Dataset for CDS BMF of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

220 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A672RK14_BMF-01      --------------------------------------------------
A0A673JJ10_BMF-01      --------------------------------------------------
A0A3B4UNJ0_BMF-01      --------------------------------------------------
W5N4P7_BMF-01          --------------------------------------------------
A3KND0_BMF-01          --------------------------------------------------
Q0GKC7_BMF-01          --------------------------------------------------
A0A671M0H4_BMF-01      --------------------------------------------------
A0A671M0H4_BMF-02      --------------------------------------------------
A0A671MNR9_BMF-01      --------------------------------------------------
A0A672JWL9_BMF-01      --------------------------------------------------
A0A672JWL9_BMF-02      --------------------------------------------------
A0A673HDR4_BMF-01      --------------------------------------------------
A0A3B3RH63_BMF-01      --------------------------------------------------
K7FRX2_BMF-01          --------------------------------------------------
A0A452H3N6_BMF-01      --------------------------------------------------
A0A674IPL3_BMF-01      --------------------------------------------------
A0A493T7X1_BMF-01      --------------------------------------------------
A0A3Q2UCA0_BMF-01      --------------------------------------------------
A0A3Q2UCA0_BMF-02      --------------------------------------------------
A0A669PL85_BMF-02      --------------------------------------------------
A0A493T7X1_BMF-02      --------------------------------------------------
A0A3Q2UCA0_BMF-03      --------------------------------------------------
A0A3Q2UCA0_BMF-04      --------------------------------------------------
A9XRH0_BMF-01          --------------------------------------------------
G1NHG8_BMF-01          --------------------------------------------------
A0A669PL85_BMF-01      --------------------------------------------------
U3JS06_BMF-01          --------------------------------------------------
A0A674GIP8_BMF-03      --------------------------------------------------
A0A674GIP8_BMF-01      --------------------------------------------------
A0A674GIP8_BMF-02      --------------------------------------------------
A0A672V891_BMF-01      --------------------------------------------------
A0A663DZQ4_BMF-01      --------------------------------------------------
A0A663MPI8_BMF-01      --------------------------------------------------
A0A670XMZ5_BMF-01      --------------------------------------------------
H9GL49_BMF-01          --------------------------------------------------
A0A670JUU6_BMF-01      --------------------------------------------------
A0A670JUU6_BMF-05      --------------------------------------------------
A0A670JUU6_BMF-04      --------------------------------------------------
A0A670JUU6_BMF-02      --------------------------------------------------
A0A670JUU6_BMF-03      --------------------------------------------------
A0A4W3JXA1_BMF-01      --------------------------------------------------
A0A3Q2CXC4_BMF-01      --------------------------------------------------
A0A3Q2CXC4_BMF-02      --------------------------------------------------
A0A3B5QK08_BMF-01      --------------------------------------------------
A0A3B5QK08_BMF-02      --------------------------------------------------
A0A096LRV0_BMF-01      --------------------------------------------------
A0A3B3WU80_BMF-01      --------------------------------------------------
A0A3P9Q8E2_BMF-01      --------------------------------------------------
A0A3Q2PJX9_BMF-01      --------------------------------------------------
A0A3Q2PJX9_BMF-03      --------------------------------------------------
A0A3Q2PJX9_BMF-02      --------------------------------------------------
A0A3Q2YCX7_BMF-01      --------------------------------------------------
A0A3Q2YCX7_BMF-02      --------------------------------------------------
A0A3B5KWG6_BMF-02      --------------------------------------------------
A0A3B5KWG6_BMF-01      --------------------------------------------------
A0A3B5KWG6_BMF-03      --------------------------------------------------
A0A3B3CGR9_BMF-01      --------------------------------------------------
A0A3P9K487_BMF-01      --------------------------------------------------
A0A3P9K487_BMF-02      --------------------------------------------------
A0A3B3HAU1_BMF-01      --------------------------------------------------
A0A3B3HAU1_BMF-02      --------------------------------------------------
A0A3B3HAU1_BMF-03      --------------------------------------------------
A0A3B3HAU1_BMF-04      --------------------------------------------------
A0A3P9ICE1_BMF-04      --------------------------------------------------
A0A3P9ICE1_BMF-01      --------------------------------------------------
A0A3P9ICE1_BMF-02      --------------------------------------------------
A0A3P9ICE1_BMF-03      --------------------------------------------------
A0A3P9ICE1_BMF-05      --------------------------------------------------
