAIP1-      --------------------------------------------------
A0A674JUE0_PMAIP1-      --------------------------------------------------
A0A5F8ATY0_PMAIP1-      --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A7M4FB17_PMAIP1-      --------------------------------------------------
A0A670IXL8_PMAIP1-      --------------------------------------------------
A0A674HDV6_PMAIP1-      --------------------------------------------------
A0A663N909_PMAIP1-      --------------------------------------------------
A0A663FH84_PMAIP1-      --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A803YIP1_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
A0A669QIC6_PMAIP1-      --------------------------------------------------
A0A803TSK5_PMAIP1-      --------------------------------------------------
A0A5F9C629_PMAIP1-      --------------------------------------------------
A0A670ZS96_PMAIP1-      --------------------------------------------------
Q9JM54_PMAIP1-03        --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q9JM54_PMAIP1-02        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        atgcgttcttccggatcgcttggctctaggattcgggggctgttggaatc
A0A4X1TQ35_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A671EYM5_PMAIP1-      --------------------------------------------------
A0A2Y9P485_PMAIP1-      --------------------------------------------------
A0A2Y9TJ73_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A452EST2_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A673UI19_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A667HYB7_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A452TE71_PMAIP1-      --------------------------------------------------
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
A0A452STA4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
                                                                          

A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
A0A4W4H0G9_PMAIP1-      --------------------------------------------------
A0A452J430_PMAIP1-      --------------------------------------------------
A0A674JUE0_PMAIP1-      --------------------------------------------------
A0A5F8ATY0_PMAIP1-      --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A7M4FB17_PMAIP1-      --------------------------------------------------
A0A670IXL8_PMAIP1-      --------------------------------------------------
A0A674HDV6_PMAIP1-      --------------------------------------------------
A0A663N909_PMAIP1-      --------------------------------------------------
A0A663FH84_PMAIP1-      --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A803YIP1_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
A0A669QIC6_PMAIP1-      --------------------------------------------------
A0A803TSK5_PMAIP1-      --------------------------------------------------
A0A5F9C629_PMAIP1-      --------------------------------------------------
A0A670ZS96_PMAIP1-      --------------------------------------------------
Q9JM54_PMAIP1-03        --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q9JM54_PMAIP1-02        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        ggcaggatgggaggaattggtaagaagccagccccgggcacatcaaggtc
A0A4X1TQ35_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A671EYM5_PMAIP1-      --------------------------------------------------
A0A2Y9P485_PMAIP1-      --------------------------------------------------
A0A2Y9TJ73_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A452EST2_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A673UI19_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A667HYB7_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A452TE71_PMAIP1-      --------------------------------------------------
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
A0A452STA4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
                                                                          

A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
A0A4W4H0G9_PMAIP1-      --------------------------------------------------
A0A452J430_PMAIP1-      --------------------------------------------------
A0A674JUE0_PMAIP1-      --------------------------------------------------
A0A5F8ATY0_PMAIP1-      --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A7M4FB17_PMAIP1-      --------------------------------------------------
A0A670IXL8_PMAIP1-      --------------------------------------------------
A0A674HDV6_PMAIP1-      --------------------------------------------------
A0A663N909_PMAIP1-      --------------------------------------------------
A0A663FH84_PMAIP1-      --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A803YIP1_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
A0A669QIC6_PMAIP1-      --------------------------------------------------
A0A803TSK5_PMAIP1-      --------------------------------------------------
A0A5F9C629_PMAIP1-      --------------------------------------------------
A0A670ZS96_PMAIP1-      --------------------------------------------------
Q9JM54_PMAIP1-03        --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q9JM54_PMAIP1-02        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        tcaccagtggccggtgtgggcagacgaggcgggaggagcttcgtggttcc
A0A4X1TQ35_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        -------------------gcgcgggcagcggcgggagc-----------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A671EYM5_PMAIP1-      --------------------------------------------------
A0A2Y9P485_PMAIP1-      --------------------------------------------------
A0A2Y9TJ73_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A452EST2_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A673UI19_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A667HYB7_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A452TE71_PMAIP1-      --------------------------------------------------
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
A0A452STA4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
                                                                          

A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
A0A4W4H0G9_PMAIP1-      --------------------------------------------------
A0A452J430_PMAIP1-      --------------------------------------------------
A0A674JUE0_PMAIP1-      --------------------------------------------------
A0A5F8ATY0_PMAIP1-      --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A7M4FB17_PMAIP1-      --------------------------------------------------
A0A670IXL8_PMAIP1-      --------------------------------------------------
A0A674HDV6_PMAIP1-      --------------------------------------------------
A0A663N909_PMAIP1-      --------------------------------------------------
A0A663FH84_PMAIP1-      --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A803YIP1_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
A0A669QIC6_PMAIP1-      --------------------------------------------------
A0A803TSK5_PMAIP1-      --------------------------------------------------
A0A5F9C629_PMAIP1-      --------------------------------------------------
A0A670ZS96_PMAIP1-      --------------------------------------------------
Q9JM54_PMAIP1-03        --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q9JM54_PMAIP1-02        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        ttcggtccgcctcccgctgccgtccgaggaaaccaaccaacctcagaggc
A0A4X1TQ35_PMAIP1-      ---------------------------------------acctcagaggc
F1SMU1_PMAIP1-01        -----------------------------------gccaacctcagaggc
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A671EYM5_PMAIP1-      ---------------gtgggctcttgcttctccccagaacccgaggttct
A0A2Y9P485_PMAIP1-      --------------------------------------------------
A0A2Y9TJ73_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A452EST2_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A673UI19_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A667HYB7_PMAIP1-      ---gaggagagcgcgggagccggccggcgatcagacctgagaggtgcgcg
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A452TE71_PMAIP1-      --------------------------------------------------
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
A0A452STA4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
                                                                          

A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
A0A4W4H0G9_PMAIP1-      --------------------------------------------------
A0A452J430_PMAIP1-      --------------------------------------------------
A0A674JUE0_PMAIP1-      --------------------------------------------------
A0A5F8ATY0_PMAIP1-      --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A7M4FB17_PMAIP1-      --------------------------------------------------
A0A670IXL8_PMAIP1-      --------------------------------------------------
A0A674HDV6_PMAIP1-      --------------------------------------------------
A0A663N909_PMAIP1-      --------------------------------------------------
A0A663FH84_PMAIP1-      --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A803YIP1_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
A0A669QIC6_PMAIP1-      --------------------------------------------------
A0A803TSK5_PMAIP1-      --------------------------------------------------
A0A5F9C629_PMAIP1-      --------------------------------------------------
A0A670ZS96_PMAIP1-      --------------------------------------------------
Q9JM54_PMAIP1-03        --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q9JM54_PMAIP1-02        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      ----------------atgcctggaaaggtgtgtaagagcgcgcagccga
G1P8F9_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        ttttgggcgttcagggtgttgcttttctagctctctcccgcttgctcgct
A0A4X1TQ35_PMAIP1-      ttttgggcgttcagggtgttgcttttctagctctctcccgcttgctcgct
F1SMU1_PMAIP1-01        ttttgggcgttcagggtgttgcttttctagctctctcccgcttgctcgct
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A671EYM5_PMAIP1-      cggctacccactgagtgccgtctccagccggctcccatcaggtccagccc
A0A2Y9P485_PMAIP1-      --------------------------------------------------
A0A2Y9TJ73_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A452EST2_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A673UI19_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A667HYB7_PMAIP1-      cgcgagcctgtcgtcgctggtagagttgggtcccgccgccccggtccggc
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A452TE71_PMAIP1-      --------------------------------------------------
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
A0A452STA4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
                                                                          

A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
A0A4W4H0G9_PMAIP1-      --------------------------------------------------
A0A452J430_PMAIP1-      --------------------------------------------------
A0A674JUE0_PMAIP1-      --------------------------------------------------
A0A5F8ATY0_PMAIP1-      --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A7M4FB17_PMAIP1-      --------------------------------------------------
A0A670IXL8_PMAIP1-      --------------------------------------------------
A0A674HDV6_PMAIP1-      --------------------------------------------------
A0A663N909_PMAIP1-      --------------------------------------------------
A0A663FH84_PMAIP1-      --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A803YIP1_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
A0A669QIC6_PMAIP1-      --------------------------------------------------
A0A803TSK5_PMAIP1-      --------------------------------------------------
A0A5F9C629_PMAIP1-      --------------------------------------------------
A0A670ZS96_PMAIP1-      --------------------------------------------------
Q9JM54_PMAIP1-03        --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q9JM54_PMAIP1-02        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      actccacgcgggcagagctagaagttgagtgtgctgcccagctcaggaga
G1P8F9_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        tctgcccgaccgccccgcgcgcagcctgctacctgcagagccaaggtgct
A0A4X1TQ35_PMAIP1-      tctgcccgaccgccccgcgcgcagcctgctacctgcagagccaaggtgct
F1SMU1_PMAIP1-01        tctgcccgaccgccccgcgcgcagcctgctacctgcagagccaaggtgct
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A671EYM5_PMAIP1-      gcccgcctggcgcgcagctcgcgtcctgtagaccccagggtgcaacccaa
A0A2Y9P485_PMAIP1-      --------------------------------------------------
A0A2Y9TJ73_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A452EST2_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A673UI19_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A667HYB7_PMAIP1-      ccgtccccccccgcgcgtgcagctcgcgtgccgccgccccgaggtgttcg
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A452TE71_PMAIP1-      --------------------------------------------------
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
A0A452STA4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
                                                                          

A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
A0A4W4H0G9_PMAIP1-      --------------------------------------------------
A0A452J430_PMAIP1-      --------------------------------------------------
A0A674JUE0_PMAIP1-      --------------------------------------------------
A0A5F8ATY0_PMAIP1-      --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A7M4FB17_PMAIP1-      --------------------------------------------------
A0A670IXL8_PMAIP1-      --------------------------------------------------
A0A674HDV6_PMAIP1-      --------------------------------------------------
A0A663N909_PMAIP1-      --------------------------------------------------
A0A663FH84_PMAIP1-      --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A803YIP1_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
A0A669QIC6_PMAIP1-      --------------------------------------------------
A0A803TSK5_PMAIP1-      --------------------------------------------------
A0A5F9C629_PMAIP1-      --------------------------------------------------
A0A670ZS96_PMAIP1-      --------------------------------------------------
Q9JM54_PMAIP1-03        --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q9JM54_PMAIP1-02        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      gttggagacacactgaattccctgggttgcaccacggaggccttggaggt
G1P8F9_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        cgggtccggggactgagttctcggagttttgcggcaaagttccggctgct
A0A4X1TQ35_PMAIP1-      cgggtccggggactgagttctcggagttttgcggcaaagttccggctgct
F1SMU1_PMAIP1-01        cgggtccggggactgagttctcggagttttgcggcaaagttccggctgct
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A671EYM5_PMAIP1-      ggttgggggactgagttccccggaggtctgcaacagacttcccgccggct
A0A2Y9P485_PMAIP1-      --------------------------------------------------
A0A2Y9TJ73_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A452EST2_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A673UI19_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A667HYB7_PMAIP1-      gggtgggggaccgagaaccccgggctcctgcggcacggtggccggcggcc
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A452TE71_PMAIP1-      --------------------------------------------------
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
A0A452STA4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
                                                                          

A0A0P0HZF9_PMAIP1-      ----------atggcgaagaaagaga------------------------
Q0GKC8_PMAIP1-01        ----------atggcgaagaaagagc------------------------
A0A4W4H0G9_PMAIP1-      --------aaacaagcag-gaactagtcccgtgacaccatg--------t
A0A452J430_PMAIP1-      ----------atgccggg-aaagaccctgcgcaagggtgcg---------
A0A674JUE0_PMAIP1-      ----------gtcc------gaggcaccaaattcggatctc---------
A0A5F8ATY0_PMAIP1-      ----------atgcccagcaaaaatgagaaaaccaacctccagcctcagc
A0A3B5RFA9_PMAIP1-      ----------cttcctgc---------------------cg---------
A0A7M4FB17_PMAIP1-      -----caaagcggccgagacagcgacacgagcgccagcccc-----gcgc
A0A670IXL8_PMAIP1-      ----------atgccctcccagcgccttgaactacaactcc---------
A0A674HDV6_PMAIP1-      ----------atgcctgg-ccggaccctgcgcaaaaccgcg-----ccgc
A0A663N909_PMAIP1-      ----------ctgccgggccaccaccacaagcggcggtgcgggtggctga
A0A663FH84_PMAIP1-      ----------atgcctgg-caggaccctgcgcaaggccgcg-----ccgc
A0A493SWX7_PMAIP1-      ----------atgccgtg-caggaccctgcgcaaacctgca-----caac
A0A803YIP1_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      -------atgatgcccgg-caggacgattcgcaaacctgcg-----ccgc
A0A669QIC6_PMAIP1-      ----------atgcctgg-caggacgattcgcaaacccgcg-----ccgc
A0A803TSK5_PMAIP1-      ----------atgcctgg-tctagaaagtcataaat--------------
A0A5F9C629_PMAIP1-      ----------atgcccgg-gaagagggcgcgcaagagatct---------
A0A670ZS96_PMAIP1-      ----------aggggagg-aaaggagagacaaagaa--------------
Q9JM54_PMAIP1-03        ----------atgcctgg-ga-----------------------------
Q9JM54_PMAIP1-01        ----------atgcccgg-gagaaaggcgcgtcggaacgcg---------
Q9JM54_PMAIP1-02        ----------atgcccgg-gagaaaggcgcgtcggaacgcg---------
G3T0P7_PMAIP1-01        ----------atgccggg-gaagaaggcacgcaagagcgcg---------
A0A286XF37_PMAIP1-      gcttgcagagatggctgg-gaagaaggcgcggaagagctcg---------
G1P8F9_PMAIP1-01        ----------atgcccgg-gaagaaggcgcgtaagaacgcg---------
Q9GL49_PMAIP1-01        gtttgcggagatgcctgg-aaggaggtctcgtaggaacact---------
A0A4X1TQ35_PMAIP1-      gtttgcggagatgcctgg-aaggaggtctcgtaggaacact---------
F1SMU1_PMAIP1-01        gtttgcggagatgcctgg-aaggaggtctcgtaggaacact---------
A0A3Q2I0H2_PMAIP1-      ----------atgcctac-aaggaaggcgcgtaagtctggg---------
A0A671EYM5_PMAIP1-      gctcgcggagatgcctgg-aaagaaggcgcgtaagaacgcg---------
A0A2Y9P485_PMAIP1-      ----------atgcctgg-aaggagggttcgtaagagcgct---------
A0A2Y9TJ73_PMAIP1-      ----------atgcctgg-aaggagggctcgtaagagcgct---------
A0A4W2CDL0_PMAIP1-      ----------atgcctgg-aaggagggctcgtaagagcgcc---------
A0A3Q1NFP6_PMAIP1-      ----------atgcctgg-aaggagggctcgtaagagcgcc---------
A0A4W2CDL0_PMAIP1-      ----------atgcctgg-aaggagggctcgtaagagcgcc---------
A0A452EST2_PMAIP1-      ----------atgcctgg-aaggagggctcgtaggagcgcc---------
W5P738_PMAIP1-01        ----------atgcctgg-aaggagggctcgtaggagcgcc---------
A0A2K6EM90_PMAIP1-      ----------atgcccgt-gaagaaggcgcgtaagaacgcg---------
A0A673UI19_PMAIP1-      ----------atgcccgg-gaagaaggcgcgcaagagcgcg---------
A0A337SUX1_PMAIP1-      ----------atgcctgg-gaagaggacgcgtaagagcgcg---------
A0A667HYB7_PMAIP1-      gctggcggagatgcctgg-gaagaggacgcgtaagagcgcg---------
G1LIZ7_PMAIP1-01        -----atcggctccctgc-tcagtggg-------gagcctg---------
A0A452TE71_PMAIP1-      -----tggggctccctgc-tcagtggg-------gagcctg---------
A0A7N5JEA5_PMAIP1-      ----------atgcctgg-gaagaaagcgcgtaagagcgcg---------
A0A452STA4_PMAIP1-      ----------atgcctgg-gaagaaagcgcgtaagagcgcg---------
A0A2I3HX97_PMAIP1-      -----------agcctgg-ga--gaagcgcgcaggaacgct---------
A0A2K5QQC6_PMAIP1-      ----------atgcctgg-gaagaaggcgcgcaagagcgcg---------
A0A2K5CFK7_PMAIP1-      ----------atgcctgg-gaagaaggcgcgcaagagcgcg---------
A0A2K6S6C4_PMAIP1-      ----------atgcctgg-gaagaaggcgcgcaagagcgcg---------
A0A2K6KJF1_PMAIP1-      ----------atgcctgg-aaagaaggcgcgcaagaacgcg---------
A0A2K6NC45_PMAIP1-      ----------atgcctgg-aaagaaggcgcgcaagaacgcg---------
A0A2K6KJF1_PMAIP1-      ----------atgcctgg-aaagaaggcgcgcaagaacgcg---------
A0A2K6NC45_PMAIP1-      ----------atgcctgg-aaagaaggcgcgcaagaacgcg---------
A0A2K5JY17_PMAIP1-      ----------atgcctgg-gaagaaggcgcgcaagaacgcg---------
A0A2K5JY17_PMAIP1-      ----------atgcctgg-gaagaaggcgcgcaagaacgcg---------
A0A2K5NJZ2_PMAIP1-      ----------atgcctgg-gaagaaggcgcgcaagaacgcg---------
A0A2K5NJZ2_PMAIP1-      ----------atgcctgg-gaagaaggcgcgcaagaacgcg---------
A0A2K6BV43_PMAIP1-      ----------atgcctgg-gaagaaggcgcgcaagaacgcg---------
A0A2K5VPX2_PMAIP1-      ----------atgcctgg-gaagaaggcgcgcaagaacgcg---------
A0A2K6BV43_PMAIP1-      ----------atgcctgg-gaagaaggcgcgcaagaacgcg---------
A0A2K5ZWH1_PMAIP1-      ----------atgcctgg-gaagaaggcgcgcaagaacgcg---------
A0A0D9S003_PMAIP1-      ----------atgcctgg-gaagaaggcgcgcaagaacgcg---------
A0A2K5ZWH1_PMAIP1-      ----------atgcctgg-gaagaaggcgcgcaagaacgcg---------
A0A2I3HX97_PMAIP1-      ----------aagcctgg----gagagcgcgcaggaacgct---------
H2NWG2_PMAIP1-01        ----------atgcctgg-aaagaaggcgcgcaagaacgct---------
A0A2I3SX38_PMAIP1-      ----------atgcctgg-gaagaaggcgcgcaagaacgct---------
A0A2R9AKC9_PMAIP1-      ----------atgcctgg-gaagaaggcgcgcaagaacgct---------
Q13794_PMAIP1-02        ----------atgcctgg-gaagaaggcgcgcaagaacgct---------
A0A2I2YVQ5_PMAIP1-      ----------atgcctgg-gaagaaggcgcgcaagaacgct---------
Q13794_PMAIP1-01        ----------atgcctgg-gaagaaggcgcgcaagaacgct---------
A0A2R9AKC9_PMAIP1-      ----------atgcctgg-gaagaaggcgcgcaagaacgct---------
A0A2I3SX38_PMAIP1-      ----------atgcctgg-gaagaaggcgcgcaagaacgct---------
A0A2I2YVQ5_PMAIP1-      ----------atgcctgg-gaagaaggcgcgcaagaacgct---------
                                                                          

A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
A0A4W4H0G9_PMAIP1-      caattaatttcttggcttt-------------------------------
A0A452J430_PMAIP1-      cag-----------------------------------------------
A0A674JUE0_PMAIP1-      gat-----------------------------------------------
A0A5F8ATY0_PMAIP1-      cca-----------------------------------------------
A0A3B5RFA9_PMAIP1-      ctg-----------------------------------------------
A0A7M4FB17_PMAIP1-      cag-----------------------------------------------
A0A670IXL8_PMAIP1-      ca------------------------------------------------
A0A674HDV6_PMAIP1-      cag-----------------------------------------------
A0A663N909_PMAIP1-      cgg-----------------------------------------------
A0A663FH84_PMAIP1-      ccg-----------------------------------------------
A0A493SWX7_PMAIP1-      cc------------------------------------------------
A0A803YIP1_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      ccg-----------------------------------------------
A0A669QIC6_PMAIP1-      ccg-----------------------------------------------
A0A803TSK5_PMAIP1-      --------------------------------------------------
A0A5F9C629_PMAIP1-      caa-----------------------------------------------
A0A670ZS96_PMAIP1-      --------------------------------------------------
Q9JM54_PMAIP1-03        --------------------------------------------------
Q9JM54_PMAIP1-01        ccagtgaacccaacgcgggcagagctaccacctgagttcgcagctcaact
Q9JM54_PMAIP1-02        ccagtgaacccaacgcgg--------------------------------
G3T0P7_PMAIP1-01        cag-----------------------------------------------
A0A286XF37_PMAIP1-      gag-----------------------------------------------
G1P8F9_PMAIP1-01        cag-----------------------------------------------
Q9GL49_PMAIP1-01        cag-----------------------------------------------
A0A4X1TQ35_PMAIP1-      cag-----------------------------------------------
F1SMU1_PMAIP1-01        cag-----------------------------------------------
A0A3Q2I0H2_PMAIP1-      cag-----------------------------------------------
A0A671EYM5_PMAIP1-      cag-----------------------------------------------
A0A2Y9P485_PMAIP1-      cag-----------------------------------------------
A0A2Y9TJ73_PMAIP1-      cag-----------------------------------------------
A0A4W2CDL0_PMAIP1-      cag-----------------------------------------------
A0A3Q1NFP6_PMAIP1-      cag-----------------------------------------------
A0A4W2CDL0_PMAIP1-      cag-----------------------------------------------
A0A452EST2_PMAIP1-      cag-----------------------------------------------
W5P738_PMAIP1-01        cag-----------------------------------------------
A0A2K6EM90_PMAIP1-      caa-----------------------------------------------
A0A673UI19_PMAIP1-      cag-----------------------------------------------
A0A337SUX1_PMAIP1-      cag-----------------------------------------------
A0A667HYB7_PMAIP1-      cag-----------------------------------------------
G1LIZ7_PMAIP1-01        ctt-----------------------------------------------
A0A452TE71_PMAIP1-      ctt-----------------------------------------------
A0A7N5JEA5_PMAIP1-      cag-----------------------------------------------
A0A452STA4_PMAIP1-      cag-----------------------------------------------
A0A2I3HX97_PMAIP1-      caa-----------------------------------------------
A0A2K5QQC6_PMAIP1-      caa-----------------------------------------------
A0A2K5CFK7_PMAIP1-      caa-----------------------------------------------
A0A2K6S6C4_PMAIP1-      caa-----------------------------------------------
A0A2K6KJF1_PMAIP1-      caa-----------------------------------------------
A0A2K6NC45_PMAIP1-      caa-----------------------------------------------
A0A2K6KJF1_PMAIP1-      caa-----------------------------------------------
A0A2K6NC45_PMAIP1-      caa-----------------------------------------------
A0A2K5JY17_PMAIP1-      caa-----------------------------------------------
A0A2K5JY17_PMAIP1-      caa-----------------------------------------------
A0A2K5NJZ2_PMAIP1-      caa-----------------------------------------------
A0A2K5NJZ2_PMAIP1-      caa-----------------------------------------------
A0A2K6BV43_PMAIP1-      caa-----------------------------------------------
A0A2K5VPX2_PMAIP1-      caa-----------------------------------------------
A0A2K6BV43_PMAIP1-      caa-----------------------------------------------
A0A2K5ZWH1_PMAIP1-      caa-----------------------------------------------
A0A0D9S003_PMAIP1-      caa-----------------------------------------------
A0A2K5ZWH1_PMAIP1-      caa-----------------------------------------------
A0A2I3HX97_PMAIP1-      caa-----------------------------------------------
H2NWG2_PMAIP1-01        caa-----------------------------------------------
A0A2I3SX38_PMAIP1-      caa-----------------------------------------------
A0A2R9AKC9_PMAIP1-      caa-----------------------------------------------
Q13794_PMAIP1-02        caa-----------------------------------------------
A0A2I2YVQ5_PMAIP1-      caa-----------------------------------------------
Q13794_PMAIP1-01        caa-----------------------------------------------
A0A2R9AKC9_PMAIP1-      caa-----------------------------------------------
A0A2I3SX38_PMAIP1-      caa-----------------------------------------------
A0A2I2YVQ5_PMAIP1-      caa-----------------------------------------------
                                                                          