A0A3P8NFE2_BMF-02      --------------------------------------------------
A0A668TQU8_BMF-01      --------------------------------------------------
I3K2D6_BMF-01          --------------------------------------------------
A0A3Q4G1I4_BMF-01      --------------------------------------------------
A0A3P8NFE2_BMF-01      --------------------------------------------------
A0A3P9DPJ5_BMF-01      --------------------------------------------------
A0A3P9DPJ5_BMF-02      --------------------------------------------------
A0A3B4ETH0_BMF-01      --------------------------------------------------
A0A3Q3C5V2_BMF-01      --------------------------------------------------
A0A672HG10_BMF-01      --------------------------------------------------
A0A3P8UA78_BMF-02      --------------------------------------------------
A0A3P8UA78_BMF-01      --------------------------------------------------
A0A3P8UA78_BMF-03      --------------------------------------------------
A0A3Q3GUU5_BMF-01      --------------------------------------------------
A0A3Q3VLX6_BMF-01      --------------------------------------------------
A0A3Q2ZA20_BMF-01      --------------------------------------------------
A0A667YNR9_BMF-01      --------------------------------------------------
A0A3Q3LME3_BMF-01      --------------------------------------------------
A0A3Q3LME3_BMF-02      --------------------------------------------------
A0A3Q3LME3_BMF-03      --------------------------------------------------
A0A3Q1IPR4_BMF-01      --------------------------------------------------
A0A3Q3QZ16_BMF-01      --------------------------------------------------
A0A3Q3QZ16_BMF-02      --------------------------------------------------
A0A665VG08_BMF-01      --------------------------------------------------
A0A673C8N3_BMF-01      --------------------------------------------------
A0A3Q1FVH7_BMF-01      --------------------------------------------------
A0A3Q1FVH7_BMF-02      --------------------------------------------------
A0A3B5B8F6_BMF-01      --------------------------------------------------
A0A3Q1D1K3_BMF-01      --------------------------------------------------
A0A3P8RKY9_BMF-01      --------------------------------------------------
A0A671X848_BMF-01      --------------------------------------------------
A0A0F8AD62_BMF-01      --------------------------------------------------
A0A4W6DUL1_BMF-01      --------------------------------------------------
A0A2U9CJH3_BMF-01      --------------------------------------------------
A0A3B4U5H8_BMF-01      --------------------------------------------------
A0A3B4WM88_BMF-01      --------------------------------------------------
A0A3P8ZIE7_BMF-01      --------------------------------------------------
A0A4W5N3A7_BMF-01      --------------------------------------------------
A0A6F9BGV6_BMF-01      --------------------------------------------------
A0A1S3SNN2_BMF-01      --------------------------------------------------
A0A674EF64_BMF-01      --------------------------------------------------
A0A1S3P5K4_BMF-01      --------------------------------------------------
A0A6F9B4C5_BMF-01      --------------------------------------------------
A0A4W5N721_BMF-01      --------------------------------------------------
A0A1S3P5K4_BMF-02      --------------------------------------------------
A0A673YQV3_BMF-01      --------------------------------------------------
A0A4W4DZH9_BMF-01      --------------------------------------------------
A0A3B4CNJ8_BMF-01      --------------------------------------------------
A0A3B1K1X5_BMF-01      --------------------------------------------------
A0A3B4B6Y3_BMF-01      --------------------------------------------------
A0A6I8NF73_BMF-01      --------------------------------------------------
A0A5F8GKJ8_BMF-01      --------------------------------------------------
G3WDQ2_BMF-01          --------------------------------------------------
A0A4X2KLG2_BMF-01      --------------------------------------------------
Q8K589_BMF-01          --------------------------------------------------
Q91ZE9_BMF-02          ------------------------atgtc---------------------
Q91ZE9_BMF-01          ------------------------atgcccggagcgggcgtattttggaa
Q91ZE9_BMF-06          --------------------------------------------------
A0A287CXH0_BMF-01      --------------------------------------------------
A0A287CXH0_BMF-02      --------------------------------------------------
A0A671DWL6_BMF-01      --------------------------------------------------
A0A671DWL6_BMF-02      --------------------------------------------------
A0A2K6FFN3_BMF-01      --------------------------------------------------
A0A2K6FFN3_BMF-02      --------------------------------------------------
A0A673TA87_BMF-01      --------------------------------------------------
L8IXF5_BMF-01          --------------------------------------------------
A0A4W2EII1_BMF-01      --------------------------------------------------
A0A4W2EII1_BMF-01      --------------------------------------------------
Q05KI3_BMF-01          --------------------------------------------------