A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
A0A4W4H0G9_PMAIP1-      --------------------------------------------------
A0A452J430_PMAIP1-      --------------------------------------------------
A0A674JUE0_PMAIP1-      --------------------------------------------------
A0A5F8ATY0_PMAIP1-      --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A7M4FB17_PMAIP1-      --------------------------------------------------
A0A670IXL8_PMAIP1-      --------------------------------------------------
A0A674HDV6_PMAIP1-      --------------------------------------------------
A0A663N909_PMAIP1-      --------------------------------------------------
A0A663FH84_PMAIP1-      --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A803YIP1_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
A0A669QIC6_PMAIP1-      --------------------------------------------------
A0A803TSK5_PMAIP1-      --------------------------------------------------
A0A5F9C629_PMAIP1-      --------------------------------------------------
A0A670ZS96_PMAIP1-      --------------------------------------------------
Q9JM54_PMAIP1-03        --------------------------------------------------
Q9JM54_PMAIP1-01        caggaagatcggagacaaagtgtattgcacgtggagtgcaccggacataa
Q9JM54_PMAIP1-02        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A4X1TQ35_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A671EYM5_PMAIP1-      --------------------------------------------------
A0A2Y9P485_PMAIP1-      --------------------------------------------------
A0A2Y9TJ73_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A452EST2_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A673UI19_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A667HYB7_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A452TE71_PMAIP1-      --------------------------------------------------
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
A0A452STA4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
                                                                          

A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
A0A4W4H0G9_PMAIP1-      --------------------------------------------------
A0A452J430_PMAIP1-      --------------------------------------------------
A0A674JUE0_PMAIP1-      --------------------------------------------------
A0A5F8ATY0_PMAIP1-      --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A7M4FB17_PMAIP1-      --------------------------------------------------
A0A670IXL8_PMAIP1-      --------------------------------------------------
A0A674HDV6_PMAIP1-      --------------------------------------------------
A0A663N909_PMAIP1-      --------------------------------------------------
A0A663FH84_PMAIP1-      --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A803YIP1_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
A0A669QIC6_PMAIP1-      --------------------------------------------------
A0A803TSK5_PMAIP1-      --------------------------------------------------
A0A5F9C629_PMAIP1-      --------------------------------------------------
A0A670ZS96_PMAIP1-      --------------------------------------------------
Q9JM54_PMAIP1-03        ---------------------------agtcgcaaaagagcaggatgagg
Q9JM54_PMAIP1-01        ctgtggttctggcgcagatgcctgggaagtcgcaaaagagcaggatgagg
Q9JM54_PMAIP1-02        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A4X1TQ35_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A671EYM5_PMAIP1-      --------------------------------------------------
A0A2Y9P485_PMAIP1-      --------------------------------------------------
A0A2Y9TJ73_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A452EST2_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A673UI19_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A667HYB7_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A452TE71_PMAIP1-      --------------------------------------------------
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
A0A452STA4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
                                                                          

A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
A0A4W4H0G9_PMAIP1-      ---ccgacct----------------------------------------
A0A452J430_PMAIP1-      ---cagaacc----------------------------------------
A0A674JUE0_PMAIP1-      ---tcgaacc----------------------------------------
A0A5F8ATY0_PMAIP1-      ---ccaatca----------------------------------------
A0A3B5RFA9_PMAIP1-      ---ctgagct----------------------------------------
A0A7M4FB17_PMAIP1-      ---ccatgct----------------------------------------
A0A670IXL8_PMAIP1-      ---ccagccc----------------------------------------
A0A674HDV6_PMAIP1-      ---ccgctcc----------------------------------------
A0A663N909_PMAIP1-      ---ccgtgct----------------------------------------
A0A663FH84_PMAIP1-      ---ccgctcc----------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A803YIP1_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      ---ccgcgcc----------------------------------------
A0A669QIC6_PMAIP1-      ---ccgcgcctgcaggtagggaaaggcgaagggaggcgggtctcaatttt
A0A803TSK5_PMAIP1-      ---ctgagg-----------------------------------------
A0A5F9C629_PMAIP1-      ---tcgagtc----------------------------------------
A0A670ZS96_PMAIP1-      ---ctgcagc----------------------------------------
Q9JM54_PMAIP1-03        agcccaagcc----------------------------------------
Q9JM54_PMAIP1-01        agcccaagcc----------------------------------------
Q9JM54_PMAIP1-02        --------------------------------------------------
G3T0P7_PMAIP1-01        ---cccggcc----------------------------------------
A0A286XF37_PMAIP1-      ---ccggatc----------------------------------------
G1P8F9_PMAIP1-01        ---cctagcc----------------------------------------
Q9GL49_PMAIP1-01        ---acgaacc----------------------------------------
A0A4X1TQ35_PMAIP1-      ---acgaacc----------------------------------------
F1SMU1_PMAIP1-01        ---acgaacc----------------------------------------
A0A3Q2I0H2_PMAIP1-      ---ccgagcc----------------------------------------
A0A671EYM5_PMAIP1-      ---ccgagcc----------------------------------------
A0A2Y9P485_PMAIP1-      ---cagagcc----------------------------------------
A0A2Y9TJ73_PMAIP1-      ---cagagcc----------------------------------------
A0A4W2CDL0_PMAIP1-      ---ccgagcc----------------------------------------
A0A3Q1NFP6_PMAIP1-      ---ccgagcc----------------------------------------
A0A4W2CDL0_PMAIP1-      ---ccgagcc----------------------------------------
A0A452EST2_PMAIP1-      ---ccgagcc----------------------------------------
W5P738_PMAIP1-01        ---ccgagcc----------------------------------------
A0A2K6EM90_PMAIP1-      ---ccgagcc----------------------------------------
A0A673UI19_PMAIP1-      ---ccaagcc----------------------------------------
A0A337SUX1_PMAIP1-      ---ccgagcc----------------------------------------
A0A667HYB7_PMAIP1-      ---ccgagcc----------------------------------------
G1LIZ7_PMAIP1-01        ---c----tc----------------------------------------
A0A452TE71_PMAIP1-      ---c----tc----------------------------------------
A0A7N5JEA5_PMAIP1-      ---gcgagtc----------------------------------------
A0A452STA4_PMAIP1-      ---gcgagcc----------------------------------------
A0A2I3HX97_PMAIP1-      ---ccgagcc----------------------------------------
A0A2K5QQC6_PMAIP1-      ---ccgagcc----------------------------------------
A0A2K5CFK7_PMAIP1-      ---ccgagcc----------------------------------------
A0A2K6S6C4_PMAIP1-      ---ccgagcc----------------------------------------
A0A2K6KJF1_PMAIP1-      ---ccgagcc----------------------------------------
A0A2K6NC45_PMAIP1-      ---ccgagcc----------------------------------------
A0A2K6KJF1_PMAIP1-      ---ccgagcc----------------------------------------
A0A2K6NC45_PMAIP1-      ---ccgagcc----------------------------------------
A0A2K5JY17_PMAIP1-      ---ccgagcc----------------------------------------
A0A2K5JY17_PMAIP1-      ---ccgagcc----------------------------------------
A0A2K5NJZ2_PMAIP1-      ---ccgagcc----------------------------------------
A0A2K5NJZ2_PMAIP1-      ---ccgagcc----------------------------------------
A0A2K6BV43_PMAIP1-      ---ccgagcc----------------------------------------
A0A2K5VPX2_PMAIP1-      ---ccgagcc----------------------------------------
A0A2K6BV43_PMAIP1-      ---ccgagcc----------------------------------------
A0A2K5ZWH1_PMAIP1-      ---ccgagcc----------------------------------------
A0A0D9S003_PMAIP1-      ---ccgagcc----------------------------------------
A0A2K5ZWH1_PMAIP1-      ---ccgagcc----------------------------------------
A0A2I3HX97_PMAIP1-      ---ccgagcc----------------------------------------
H2NWG2_PMAIP1-01        ---ccgagcc----------------------------------------
A0A2I3SX38_PMAIP1-      ---ccgagcc----------------------------------------
A0A2R9AKC9_PMAIP1-      ---ccgagcc----------------------------------------
Q13794_PMAIP1-02        ---ccgagcc----------------------------------------
A0A2I2YVQ5_PMAIP1-      ---ccgagcc----------------------------------------
Q13794_PMAIP1-01        ---ccgagcc----------------------------------------
A0A2R9AKC9_PMAIP1-      ---ccgagcc----------------------------------------
A0A2I3SX38_PMAIP1-      ---ccgagcc----------------------------------------
A0A2I2YVQ5_PMAIP1-      ---ccgagcc----------------------------------------
                                                                          

A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
A0A4W4H0G9_PMAIP1-      --------------------------------------------------
A0A452J430_PMAIP1-      --------------------------------------------------
A0A674JUE0_PMAIP1-      --------------------------------------------------
A0A5F8ATY0_PMAIP1-      --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A7M4FB17_PMAIP1-      --------------------------------------------------
A0A670IXL8_PMAIP1-      --------------------------------------------------
A0A674HDV6_PMAIP1-      --------------------------------------------------
A0A663N909_PMAIP1-      --------------------------------------------------
A0A663FH84_PMAIP1-      --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A803YIP1_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
A0A669QIC6_PMAIP1-      tttacgggggttgatactggaaaaaagcaagcttttccctttttcttttc
A0A803TSK5_PMAIP1-      --------------------------------------------------
A0A5F9C629_PMAIP1-      --------------------------------------------------
A0A670ZS96_PMAIP1-      --------------------------------------------------
Q9JM54_PMAIP1-03        --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q9JM54_PMAIP1-02        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A4X1TQ35_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A671EYM5_PMAIP1-      --------------------------------------------------
A0A2Y9P485_PMAIP1-      --------------------------------------------------
A0A2Y9TJ73_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A452EST2_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A673UI19_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A667HYB7_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A452TE71_PMAIP1-      --------------------------------------------------
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
A0A452STA4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
                                                                          

A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
A0A4W4H0G9_PMAIP1-      --------------------------------------------------
A0A452J430_PMAIP1-      --------------------------------------------------
A0A674JUE0_PMAIP1-      --------------------------------------------------
A0A5F8ATY0_PMAIP1-      --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A7M4FB17_PMAIP1-      --------------------------------------------------
A0A670IXL8_PMAIP1-      --------------------------------------------------
A0A674HDV6_PMAIP1-      --------------------------------------------------
A0A663N909_PMAIP1-      --------------------------------------------------
A0A663FH84_PMAIP1-      --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A803YIP1_PMAIP1-      ----------------------------------------ttatctggaa
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
A0A669QIC6_PMAIP1-      ctttttcttctctaccgtcttctttccctccccgatatcgctgtctggaa
A0A803TSK5_PMAIP1-      --------------------------------------------------
A0A5F9C629_PMAIP1-      --------------------------------------------------
A0A670ZS96_PMAIP1-      --------------------------------------------------
Q9JM54_PMAIP1-03        --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q9JM54_PMAIP1-02        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A4X1TQ35_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A671EYM5_PMAIP1-      --------------------------------------------------
A0A2Y9P485_PMAIP1-      --------------------------------------------------
A0A2Y9TJ73_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A452EST2_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A673UI19_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A667HYB7_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A452TE71_PMAIP1-      --------------------------------------------------
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
A0A452STA4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
                                                                          

A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
A0A4W4H0G9_PMAIP1-      ----------------------------------------ctttctagag
A0A452J430_PMAIP1-      ------------------------------------ccgctctcccagca
A0A674JUE0_PMAIP1-      ------------------------------------ac---caccca-ca
A0A5F8ATY0_PMAIP1-      ---------------------------------------------acaga
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A7M4FB17_PMAIP1-      -------------------------------------------gcccgag
A0A670IXL8_PMAIP1-      ---------------------------------------------cagca
A0A674HDV6_PMAIP1-      --------------------------------------------------
A0A663N909_PMAIP1-      ----------------------------------tgtgccctctgcagag
A0A663FH84_PMAIP1-      -------------------------------------------cgcaggg
A0A493SWX7_PMAIP1-      -----------------------------------------tccgcagaa
A0A803YIP1_PMAIP1-      aagacctcgttagaattaaatccccatcgccctgcgcgtgttctgcagag
A0A1D5PAR2_PMAIP1-      -------------------------------------------tgcagag
A0A669QIC6_PMAIP1-      aagacctcgttagaattaaatccccatcgccctgcgcgtgttttgcagag
A0A803TSK5_PMAIP1-      --------------------------------------------------
A0A5F9C629_PMAIP1-      ---------------------------------------------cgaag
A0A670ZS96_PMAIP1-      ---------------------------------------------ttcca
Q9JM54_PMAIP1-03        ---------------------------------------------caacc
Q9JM54_PMAIP1-01        ---------------------------------------------caacc
Q9JM54_PMAIP1-02        --------------------------------------------------
G3T0P7_PMAIP1-01        ---------------------------------------------ctgcc
A0A286XF37_PMAIP1-      ---------------------------------------------cggca
G1P8F9_PMAIP1-01        ---------------------------------------------cgacg
Q9GL49_PMAIP1-01        ---------------------------------------------ctacg
A0A4X1TQ35_PMAIP1-      ---------------------------------------------ctacg
F1SMU1_PMAIP1-01        ---------------------------------------------ctacg
A0A3Q2I0H2_PMAIP1-      ---------------------------------------------ccacg
A0A671EYM5_PMAIP1-      ---------------------------------------------ccacg
A0A2Y9P485_PMAIP1-      ---------------------------------------------cgacg
A0A2Y9TJ73_PMAIP1-      ---------------------------------------------cgacg
A0A4W2CDL0_PMAIP1-      ---------------------------------------------ccacg
A0A3Q1NFP6_PMAIP1-      ---------------------------------------------ccacg
A0A4W2CDL0_PMAIP1-      ---------------------------------------------ccacg
A0A452EST2_PMAIP1-      ---------------------------------------------ccacg
W5P738_PMAIP1-01        ---------------------------------------------ccacg
A0A2K6EM90_PMAIP1-      ---------------------------------------------cgacg
A0A673UI19_PMAIP1-      ---------------------------------------------ccgcg
A0A337SUX1_PMAIP1-      ---------------------------------------------ccgcg
A0A667HYB7_PMAIP1-      ---------------------------------------------ccgcg
G1LIZ7_PMAIP1-01        ---------------------------------------------cctct
A0A452TE71_PMAIP1-      ---------------------------------------------cctct
A0A7N5JEA5_PMAIP1-      ---------------------------------------------ctgcg
A0A452STA4_PMAIP1-      ---------------------------------------------ctgcg
A0A2I3HX97_PMAIP1-      ---------------------------------------------ccgcg
A0A2K5QQC6_PMAIP1-      ---------------------------------------------ccgcg
A0A2K5CFK7_PMAIP1-      ---------------------------------------------cctcg
A0A2K6S6C4_PMAIP1-      ---------------------------------------------ccgcg
A0A2K6KJF1_PMAIP1-      ---------------------------------------------cagcg
A0A2K6NC45_PMAIP1-      ---------------------------------------------cagcg
A0A2K6KJF1_PMAIP1-      ---------------------------------------------cagcg
A0A2K6NC45_PMAIP1-      ---------------------------------------------cagcg
A0A2K5JY17_PMAIP1-      ---------------------------------------------cagcg
A0A2K5JY17_PMAIP1-      ---------------------------------------------cagcg
A0A2K5NJZ2_PMAIP1-      ---------------------------------------------caatg
A0A2K5NJZ2_PMAIP1-      ---------------------------------------------caatg
A0A2K6BV43_PMAIP1-      ---------------------------------------------caacg
A0A2K5VPX2_PMAIP1-      ---------------------------------------------caacg
A0A2K6BV43_PMAIP1-      ---------------------------------------------caacg
A0A2K5ZWH1_PMAIP1-      ---------------------------------------------caacg
A0A0D9S003_PMAIP1-      ---------------------------------------------caacg
A0A2K5ZWH1_PMAIP1-      ---------------------------------------------caacg
A0A2I3HX97_PMAIP1-      ---------------------------------------------ccgcg
H2NWG2_PMAIP1-01        ---------------------------------------------ccgcg
A0A2I3SX38_PMAIP1-      ---------------------------------------------ccgcg
A0A2R9AKC9_PMAIP1-      ---------------------------------------------ccgcg
Q13794_PMAIP1-02        ---------------------------------------------ccgcg
A0A2I2YVQ5_PMAIP1-      ---------------------------------------------ccgcg
Q13794_PMAIP1-01        ---------------------------------------------ccgcg
A0A2R9AKC9_PMAIP1-      ---------------------------------------------ccgcg
A0A2I3SX38_PMAIP1-      ---------------------------------------------ccgcg
A0A2I2YVQ5_PMAIP1-      ---------------------------------------------ccgcg
                                                                          

A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
A0A4W4H0G9_PMAIP1-      c-------------------------------------------------
A0A452J430_PMAIP1-      cagg----------------------------------------------
A0A674JUE0_PMAIP1-      cagg----------------------------------------------
A0A5F8ATY0_PMAIP1-      tgg-----------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A7M4FB17_PMAIP1-      cggg----------------------------------------------
A0A670IXL8_PMAIP1-      tccacaaccaatgactcgg-------------------------------
A0A674HDV6_PMAIP1-      --------------------------------------------------
A0A663N909_PMAIP1-      cggg----------------------------------------------
A0A663FH84_PMAIP1-      cggg----------------------------------------------
A0A493SWX7_PMAIP1-      cggc----------------------------------------------
A0A803YIP1_PMAIP1-      cggg----------------------------------------------
A0A1D5PAR2_PMAIP1-      cggg----------------------------------------------
A0A669QIC6_PMAIP1-      cggg----------------------------------------------
A0A803TSK5_PMAIP1-      ----------tggcggcag-------------------------------
A0A5F9C629_PMAIP1-      cgag------cgccagcag-------------------------------
A0A670ZS96_PMAIP1-      ctgaagagtgctctgtcat-------------------------------
Q9JM54_PMAIP1-03        cggg------tgccagcag-------------------------------
Q9JM54_PMAIP1-01        cggg------tgccagcag-------------------------------
Q9JM54_PMAIP1-02        ---------------gcag-------------------------------
G3T0P7_PMAIP1-01        ggga------ccccggcaggtactcaac----------------------
A0A286XF37_PMAIP1-      cggg------cgcgcgcgg-------------------------------
G1P8F9_PMAIP1-01        cggg------ccccggcag-------------------------------
Q9GL49_PMAIP1-01        cgggtggccctcccgccag-------------------------------
A0A4X1TQ35_PMAIP1-      cgggtggccctcccgccag-------------------------------
F1SMU1_PMAIP1-01        cgggtggccctcccgccag-------------------------------
A0A3Q2I0H2_PMAIP1-      cgag------ccccggcag-------------------------------
A0A671EYM5_PMAIP1-      cggg------ccccggcag-------------------------------
A0A2Y9P485_PMAIP1-      cggg------ctccggcag-------------------------------
A0A2Y9TJ73_PMAIP1-      cggg------ccccggcag-------------------------------
A0A4W2CDL0_PMAIP1-      cggg------tcccggcag-------------------------------
A0A3Q1NFP6_PMAIP1-      cggg------tcccggcag-------------------------------
A0A4W2CDL0_PMAIP1-      cggg------tcccggcag-------------------------------
A0A452EST2_PMAIP1-      cggg------tcccggcag-------------------------------
W5P738_PMAIP1-01        cggg------tcccggcag-------------------------------
A0A2K6EM90_PMAIP1-      cgga------ctcgggcag-------------------------------
A0A673UI19_PMAIP1-      cggg------ccccggcag-------------------------------
A0A337SUX1_PMAIP1-      cggg------ccccggcag-------------------------------
A0A667HYB7_PMAIP1-      cggg------ccccggcag-------------------------------
G1LIZ7_PMAIP1-01        ccct------ctgccgcaccccct--------------------------
A0A452TE71_PMAIP1-      ccct------ctgctgcaccccct--------------------------
A0A7N5JEA5_PMAIP1-      cgga------ccccggcag-------------------------------
A0A452STA4_PMAIP1-      cgga------ccccggcag-------------------------------
A0A2I3HX97_PMAIP1-      ccgg------ctccagcaggtaccgacccgctggggacggcggggacggc
A0A2K5QQC6_PMAIP1-      ccgg------ctccagcag-------------------------------
A0A2K5CFK7_PMAIP1-      cggg------ctccagcag-------------------------------
A0A2K6S6C4_PMAIP1-      cggg------ctccagcag-------------------------------
A0A2K6KJF1_PMAIP1-      cggg------ctcaggcag-------------------------------
A0A2K6NC45_PMAIP1-      cggg------ctcaggcag-------------------------------
A0A2K6KJF1_PMAIP1-      cggg------ctcaggcaggacct------gcagggacggcagggacggc
A0A2K6NC45_PMAIP1-      cggg------ctcaggcaggacct------gcagggacggcagggacggc
A0A2K5JY17_PMAIP1-      cggg------ctcaggcag-------------------------------
A0A2K5JY17_PMAIP1-      cggg------ctcaggcaggtactgacccgctggggccagcgaagaccca
A0A2K5NJZ2_PMAIP1-      cggg------ctcaggcag-------------------------------
A0A2K5NJZ2_PMAIP1-      cggg------ctcaggcaggacag------gcagggacggcagggacggc
A0A2K6BV43_PMAIP1-      cggg------ctcaggcag-------------------------------
A0A2K5VPX2_PMAIP1-      cggg------ctcaggcaggaccggggactgcagggacggcagggacggc
A0A2K6BV43_PMAIP1-      cggg------ctcaggcaggaccg------gcagggacggcagggacggc
A0A2K5ZWH1_PMAIP1-      cggg------ctcaggcaggacag------gcagggacggcagggacggc
A0A0D9S003_PMAIP1-      cggg------ctcaggcag-------------------------------
A0A2K5ZWH1_PMAIP1-      cggg------ctcaggcag-------------------------------
A0A2I3HX97_PMAIP1-      ccgg------ctccagcag-------------------------------
H2NWG2_PMAIP1-01        cggg------ctccagcaggag---------caggtacggcgggtacggc
A0A2I3SX38_PMAIP1-      cggg------ctccagcaggac---------------cggcgggtacggc
A0A2R9AKC9_PMAIP1-      cggg------ctccagcaggac---------------cggcgggtacggc
Q13794_PMAIP1-02        cggg------ctccagcaggaccg------gcgggtacggcgggtacggc
A0A2I2YVQ5_PMAIP1-      cggg------ctccagcag-------------------------------
Q13794_PMAIP1-01        cggg------ctccagcag-------------------------------
A0A2R9AKC9_PMAIP1-      cggg------ctccagcag-------------------------------
A0A2I3SX38_PMAIP1-      cggg------ctccagcag-------------------------------
A0A2I2YVQ5_PMAIP1-      cggg------ctccagcaggac---------------cggcgggtacggc
                                                                          