Q05KI3_BMF-02          --------------------------------------------------
A0A4W2INA4_BMF-01      --------------------------------------------------
A0A4W2INA4_BMF-01      --------------------------------------------------
A0A452F2E0_BMF-01      --------------------------------------------------
A0A452F2E0_BMF-02      --------------------------------------------------
W5QFV1_BMF-01          --------------------------------------------------
H0WYH6_BMF-01          --------------------------------------------------
A0A337ST43_BMF-02      --------------------------------------------------
A0A337ST43_BMF-03      --------------------------------------------------
A0A337ST43_BMF-05      atgaccagaaccagcccgggtcagaagaaaaggccaaggtgggagtggct
A0A337ST43_BMF-01      --------------------------------------------------
A0A337ST43_BMF-04      atgaccagaaccagcccgggtcagaagaaaaggccaaggtgggagtggct
A0A667H967_BMF-01      --------------------------------------------------
M3YAD5_BMF-01          --------------------------------------------------
U6CSY8_BMF-01          --------------------------------------------------
A0A452SED0_BMF-01      --------------------------------------------------
A0A384D070_BMF-01      --------------------------------------------------
A0A5F4CJ04_BMF-04      --------------------------------------------------
A0A5F4CJ04_BMF-03      --------------------------------------------------
A0A5F4CJ04_BMF-01      --------------------------------------------------
A0A5F4CJ04_BMF-02      --------------------------------------------------
A0A4X1UQ42_BMF-01      --------------------------------------------------
A0A4X1UQ42_BMF-02      --------------------------------------------------
A0A287AIU8_BMF-01      --------------------------------------------------
A0A287AIU8_BMF-02      --------------------------------------------------
A0A3Q2HR24_BMF-01      --------------------------------------------------
A0A3Q2HR24_BMF-02      --------------------------------------------------
G1SR62_BMF-01          --------------------------------------------------
A0A286XXB0_BMF-03      --------------------------------------------------
A0A286XXB0_BMF-01      --------------------------------------------------
A0A286XXB0_BMF-02      --------------------------------------------------
A0A2K5KGP2_BMF-01      --------------------------------------------------
A0A0D9R4R5_BMF-01      --------------------------------------------------
A0A2K5VLE9_BMF-01      --------------------------------------------------
A0A2K5VLE9_BMF-02      --------------------------------------------------
A0A096NTE9_BMF-02      --------------------------------------------------
A0A096NTE9_BMF-01      --------------------------------------------------
A0A096NTE9_BMF-03      --------------------------------------------------
A0A5F7ZML1_BMF-01      --------------------------------------------------
A0A5F7ZML1_BMF-02      --------------------------------------------------
A0A5F7ZML1_BMF-03      --------------------------------------------------
A0A2K5MJW4_BMF-01      --------------------------------------------------
A0A2K6B5F6_BMF-03      --------------------------------------------------
A0A2K5Z4A9_BMF-02      --------------------------------------------------
A0A2K5MJW4_BMF-02      --------------------------------------------------
A0A2K6B5F6_BMF-01      --------------------------------------------------
A0A2K6B5F6_BMF-02      --------------------------------------------------
A0A2K6B5F6_BMF-04      --------------------------------------------------
A0A2K5Z4A9_BMF-01      --------------------------------------------------
A0A2K5KGP2_BMF-02      --------------------------------------------------
A0A2K6RAW1_BMF-02      --------------------------------------------------
A0A2K6RAW1_BMF-01      --------------------------------------------------
A0A2K6L919_BMF-01      --------------------------------------------------
A0A2K6L919_BMF-03      --------------------------------------------------
A0A2K6L919_BMF-02      --------------------------------------------------
A0A2U4BC98_BMF-01      --------------------------------------------------
G1PAU1_BMF-01          --------------------------------------------------
A0A2I3HD83_BMF-01      --------------------------------------------------
A0A2K6TW78_BMF-03      --------------------------------------------------
A0A2K6TW78_BMF-02      --------------------------------------------------
A0A2K6TW78_BMF-01      --------------------------------------------------
A0A2J8T301_BMF-01      --------------------------------------------------
G3T7Z4_BMF-01          ------------------------------atgccccgagcgggggtatt
A0A2K5RN49_BMF-02      --------------------------------------------------
A0A2K5RN49_BMF-01      --------------------------------------------------
F7HZL0_BMF-01          --------------------------------------------------
A0A2K5E1Q4_BMF-02      --------------------------------------------------
A0A2K5E1Q4_BMF-01      --------------------------------------------------
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          --------------------------------------------------