A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
A0A4W4H0G9_PMAIP1-      --------------------------------------------------
A0A452J430_PMAIP1-      --------------------------------------------------
A0A674JUE0_PMAIP1-      --------------------------------------------------
A0A5F8ATY0_PMAIP1-      --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A7M4FB17_PMAIP1-      --------------------------------------------------
A0A670IXL8_PMAIP1-      --------------------------------------------------
A0A674HDV6_PMAIP1-      --------------------------------------------------
A0A663N909_PMAIP1-      --------------------------------------------------
A0A663FH84_PMAIP1-      --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A803YIP1_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
A0A669QIC6_PMAIP1-      --------------------------------------------------
A0A803TSK5_PMAIP1-      --------------------------------------------------
A0A5F9C629_PMAIP1-      --------------------------------------------------
A0A670ZS96_PMAIP1-      --------------------------------------------------
Q9JM54_PMAIP1-03        --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q9JM54_PMAIP1-02        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A4X1TQ35_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A671EYM5_PMAIP1-      --------------------------------------------------
A0A2Y9P485_PMAIP1-      --------------------------------------------------
A0A2Y9TJ73_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A452EST2_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A673UI19_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A667HYB7_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A452TE71_PMAIP1-      --------------------------------------------------
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
A0A452STA4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      gaggaaccaagccggatttgggattgggatgcagctgcgtttcaccaggg
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      gagggaccaagccggattagggattgggatgcagctgcatttcaccagag
A0A2K6NC45_PMAIP1-      gagggaccaagccggattagggattgggatgcagctgcatttcaccagag
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      ggctgggcggggtcggggccggggcaaaaagc------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      gagggaccaggccggatttgggattgggatgcagctgcatttcaccagag
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      gagggaccaggccggatttgggattgggatgcagctgcattacaccagag
A0A2K6BV43_PMAIP1-      gagggaccaggccggatttgggattgggatgcagctgcattacaccagag
A0A2K5ZWH1_PMAIP1-      gagggaccaggccggatttgggattgggatgcaactgcatttcaccagag
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        gagggaccaagccggatttgggattgggatgcagctgcgtttcaccaggg
A0A2I3SX38_PMAIP1-      gagggaccaagccggatttgggattgggatgcagctgcgtttcaccaggg
A0A2R9AKC9_PMAIP1-      gagggaccaagccggatttgggattgggatgcagctgcgtttcaccaggg
Q13794_PMAIP1-02        gagggaccaagccggatttgcgattgggatgcagctgcgtttcaccaggg
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      gagggaccaagccggctttgggattgagatgcagctgcgtttcaccaggg
                                                                          

A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
A0A4W4H0G9_PMAIP1-      --------------------------------------------------
A0A452J430_PMAIP1-      --------------------------------------------------
A0A674JUE0_PMAIP1-      --------------------------------------------------
A0A5F8ATY0_PMAIP1-      --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A7M4FB17_PMAIP1-      --------------------------------------------------
A0A670IXL8_PMAIP1-      --------------------------------------------------
A0A674HDV6_PMAIP1-      --------------------------------------------------
A0A663N909_PMAIP1-      --------------------------------------------------
A0A663FH84_PMAIP1-      --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A803YIP1_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
A0A669QIC6_PMAIP1-      --------------------------------------------------
A0A803TSK5_PMAIP1-      --------------------------------------------------
A0A5F9C629_PMAIP1-      --------------------------------------------------
A0A670ZS96_PMAIP1-      --------------------------------------------------
Q9JM54_PMAIP1-03        --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q9JM54_PMAIP1-02        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A4X1TQ35_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A671EYM5_PMAIP1-      --------------------------------------------------
A0A2Y9P485_PMAIP1-      --------------------------------------------------
A0A2Y9TJ73_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A452EST2_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A673UI19_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A667HYB7_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A452TE71_PMAIP1-      --------------------------------------------------
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
A0A452STA4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      gcaaaaagctcctctcctcctctctttcctcctcgccacttgcccttccc
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      gcaaaaagctc------------ctctcctcctccccacttgcccttccg
A0A2K6NC45_PMAIP1-      gcaaaaagctc------------ctctcctcctccccacttgcccttccg
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      ------------------------tcctctcctccccacttgcccttccg
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      gcaaagagctc------------gtctcctcctccccacttgcccttccg
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      gcaaaaagctc------------gtctcctcctccccacttgtccttccg
A0A2K6BV43_PMAIP1-      gcaaaaagctc------------gtctcctcctccccacttgtccttccg
A0A2K5ZWH1_PMAIP1-      gcaaaaagctc------------gtctcctcctccccacttgcccttccg
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        gcaaaaagctc------------ctttcctcctcgccacttgccctgccc
A0A2I3SX38_PMAIP1-      gcaaaaagctcctttcctcctctctttcctcctggccacttgcccttccc
A0A2R9AKC9_PMAIP1-      gcaaaaagctcctttcctcctc---ttcctcctcgccacttgcccttccc
Q13794_PMAIP1-02        gcaaaaagctcctttcctcctctctttcctcctcgccacttgcccttccc
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      gcaaaaagctc------------ctttcctcctcgccacttgcccttccc
                                                                          

A0A0P0HZF9_PMAIP1-      --------------------------aaaccgctgttgtcgagtgcgcgc
Q0GKC8_PMAIP1-01        --------------------------aaaccgctgtagtagagtgcgcgc
A0A4W4H0G9_PMAIP1-      --------------------------aaaccgttgtgtctgaatgtgcgt
A0A452J430_PMAIP1-      --------------------------aagctgt---gacgcagtgctctt
A0A674JUE0_PMAIP1-      --------------------------aagctgt---gatgcagtgctctt
A0A5F8ATY0_PMAIP1-      --------------------------aattgca---aattcagtttgcaa
A0A3B5RFA9_PMAIP1-      ------------------------------------------ctgcgctc
A0A7M4FB17_PMAIP1-      --------------------------aagcagt---gagagagtgcgcct
A0A670IXL8_PMAIP1-      --------------------------aggcggt---acgggaatgtgcat
A0A674HDV6_PMAIP1-      ---------------------------tgcggc---ggtggagtgcgccc
A0A663N909_PMAIP1-      --------------------------aggcggt---ggcggagtgcgccc
A0A663FH84_PMAIP1-      --------------------------aggtgga---ggcgcagtgcgccc
A0A493SWX7_PMAIP1-      --------------------------aggcggt---ggcggagtgcgcgc
A0A803YIP1_PMAIP1-      --------------------------acgcggt---ggctgagtgcgcac
A0A1D5PAR2_PMAIP1-      --------------------------acgcggt---ggctgagtgcgcgc
A0A669QIC6_PMAIP1-      --------------------------acgcggt---ggctgagtgcgcgc
A0A803TSK5_PMAIP1-      -----------------------------------------aatgcgcat
A0A5F9C629_PMAIP1-      --------------------------agctgga---agtcgaatgtgcca
A0A670ZS96_PMAIP1-      ------------------------------------------gatagctt
Q9JM54_PMAIP1-03        --------------------------acttgaa---ggacgagtgtgc--
Q9JM54_PMAIP1-01        --------------------------acttgaa---ggacgagtgtgc--
Q9JM54_PMAIP1-02        --------------------------acttgaa---ggacgagtgtgc--
G3T0P7_PMAIP1-01        --------------------------agcgcgatgttgtcgagtgtgcta
A0A286XF37_PMAIP1-      --------------------------agctgga---agtcgagtgtgctg
G1P8F9_PMAIP1-01        --------------------------aggctga---aattgagtgtgccc
Q9GL49_PMAIP1-01        --------------------------atcctga---agtcgagtgtgcca
A0A4X1TQ35_PMAIP1-      --------------------------atcctga---agtcgagtgtgcca
F1SMU1_PMAIP1-01        --------------------------atcctga---agtcgagtgtgcca
A0A3Q2I0H2_PMAIP1-      --------------------------agcttga---ggctgagtgtgcca
A0A671EYM5_PMAIP1-      --------------------------agctcga---agttgagtgtgcca
A0A2Y9P485_PMAIP1-      --------------------------atcctga---agttgagtgtgcca
A0A2Y9TJ73_PMAIP1-      --------------------------atcctga---agttgagtgtgcca
A0A4W2CDL0_PMAIP1-      --------------------------atcctga---agttgaatgtgcca
A0A3Q1NFP6_PMAIP1-      --------------------------atcctga---agttgaatgtgcca
A0A4W2CDL0_PMAIP1-      --------------------------atcctga---agttgaatgtgcca
A0A452EST2_PMAIP1-      --------------------------atcctga---agttgagtgtgcca
W5P738_PMAIP1-01        --------------------------atcctga---agttgagtgtgcca
A0A2K6EM90_PMAIP1-      --------------------------agatcga---agaggagtgtgccc
A0A673UI19_PMAIP1-      --------------------------agcccga---ggtggaatgtgcca
A0A337SUX1_PMAIP1-      --------------------------agcccga---agtggaatgtgcca
A0A667HYB7_PMAIP1-      --------------------------agcccga---agtggaatgtgcca
G1LIZ7_PMAIP1-01        ----------------------------cccga---agtggagtgcgcca
A0A452TE71_PMAIP1-      ----------------------------cccga---agtggagtgtgcca
A0A7N5JEA5_PMAIP1-      --------------------------agcccga---agtggagtgcgcca
A0A452STA4_PMAIP1-      --------------------------agcccga---agtggagtgtgcca
A0A2I3HX97_PMAIP1-      cggggccacgaggaacaagtgcaagt--------------gagaacgtca
A0A2K5QQC6_PMAIP1-      --------------------------accttga---agtcgagtgtgcta
A0A2K5CFK7_PMAIP1-      --------------------------accttga---agtcgagtgtgcca
A0A2K6S6C4_PMAIP1-      --------------------------accttga---agtcgagtgtgcca
A0A2K6KJF1_PMAIP1-      --------------------------agctcga---agtcgagtgtgcta
A0A2K6NC45_PMAIP1-      --------------------------agctcga---agtcgagtgtgcta
A0A2K6KJF1_PMAIP1-      cggggccacgaggaacaagtgcaagtagctcga---agtcgagtgtgcta
A0A2K6NC45_PMAIP1-      cggggccacgaggaacaagtgcaagtagctcga---agtcgagtgtgcta
A0A2K5JY17_PMAIP1-      --------------------------agctcga---agtcgagtgtgcta
A0A2K5JY17_PMAIP1-      cggggccacgaggaacaagtgcaagtagctcga---agtcgagtgtgcta
A0A2K5NJZ2_PMAIP1-      --------------------------agctcga---agtcgagtgtgcta
A0A2K5NJZ2_PMAIP1-      cggggccgcgaggaacaagtgcaagtagctcga---agtcgagtgtgcta
A0A2K6BV43_PMAIP1-      --------------------------agctcga---agtcgagtgtgcta
A0A2K5VPX2_PMAIP1-      cggggccacgaggaacaagtgcaagtagctcga---agtcgagtgtgcta
A0A2K6BV43_PMAIP1-      cggggccacgaggaacaagtgcaagtagctcga---agtcgagtgtgcta
A0A2K5ZWH1_PMAIP1-      cggggccacgaggaacaagtgcaagtagctcga---agtcgagtgtgcta
A0A0D9S003_PMAIP1-      --------------------------agctcga---agtcgagtgtgcta
A0A2K5ZWH1_PMAIP1-      --------------------------agctcga---agtcgagtgtgcta
A0A2I3HX97_PMAIP1-      --------------------------agctgga---agttgagtgtgcta
H2NWG2_PMAIP1-01        cggggccacgaggaacaagtgcaaatagctgga---agtcgagtgtgcta
A0A2I3SX38_PMAIP1-      cgggggcacgaggaacaagtgcaagtagctgga---agtcgagtgtgcta
A0A2R9AKC9_PMAIP1-      cggggccacgaggaacaagcgcaagtagctgga---agtcgagtgtgcta
Q13794_PMAIP1-02        cggggccacgaggaacaagtgcaagtagctgga---agtcgagtgtgcta
A0A2I2YVQ5_PMAIP1-      --------------------------agctgga---agtcgagtgtgcta
Q13794_PMAIP1-01        --------------------------agctgga---agtcgagtgtgcta
A0A2R9AKC9_PMAIP1-      --------------------------agctgga---agtcgagtgtgcta
A0A2I3SX38_PMAIP1-      --------------------------agctgga---agtcgagtgtgcta
A0A2I2YVQ5_PMAIP1-      cggggccacgaggaacaagtgcaagtagctgga---agtcgagtgtgcta
                                                                          