Q96LC9_BMF-02          --------------------------------------------------
Q96LC9_BMF-03          --------------------------------------------------
Q96LC9_BMF-04          --------------------------------------------------
A0A2J8QDD5_BMF-01      --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
Q96LC9_BMF-06          --------------------------------------------------
A0A2I2Z168_BMF-02      --------------------------------------------------
A0A2I2Z168_BMF-01      --------------------------------------------------
Q96LC9_BMF-08          --------------------------------------------------
A0A2R9BS98_BMF-01      --------------------------------------------------
A0A2J8QDD5_BMF-02      --------------------------------------------------
                                                                         

A0A672RK14_BMF-01      --------------------------------------------------
A0A673JJ10_BMF-01      --------------------------------------------------
A0A3B4UNJ0_BMF-01      --------------------------------------------------
W5N4P7_BMF-01          --------------------------------------------------
A3KND0_BMF-01          --------------------------------------------------
Q0GKC7_BMF-01          --------------------------------------------------
A0A671M0H4_BMF-01      --------------------------------------------------
A0A671M0H4_BMF-02      --------------------------------------------------
A0A671MNR9_BMF-01      --------------------------------------------------
A0A672JWL9_BMF-01      --------------------------------------------------
A0A672JWL9_BMF-02      --------------------------------------------------
A0A673HDR4_BMF-01      --------------------------------------------------
A0A3B3RH63_BMF-01      --------------------------------------------------
K7FRX2_BMF-01          --------------------------------------------------
A0A452H3N6_BMF-01      --------------------------------------------------
A0A674IPL3_BMF-01      --------------------------------------------------
A0A493T7X1_BMF-01      --------------------------------------------------
A0A3Q2UCA0_BMF-01      --------------------------------------------------
A0A3Q2UCA0_BMF-02      --------------------------------------------------
A0A669PL85_BMF-02      --------------------------------------------------
A0A493T7X1_BMF-02      --------------------------------------------------
A0A3Q2UCA0_BMF-03      --------------------------------------------------
A0A3Q2UCA0_BMF-04      --------------------------------------------------
A9XRH0_BMF-01          --------------------------------------------------
G1NHG8_BMF-01          --------------------------------------------------
A0A669PL85_BMF-01      --------------------------------------------------
U3JS06_BMF-01          --------------------------------------------------
A0A674GIP8_BMF-03      --------------------------------------------------
A0A674GIP8_BMF-01      --------------------------------------------------
A0A674GIP8_BMF-02      --------------------------------------------------
A0A672V891_BMF-01      --------------------------------------------------
A0A663DZQ4_BMF-01      --------------------------------------------------
A0A663MPI8_BMF-01      --------------------------------------------------
A0A670XMZ5_BMF-01      --------------------------------------------------
H9GL49_BMF-01          --------------------------------------------------
A0A670JUU6_BMF-01      --------------------------------------------------
A0A670JUU6_BMF-05      --------------------------------------------------
A0A670JUU6_BMF-04      --------------------------------------------------
A0A670JUU6_BMF-02      --------------------------------------------------
A0A670JUU6_BMF-03      --------------------------------------------------
A0A4W3JXA1_BMF-01      --------------------------------------------------
A0A3Q2CXC4_BMF-01      --------------------------------------------------
A0A3Q2CXC4_BMF-02      --------------------------------------------------
A0A3B5QK08_BMF-01      --------------------------------------------------
A0A3B5QK08_BMF-02      --------------------------------------------------
A0A096LRV0_BMF-01      --------------------------------------------------
A0A3B3WU80_BMF-01      --------------------------------------------------
A0A3P9Q8E2_BMF-01      --------------------------------------------------
A0A3Q2PJX9_BMF-01      --------------------------------------------------
A0A3Q2PJX9_BMF-03      --------------------------------------------------
A0A3Q2PJX9_BMF-02      --------------------------------------------------
A0A3Q2YCX7_BMF-01      --------------------------------------------------
A0A3Q2YCX7_BMF-02      --------------------------------------------------
A0A3B5KWG6_BMF-02      --------------------------------------------------
A0A3B5KWG6_BMF-01      --------------------------------------------------
A0A3B5KWG6_BMF-03      --------------------------------------------------
A0A3B3CGR9_BMF-01      --------------------------------------------------
A0A3P9K487_BMF-01      --------------------------------------------------
A0A3P9K487_BMF-02      --------------------------------------------------