A0A0P0HZF9_PMAIP1-      aacagttgcgcacaattggagatctctttgactggaaatacaagttactg
Q0GKC8_PMAIP1-01        agcagttgcgaaacattggagatctgttgaactggaaatataagttactg
A0A4W4H0G9_PMAIP1-      gccagctgcgcagaatgggagatctgatcaactggaaatacttgttgctg
A0A452J430_PMAIP1-      tgcaactacgcaaaataggagatatatgcaacctgcagcagaagattctt
A0A674JUE0_PMAIP1-      tgcaactacgcaaaataggagatatatgcaacctgcagcagaagattctt
A0A5F8ATY0_PMAIP1-      agaggaaaagagcgtttgggggaagattaaatagaagagacaagagtctt
A0A3B5RFA9_PMAIP1-      gcgagctgcggcaagttggagataaattgtactggagatacaaactcctg
A0A7M4FB17_PMAIP1-      tgcagctgcgccggatcggagaccagtgccacctgcaccagaagattttg
A0A670IXL8_PMAIP1-      tgcagctacgcaggatgggggacaaatggaacctgcgccagaagatcctc
A0A674HDV6_PMAIP1-      tggagctgacccgcatcggcgacaggtgggacttgcggcagaggctcctg
A0A663N909_PMAIP1-      tgcagctgcgcaggataggcgacaagtgggacctgcggcagaagatcctg
A0A663FH84_PMAIP1-      tgcagctgcgcaggatcggcgacaagtgggacctgcggcagaagatcctg
A0A493SWX7_PMAIP1-      tggagctgcgccggatcggcgacaaggcggactttcgacagcggatcctg
A0A803YIP1_PMAIP1-      tggagctgcgcaagatcggcgacaaggcggacctacagcagaaagtcctg
A0A1D5PAR2_PMAIP1-      tggagctgcgcaggatcggagacaaggcggacctgcagcagaaagtcctg
A0A669QIC6_PMAIP1-      tggagctgcgcaggatcggcgacaaggcggacctacggcagaaggtcctg
A0A803TSK5_PMAIP1-      tgcaactgagagtgattggagacaagtggaacctccgacagaggatccta
A0A5F9C629_PMAIP1-      ctcaactcaggatcatcggagataaactggatttgcgcagaaaactactg
A0A670ZS96_PMAIP1-      tgcagctacgcagaattggagacaaatggaatctccggcaaagaatcctg
Q9JM54_PMAIP1-03        -tcaactccggaggattggagacaaagtgaatttacggcagaaacttctg
Q9JM54_PMAIP1-01        -tcaactccggaggattggagacaaagtgaatttacggcagaaacttctg
Q9JM54_PMAIP1-02        -tcaactccggaggattggagacaaagtgaatttacggcagaaacttctg
G3T0P7_PMAIP1-01        ttcaactcaggagaattggagacaaaattaatttccggcagaaacttctg
A0A286XF37_PMAIP1-      ctcagttgagaagaattggagataaactgaatttccagcagaaacttatg
G1P8F9_PMAIP1-01        ttcaattaaggagaattggagacaagctgagtttcctgcagaaacttctg
Q9GL49_PMAIP1-01        ttcagttcagaaggattggagacaaactgaacttccggcagaaacttctg
A0A4X1TQ35_PMAIP1-      ttcagttcagaaggattggagacaaactgaacttccggcagaaacttctg
F1SMU1_PMAIP1-01        ttcagttcagaaggattggagacaaactgaacttccggcagaaacttctg
A0A3Q2I0H2_PMAIP1-      ttcaaattaggagaattggagacaaactgaatttccggcagaaacttctg
A0A671EYM5_PMAIP1-      ttcaattcaggagaattggagacaaactgagtttccggcagaaacttctg
A0A2Y9P485_PMAIP1-      ttcagttcaggagaattggagacaaactgaatttccggcagaaacttctg
A0A2Y9TJ73_PMAIP1-      ttcagttcaggagaattggagacaaactgaatttccggcagaaacttctg
A0A4W2CDL0_PMAIP1-      ttcagttgaggagaattggagacaaactgaatttccggcagaaacttgtg
A0A3Q1NFP6_PMAIP1-      ttcagttgaggagaattggagacaaactgaatttccggcagaaacttgtg
A0A4W2CDL0_PMAIP1-      ttcagttgaggagaattggagacaaactgaatttccggcagaaacttgtg
A0A452EST2_PMAIP1-      ttcagttgaggagaattggagacaaactgaatttccggcagaaacttgtg
W5P738_PMAIP1-01        ttcagttgaggagaattggagacaaactgaatttccggcagaaacttgtg
A0A2K6EM90_PMAIP1-      ttcaactcaggagacttggagacaaactgcatttccagcagaaacttctg
A0A673UI19_PMAIP1-      tgcagctccggagaattggagacaaactgaatttccggcagaaacttatg
A0A337SUX1_PMAIP1-      tgcagctccggagatttggagacaaactgaatttccgacagaagcttatg
A0A667HYB7_PMAIP1-      tgcagctccggagatttggagacaaactgaatttccgacagaagcttatg
G1LIZ7_PMAIP1-01        ttcaactcaggagatttggagacaaactgaatttccggcagaaacttctg
A0A452TE71_PMAIP1-      ttcaactcaggagatttggagacaaactgaatttccggcagaaacttctg
A0A7N5JEA5_PMAIP1-      ttcaactcaggagatttggagacaaactgaatttccggcagaaacttctg
A0A452STA4_PMAIP1-      ttcaactcaggagatttggagacaaactgaatttccggcagaaacttctg
A0A2I3HX97_PMAIP1-      tt-atcgcggcaga---agggacaaactgaacttccggcagaaacttctg
A0A2K5QQC6_PMAIP1-      ctcaactcaggagatttggagacaaactgaatttccggcagaaacttctg
A0A2K5CFK7_PMAIP1-      ctcaactcaggagatttggagacaaactaaatttccggcagaaacttctg
A0A2K6S6C4_PMAIP1-      ttcaactcaggagatttggagacaaactgaatttccggcagaaacttctg
A0A2K6KJF1_PMAIP1-      ctcaactcaggagatttggagacaaactgaacttccggcagaaacttttg
A0A2K6NC45_PMAIP1-      ctcaactcaggagatttggagacaaactgaacttccggcagaaacttttg
A0A2K6KJF1_PMAIP1-      ctcaactcaggagatttggagacaaactgaacttccggcagaaacttttg
A0A2K6NC45_PMAIP1-      ctcaactcaggagatttggagacaaactgaacttccggcagaaacttttg
A0A2K5JY17_PMAIP1-      ctcaactcaggagatttggagacaaactgaacttccggcagaaacttctg
A0A2K5JY17_PMAIP1-      ctcaactcaggagatttggagacaaactgaacttccggcagaaacttctg
A0A2K5NJZ2_PMAIP1-      ctcaactcaggagatttggagacaaactgaacttccggcagaaacttctg
A0A2K5NJZ2_PMAIP1-      ctcaactcaggagatttggagacaaactgaacttccggcagaaacttctg
A0A2K6BV43_PMAIP1-      ctcaactcaggagatttggagacaaactaaacttccggcagaaacttctg
A0A2K5VPX2_PMAIP1-      ctcaactcaggagatttggagacaaactgaacttccggcagaaacttctg
A0A2K6BV43_PMAIP1-      ctcaactcaggagatttggagacaaactaaacttccggcagaaacttctg
A0A2K5ZWH1_PMAIP1-      ctcaactcaggagatttggagacaaactgaacttccggcagaaacttctg
A0A0D9S003_PMAIP1-      ctcaactcaggagatttggagacaaactgaacttccggcagaaacttctg
A0A2K5ZWH1_PMAIP1-      ctcaactcaggagatttggagacaaactgaacttccggcagaaacttctg
A0A2I3HX97_PMAIP1-      ctcaactcaggagatttggagacaaactgaacttccggcagaaacttctg
H2NWG2_PMAIP1-01        ctcaactcaggagatttggagacaaactgaacttccggcagaaacttctg
A0A2I3SX38_PMAIP1-      ctcaactcaggagatttggagacaaactgaacttccggcagaaacttctg
A0A2R9AKC9_PMAIP1-      ctcaactcaggagatttggagacaaactgaacttccggcagaaacttctg
Q13794_PMAIP1-02        ctcaactcaggagatttggagacaaactgaacttccggcagaaacttctg
A0A2I2YVQ5_PMAIP1-      ctcaactcaggagatttggagacaaactgaacttccggcagaaacttctg
Q13794_PMAIP1-01        ctcaactcaggagatttggagacaaactgaacttccggcagaaacttctg
A0A2R9AKC9_PMAIP1-      ctcaactcaggagatttggagacaaactgaacttccggcagaaacttctg
A0A2I3SX38_PMAIP1-      ctcaactcaggagatttggagacaaactgaacttccggcagaaacttctg
A0A2I2YVQ5_PMAIP1-      ctcaactcaggagatttggagacaaactgaacttccggcagaaacttctg
                                          * *                           * 

A0A0P0HZF9_PMAIP1-      gaaatcataatcgc-gctcc----------------agaaagc-------
Q0GKC8_PMAIP1-01        gagctcatagtaac-actcc----------------agaaaat-------
A0A4W4H0G9_PMAIP1-      catttgattgctgacgctcg-------tacacgtctgggaata-------
A0A452J430_PMAIP1-      aacgttattacaaa-actgt---------tctgcccaggaacg-------
A0A674JUE0_PMAIP1-      aatgttattacaaa-actgt---------tctgcccaggaacg-------
A0A5F8ATY0_PMAIP1-      gctctgtcacccag-gctgg-----------agtgcagtggcc-------
A0A3B5RFA9_PMAIP1-      gaaatgctgctcaa-gaactatgagactctcaacaaaataaaa-------
A0A7M4FB17_PMAIP1-      ggtctcattgcaaa-acttt---------tccgccctggaacg-------
A0A670IXL8_PMAIP1-      aacctgatttcaaa-gcttt---------tctgccccgaaacg-------
A0A674HDV6_PMAIP1-      aacctgctcgccaa-gctct---------tctgccccggaacgtgggctg
A0A663N909_PMAIP1-      aacctcctcacaaa-gctgt---------tctgcccggaaacg-------
A0A663FH84_PMAIP1-      aacctcctcacgaa-gctat---------tcttcccggagacg-------
A0A493SWX7_PMAIP1-      aacctcatcacaaa-gctgt---------tctgccccaaaacg-------
A0A803YIP1_PMAIP1-      aacctcatcgcgaa-acttt---------tctgccccaagaaac------
A0A1D5PAR2_PMAIP1-      aacctcatcacgaa-actgt---------tctgccccaaaacg-------
A0A669QIC6_PMAIP1-      aacctcatcgcgaa-actct---------tctgccccaaaacg-------
A0A803TSK5_PMAIP1-      aacatgatttccaa-gatct---------tctgcccaggaaga-------
A0A5F9C629_PMAIP1-      aatctcatatctaa-gttct---------tcaacttcgtcccc-------
A0A670ZS96_PMAIP1-      aacctcttctccaa-gctct---------tctgcccaggaact-------
Q9JM54_PMAIP1-03        aatttgatttccaa-gctct---------tcaatttagtaacc-------
Q9JM54_PMAIP1-01        aatttgatttccaa-gctct---------tcaatttagtaacc-------
Q9JM54_PMAIP1-02        aatttgatttccaa-gctct---------tcaatttagtaacc-------
G3T0P7_PMAIP1-01        aatgtgatatgcaa-gctct---------tctgctcaggcacc-------
A0A286XF37_PMAIP1-      tatttgatttccaa-actca---------tcagtttggtaacc-------
G1P8F9_PMAIP1-01        aatctgatgtacaa-actct---------ttggctcaggaacc-------
Q9GL49_PMAIP1-01        aatctgatagccaa-actct---------tccgtctaggaacc-------
A0A4X1TQ35_PMAIP1-      aatctgatagccaa-actct---------tccgcctaggaacc-------
F1SMU1_PMAIP1-01        aatctgatagccaa-actct---------tccgcctaggaacc-------
A0A3Q2I0H2_PMAIP1-      aatctcatagccaa-actct---------tccgctcaggaacc-------
A0A671EYM5_PMAIP1-      aatctaatatccaa-actct---------tccgctcaggaacc-------
A0A2Y9P485_PMAIP1-      aatttgatatccaa-actct---------tccgctcaggaacc-------
A0A2Y9TJ73_PMAIP1-      aatttgatatccaa-actct---------tccgctcaggaacc-------
A0A4W2CDL0_PMAIP1-      aatctgatatccaa-actcc---------tccgctcaggaact-------
A0A3Q1NFP6_PMAIP1-      aatctgatatccaa-actcc---------tccgctcaggaact-------
A0A4W2CDL0_PMAIP1-      aatctgatatccaa-actcc---------tccgctcaggaact-------
A0A452EST2_PMAIP1-      aatctgatagccaa-actcc---------tccgctcaggaact-------
W5P738_PMAIP1-01        aatctgatagccaa-actcc---------tccgctcaggaact-------
A0A2K6EM90_PMAIP1-      aatctgatagccaa-acttt---------tccgctcaggaact-------
A0A673UI19_PMAIP1-      aatctgatagccaa-actct---------tccgctcgggaacc-------
A0A337SUX1_PMAIP1-      aatctgatatccaa-actct---------tccgctcgggaacc-------
A0A667HYB7_PMAIP1-      aatctgatatccaa-actct---------tccgctcgggaacc-------
G1LIZ7_PMAIP1-01        aatctgatatccaa-actct---------tccgctcaggaacc-------
A0A452TE71_PMAIP1-      aatctgatatccaa-actct---------tccgctcaggaacc-------
A0A7N5JEA5_PMAIP1-      aatctgatatccaa-actct---------tccgctcaggaacc-------
A0A452STA4_PMAIP1-      aatctgatatccaa-actct---------tccgctcaggaacc-------
A0A2I3HX97_PMAIP1-      aatctgatatccaa-actct---------tctgctcaggaacc-------
A0A2K5QQC6_PMAIP1-      aatctgatatccaa-actct---------tctgctcaggaaca-------
A0A2K5CFK7_PMAIP1-      aatctgatatccaa-actct---------tctgctcaggaacc-------
A0A2K6S6C4_PMAIP1-      aatctgatatccaa-actct---------tctgctcaggaacc-------
A0A2K6KJF1_PMAIP1-      aatctgatagccaa-actct---------tctgctcaggaacc-------
A0A2K6NC45_PMAIP1-      aatctgatagccaa-actct---------tctgctcaggaacc-------
A0A2K6KJF1_PMAIP1-      aatctgatagccaa-actct---------tctgctcaggaacc-------
A0A2K6NC45_PMAIP1-      aatctgatagccaa-actct---------tctgctcaggaacc-------
A0A2K5JY17_PMAIP1-      aatctgatagccaa-actct---------tctgctcaggaacc-------
A0A2K5JY17_PMAIP1-      aatctgatagccaa-actct---------tctgctcaggaacc-------
A0A2K5NJZ2_PMAIP1-      aatctgatagccaa-actct---------tctgctcaggaacc-------
A0A2K5NJZ2_PMAIP1-      aatctgatagccaa-actct---------tctgctcaggaacc-------
A0A2K6BV43_PMAIP1-      aatctgatagccaa-actct---------tctgctcaggaacc-------
A0A2K5VPX2_PMAIP1-      aatctgatagccaa-actct---------tctgctcaggaacc-------
A0A2K6BV43_PMAIP1-      aatctgatagccaa-actct---------tctgctcaggaacc-------
A0A2K5ZWH1_PMAIP1-      aatctgatagccaa-actct---------tctgctcaggaacc-------
A0A0D9S003_PMAIP1-      aatctgatagccaa-actct---------tctgctcaggaacc-------
A0A2K5ZWH1_PMAIP1-      aatctgatagccaa-actct---------tctgctcaggaacc-------
A0A2I3HX97_PMAIP1-      aatctgatatccaa-actct---------tctgctcaggaacc-------
H2NWG2_PMAIP1-01        aatctgatatccaa-actct---------tctgctcaggaacc-------
A0A2I3SX38_PMAIP1-      aatctgatatccaa-actct---------tctgctcaggaacc-------
A0A2R9AKC9_PMAIP1-      aatctgatatccaa-actct---------tctgctcaggaacc-------
Q13794_PMAIP1-02        aatctgatatccaa-actct---------tctgctcaggaacc-------
A0A2I2YVQ5_PMAIP1-      aatctgatatccaa-actct---------tctgctcaggaacc-------
Q13794_PMAIP1-01        aatctgatatccaa-actct---------tctgctcaggaacc-------
A0A2R9AKC9_PMAIP1-      aatctgatatccaa-actct---------tctgctcaggaacc-------
A0A2I3SX38_PMAIP1-      aatctgatatccaa-actct---------tctgctcaggaacc-------
A0A2I2YVQ5_PMAIP1-      aatctgatatccaa-actct---------tctgctcaggaacc-------
                            *                                             

A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
A0A4W4H0G9_PMAIP1-      --------------------------------------------------
A0A452J430_PMAIP1-      --------------------------------------------------
A0A674JUE0_PMAIP1-      --------------------------------------------------
A0A5F8ATY0_PMAIP1-      --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A7M4FB17_PMAIP1-      --------------------------------------------------
A0A670IXL8_PMAIP1-      --------------------------------------------------
A0A674HDV6_PMAIP1-      cccgcggacacggcgagcggaacggaggaggaccttggctttgtgggttt
A0A663N909_PMAIP1-      --------------------------------------------------
A0A663FH84_PMAIP1-      --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A803YIP1_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
A0A669QIC6_PMAIP1-      --------------------------------------------------
A0A803TSK5_PMAIP1-      --------------------------------------------------
A0A5F9C629_PMAIP1-      --------------------------------------------------
A0A670ZS96_PMAIP1-      --------------------------------------------------
Q9JM54_PMAIP1-03        --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q9JM54_PMAIP1-02        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A4X1TQ35_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A671EYM5_PMAIP1-      --------------------------------------------------
A0A2Y9P485_PMAIP1-      --------------------------------------------------
A0A2Y9TJ73_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A452EST2_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A673UI19_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A667HYB7_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A452TE71_PMAIP1-      --------------------------------------------------
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
A0A452STA4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
                                                                          

A0A0P0HZF9_PMAIP1-      -----------gcagacggacggaaaaagatga-----------------
Q0GKC8_PMAIP1-01        -----------acaaatggaggggaagcgatga-----------------
A0A4W4H0G9_PMAIP1-      -------------------tgcagtggtaatgatgttgttgctttgtgca
A0A452J430_PMAIP1-      ------------------------------tga-----------------
A0A674JUE0_PMAIP1-      ------------------------------tga-----------------
A0A5F8ATY0_PMAIP1-      ------------------------------cg------------------
A0A3B5RFA9_PMAIP1-      ------------------------------tga-----------------
A0A7M4FB17_PMAIP1-      ------------------------------tga-----------------
A0A670IXL8_PMAIP1-      ------------------------------tga-----------------
A0A674HDV6_PMAIP1-      ggaagaagaggctccacagacactgggagatga-----------------
A0A663N909_PMAIP1-      ------------------------------tga-----------------
A0A663FH84_PMAIP1-      ------------------------------tga-----------------
A0A493SWX7_PMAIP1-      ------------------------------tga-----------------
A0A803YIP1_PMAIP1-      ----------------cgcgcccgcggtgctga-----------------
A0A1D5PAR2_PMAIP1-      ------------------------------tga-----------------
A0A669QIC6_PMAIP1-      ------------------------------tga-----------------
A0A803TSK5_PMAIP1-      ------------------------------ggagagtga-----------
A0A5F9C629_PMAIP1-      ------------------------------tga-----------------
A0A670ZS96_PMAIP1-      ------------------------------tga-----------------
Q9JM54_PMAIP1-03        ------------------------------tga-----------------
Q9JM54_PMAIP1-01        ------------------------------tga-----------------
Q9JM54_PMAIP1-02        ------------------------------tga-----------------
G3T0P7_PMAIP1-01        ------------------------------tga-----------------
A0A286XF37_PMAIP1-      ------------------------------tga-----------------
G1P8F9_PMAIP1-01        ------------------------------tga-----------------
Q9GL49_PMAIP1-01        ------------------------------tga-----------------
A0A4X1TQ35_PMAIP1-      ------------------------------tga-----------------
F1SMU1_PMAIP1-01        ------------------------------tga-----------------
A0A3Q2I0H2_PMAIP1-      ------------------------------tga-----------------
A0A671EYM5_PMAIP1-      ------------------------------tga-----------------
A0A2Y9P485_PMAIP1-      ------------------------------tga-----------------
A0A2Y9TJ73_PMAIP1-      ------------------------------tga-----------------
A0A4W2CDL0_PMAIP1-      ------------------------------tga-----------------
A0A3Q1NFP6_PMAIP1-      ------------------------------tga-----------------
A0A4W2CDL0_PMAIP1-      ------------------------------tga-----------------
A0A452EST2_PMAIP1-      ------------------------------tga-----------------
W5P738_PMAIP1-01        ------------------------------tga-----------------
A0A2K6EM90_PMAIP1-      ------------------------------tga-----------------
A0A673UI19_PMAIP1-      ------------------------------tga-----------------
A0A337SUX1_PMAIP1-      ------------------------------tga-----------------
A0A667HYB7_PMAIP1-      ------------------------------tga-----------------
G1LIZ7_PMAIP1-01        ------------------------------tga-----------------
A0A452TE71_PMAIP1-      ------------------------------tga-----------------
A0A7N5JEA5_PMAIP1-      ------------------------------tga-----------------
A0A452STA4_PMAIP1-      ------------------------------tga-----------------
A0A2I3HX97_PMAIP1-      ------------------------------tgactgcatcaaaaacttgc
A0A2K5QQC6_PMAIP1-      ------------------------------tga-----------------
A0A2K5CFK7_PMAIP1-      ------------------------------tga-----------------
A0A2K6S6C4_PMAIP1-      ------------------------------tga-----------------
A0A2K6KJF1_PMAIP1-      ------------------------------tga-----------------
A0A2K6NC45_PMAIP1-      ------------------------------tga-----------------
A0A2K6KJF1_PMAIP1-      ------------------------------tgactgcatcaaaaacttgc
A0A2K6NC45_PMAIP1-      ------------------------------tgactgcatcaaaaacttgc
A0A2K5JY17_PMAIP1-      ------------------------------tga-----------------
A0A2K5JY17_PMAIP1-      ------------------------------tgactgcaacaaaaacttgc
A0A2K5NJZ2_PMAIP1-      ------------------------------tga-----------------
A0A2K5NJZ2_PMAIP1-      ------------------------------tgactgcatcaaacacttgc
A0A2K6BV43_PMAIP1-      ------------------------------tga-----------------
A0A2K5VPX2_PMAIP1-      ------------------------------tgactgcatcaaaaacttgc
A0A2K6BV43_PMAIP1-      ------------------------------tgactgcatcaaaaacttgc
A0A2K5ZWH1_PMAIP1-      ------------------------------tgactgcatcaaaaacttgc
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      ------------------------------tga-----------------
A0A2I3HX97_PMAIP1-      ------------------------------tga-----------------
H2NWG2_PMAIP1-01        ------------------------------tgactgcatcaaaaacttgc
A0A2I3SX38_PMAIP1-      ------------------------------tgactgcatcaaaaacttgc
A0A2R9AKC9_PMAIP1-      ------------------------------tgactgcatcaaaaacttgc
Q13794_PMAIP1-02        ------------------------------tgactgcatcaaaaacttgc
A0A2I2YVQ5_PMAIP1-      ------------------------------tga-----------------
Q13794_PMAIP1-01        ------------------------------tga-----------------
A0A2R9AKC9_PMAIP1-      ------------------------------tga-----------------
A0A2I3SX38_PMAIP1-      ------------------------------tga-----------------
A0A2I2YVQ5_PMAIP1-      ------------------------------tgactgcatcaaaaacttgc
                                                                          

A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
A0A4W4H0G9_PMAIP1-      tgtag---------------------------------------------
A0A452J430_PMAIP1-      --------------------------------------------------
A0A674JUE0_PMAIP1-      --------------------------------------------------
A0A5F8ATY0_PMAIP1-      --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A7M4FB17_PMAIP1-      --------------------------------------------------
A0A670IXL8_PMAIP1-      --------------------------------------------------
A0A674HDV6_PMAIP1-      --------------------------------------------------
A0A663N909_PMAIP1-      --------------------------------------------------
A0A663FH84_PMAIP1-      --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A803YIP1_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
A0A669QIC6_PMAIP1-      --------------------------------------------------
A0A803TSK5_PMAIP1-      --------------------------------------------------
A0A5F9C629_PMAIP1-      --------------------------------------------------
A0A670ZS96_PMAIP1-      --------------------------------------------------
Q9JM54_PMAIP1-03        --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q9JM54_PMAIP1-02        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A4X1TQ35_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A671EYM5_PMAIP1-      --------------------------------------------------
A0A2Y9P485_PMAIP1-      --------------------------------------------------
A0A2Y9TJ73_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A452EST2_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A673UI19_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A667HYB7_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A452TE71_PMAIP1-      --------------------------------------------------
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
A0A452STA4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      atgaggggactccttcaaaagagttttctcaggaggcgcacatttcatca
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      ataaggggactccaaacgagaatttttctcaggaggtgcacgtttcatca
A0A2K6NC45_PMAIP1-      ataaggggactccaaacgagaatttttctcaggaggtgcacgtttcatca
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      atgaggggactccaaaagagaatttttctcaggaggtgcacatttcatca
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      ataaggggactccaaaagagactttttctcaggaggtgcacacttcatca
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      ataaggggactccaaaagagactttttctcaggaggtgcacacttcatca
A0A2K6BV43_PMAIP1-      ataaggggactccaaaagagactttttctcaggaggtgcacacttcatca
A0A2K5ZWH1_PMAIP1-      ataaggggactccaaaagagactttttctcaggaggtgcatacttcataa
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        atgaggggactccttcaaaagagttttctcaggaggtgcacatttcatca
A0A2I3SX38_PMAIP1-      atgaggggactccttcaaaagagttttctcaggaggtgcacgtttcatca
A0A2R9AKC9_PMAIP1-      atgaggggactccttcaaaagagttttctcaggaggtgcacgtttcatca
Q13794_PMAIP1-02        atgaggggactccttcaaaagagttttctcaggaggtgcacgtttcatca
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      atgaggggactccttcaaaagagttttctcaggaggtgcacatttcatca
                                                                          

A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
A0A4W4H0G9_PMAIP1-      --------------------------------------------------
A0A452J430_PMAIP1-      --------------------------------------------------
A0A674JUE0_PMAIP1-      --------------------------------------------------
A0A5F8ATY0_PMAIP1-      --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A7M4FB17_PMAIP1-      --------------------------------------------------
A0A670IXL8_PMAIP1-      --------------------------------------------------
A0A674HDV6_PMAIP1-      --------------------------------------------------
A0A663N909_PMAIP1-      --------------------------------------------------
A0A663FH84_PMAIP1-      --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A803YIP1_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
A0A669QIC6_PMAIP1-      --------------------------------------------------
A0A803TSK5_PMAIP1-      --------------------------------------------------
A0A5F9C629_PMAIP1-      --------------------------------------------------
A0A670ZS96_PMAIP1-      --------------------------------------------------
Q9JM54_PMAIP1-03        --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q9JM54_PMAIP1-02        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A4X1TQ35_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A671EYM5_PMAIP1-      --------------------------------------------------
A0A2Y9P485_PMAIP1-      --------------------------------------------------
A0A2Y9TJ73_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A4W2CDL0_PMAIP1-      --------------------------------------------------
A0A452EST2_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A673UI19_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A667HYB7_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A452TE71_PMAIP1-      --------------------------------------------------
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
A0A452STA4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      atttgaagaaagattgcattgtaat-------------------------
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      atttgaagaaagattgcattgtaattgg----------------------
A0A2K6NC45_PMAIP1-      atttgaagaaagattgcattgtaattgg----------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      atttgaagcaagattgcattgtaat-------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      atttgaagaaagattgcattgtaattgg----------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      atttgaagaaagattgcattgtaattgg----------------------
A0A2K6BV43_PMAIP1-      atttgaagaaagattgcattgtaattgg----------------------
A0A2K5ZWH1_PMAIP1-      atttgaagaaagattgcattgtaattgg----------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        atttgaagaaagactgcattgtcattgg----------------------
A0A2I3SX38_PMAIP1-      atttgaagaaagactgcattgtaattgg----------------------
A0A2R9AKC9_PMAIP1-      atttgaagaaagactgcattgtaattgg----------------------
Q13794_PMAIP1-02        atttgaagaaagactgcattgtaattga----------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      gtttgaagaaagactgcattgtaattgggaggaatgtgaaggtgcattca
                                                                          

A0A0P0HZF9_PMAIP1-      -----------------------------------------
Q0GKC8_PMAIP1-01        -----------------------------------------
A0A4W4H0G9_PMAIP1-      -----------------------------------------
A0A452J430_PMAIP1-      -----------------------------------------
A0A674JUE0_PMAIP1-      -----------------------------------------
A0A5F8ATY0_PMAIP1-      -----------------------------------------
A0A3B5RFA9_PMAIP1-      -----------------------------------------
A0A7M4FB17_PMAIP1-      -----------------------------------------
A0A670IXL8_PMAIP1-      -----------------------------------------
A0A674HDV6_PMAIP1-      -----------------------------------------
A0A663N909_PMAIP1-      -----------------------------------------
A0A663FH84_PMAIP1-      -----------------------------------------
A0A493SWX7_PMAIP1-      -----------------------------------------
A0A803YIP1_PMAIP1-      -----------------------------------------
A0A1D5PAR2_PMAIP1-      -----------------------------------------
A0A669QIC6_PMAIP1-      -----------------------------------------
A0A803TSK5_PMAIP1-      -----------------------------------------
A0A5F9C629_PMAIP1-      -----------------------------------------
A0A670ZS96_PMAIP1-      -----------------------------------------
Q9JM54_PMAIP1-03        -----------------------------------------
Q9JM54_PMAIP1-01        -----------------------------------------
Q9JM54_PMAIP1-02        -----------------------------------------
G3T0P7_PMAIP1-01        -----------------------------------------
A0A286XF37_PMAIP1-      -----------------------------------------
G1P8F9_PMAIP1-01        -----------------------------------------
Q9GL49_PMAIP1-01        -----------------------------------------
A0A4X1TQ35_PMAIP1-      -----------------------------------------
F1SMU1_PMAIP1-01        -----------------------------------------
A0A3Q2I0H2_PMAIP1-      -----------------------------------------
A0A671EYM5_PMAIP1-      -----------------------------------------
A0A2Y9P485_PMAIP1-      -----------------------------------------
A0A2Y9TJ73_PMAIP1-      -----------------------------------------
A0A4W2CDL0_PMAIP1-      -----------------------------------------
A0A3Q1NFP6_PMAIP1-      -----------------------------------------
A0A4W2CDL0_PMAIP1-      -----------------------------------------
A0A452EST2_PMAIP1-      -----------------------------------------
W5P738_PMAIP1-01        -----------------------------------------
A0A2K6EM90_PMAIP1-      -----------------------------------------
A0A673UI19_PMAIP1-      -----------------------------------------
A0A337SUX1_PMAIP1-      -----------------------------------------
A0A667HYB7_PMAIP1-      -----------------------------------------
G1LIZ7_PMAIP1-01        -----------------------------------------
A0A452TE71_PMAIP1-      -----------------------------------------
A0A7N5JEA5_PMAIP1-      -----------------------------------------
A0A452STA4_PMAIP1-      -----------------------------------------
A0A2I3HX97_PMAIP1-      -----------------------------------------
A0A2K5QQC6_PMAIP1-      -----------------------------------------
A0A2K5CFK7_PMAIP1-      -----------------------------------------
A0A2K6S6C4_PMAIP1-      -----------------------------------------
A0A2K6KJF1_PMAIP1-      -----------------------------------------
A0A2K6NC45_PMAIP1-      -----------------------------------------
A0A2K6KJF1_PMAIP1-      -----------------------------------------
A0A2K6NC45_PMAIP1-      -----------------------------------------
A0A2K5JY17_PMAIP1-      -----------------------------------------
A0A2K5JY17_PMAIP1-      -----------------------------------------
A0A2K5NJZ2_PMAIP1-      -----------------------------------------
A0A2K5NJZ2_PMAIP1-      -----------------------------------------
A0A2K6BV43_PMAIP1-      -----------------------------------------
A0A2K5VPX2_PMAIP1-      -----------------------------------------
A0A2K6BV43_PMAIP1-      -----------------------------------------
A0A2K5ZWH1_PMAIP1-      -----------------------------------------
A0A0D9S003_PMAIP1-      -----------------------------------------
A0A2K5ZWH1_PMAIP1-      -----------------------------------------
A0A2I3HX97_PMAIP1-      -----------------------------------------
H2NWG2_PMAIP1-01        -----------------------------------------
A0A2I3SX38_PMAIP1-      -----------------------------------------
A0A2R9AKC9_PMAIP1-      -----------------------------------------
Q13794_PMAIP1-02        -----------------------------------------
A0A2I2YVQ5_PMAIP1-      -----------------------------------------
Q13794_PMAIP1-01        -----------------------------------------
A0A2R9AKC9_PMAIP1-      -----------------------------------------
A0A2I3SX38_PMAIP1-      -----------------------------------------
A0A2I2YVQ5_PMAIP1-      tgggtgcccttggaaacggaagatggaatacatcaaagtga
                                                                 

© 1998-2022Legal notice