A0A3B3HAU1_BMF-01      --------------------------------------------------
A0A3B3HAU1_BMF-02      --------------------------------------------------
A0A3B3HAU1_BMF-03      --------------------------------------------------
A0A3B3HAU1_BMF-04      --------------------------------------------------
A0A3P9ICE1_BMF-04      --------------------------------------------------
A0A3P9ICE1_BMF-01      --------------------------------------------------
A0A3P9ICE1_BMF-02      --------------------------------------------------
A0A3P9ICE1_BMF-03      --------------------------------------------------
A0A3P9ICE1_BMF-05      --------------------------------------------------
A0A3P8NFE2_BMF-02      --------------------------------------------------
A0A668TQU8_BMF-01      --------------------------------------------------
I3K2D6_BMF-01          --------------------------------------------------
A0A3Q4G1I4_BMF-01      --------------------------------------------------
A0A3P8NFE2_BMF-01      --------------------------------------------------
A0A3P9DPJ5_BMF-01      --------------------------------------------------
A0A3P9DPJ5_BMF-02      --------------------------------------------------
A0A3B4ETH0_BMF-01      --------------------------------------------------
A0A3Q3C5V2_BMF-01      --------------------------------------------------
A0A672HG10_BMF-01      --------------------------------------------------
A0A3P8UA78_BMF-02      --------------------------------------------------
A0A3P8UA78_BMF-01      --------------------------------------------------
A0A3P8UA78_BMF-03      --------------------------------------------------
A0A3Q3GUU5_BMF-01      --------------------------------------------------
A0A3Q3VLX6_BMF-01      --------------------------------------------------
A0A3Q2ZA20_BMF-01      --------------------------------------------------
A0A667YNR9_BMF-01      --------------------------------------------------
A0A3Q3LME3_BMF-01      --------------------------------------------------
A0A3Q3LME3_BMF-02      --------------------------------------------------
A0A3Q3LME3_BMF-03      --------------------------------------------------
A0A3Q1IPR4_BMF-01      --------------------------------------------------
A0A3Q3QZ16_BMF-01      --------------------------------------------------
A0A3Q3QZ16_BMF-02      --------------------------------------------------
A0A665VG08_BMF-01      --------------------------------------------------
A0A673C8N3_BMF-01      --------------------------------------------------
A0A3Q1FVH7_BMF-01      --------------------------------------------------
A0A3Q1FVH7_BMF-02      --------------------------------------------------
A0A3B5B8F6_BMF-01      --------------------------------------------------
A0A3Q1D1K3_BMF-01      --------------------------------------------------
A0A3P8RKY9_BMF-01      --------------------------------------------------
A0A671X848_BMF-01      --------------------------------------------------
A0A0F8AD62_BMF-01      --------------------------------------------------
A0A4W6DUL1_BMF-01      --------------------------------------------------
A0A2U9CJH3_BMF-01      --------------------------------------------------
A0A3B4U5H8_BMF-01      --------------------------------------------------
A0A3B4WM88_BMF-01      --------------------------------------------------
A0A3P8ZIE7_BMF-01      --------------------------------------------------
A0A4W5N3A7_BMF-01      --------------------------------------------------
A0A6F9BGV6_BMF-01      --------------------------------------------------
A0A1S3SNN2_BMF-01      --------------------------------------------------
A0A674EF64_BMF-01      --------------------------------------------------
A0A1S3P5K4_BMF-01      --------------------------------------------------
A0A6F9B4C5_BMF-01      --------------------------------------------------
A0A4W5N721_BMF-01      --------------------------------------------------
A0A1S3P5K4_BMF-02      --------------------------------------------------
A0A673YQV3_BMF-01      --------------------------------------------------
A0A4W4DZH9_BMF-01      --------------------------------------------------
A0A3B4CNJ8_BMF-01      --------------------------------------------------
A0A3B1K1X5_BMF-01      --------------------------------------------------
A0A3B4B6Y3_BMF-01      --------------------------------------------------
A0A6I8NF73_BMF-01      --------------------------------------------------
A0A5F8GKJ8_BMF-01      --------------------------------------------------
G3WDQ2_BMF-01          --------------------------------------------------
A0A4X2KLG2_BMF-01      --------------------------------------------------
Q8K589_BMF-01          --------------------------------------------------
Q91ZE9_BMF-02          --------------------------------------------------
Q91ZE9_BMF-01          acaataccgcgcggtgtgccgtggcctcctcccgcgccagctcgcgcctg
Q91ZE9_BMF-06          --------------------------------------------------
A0A287CXH0_BMF-01      ----------atgccccgagcgggcgtattttggaaacaataccgcgcgg
A0A287CXH0_BMF-02      ---------------------------gtttt------------------
A0A671DWL6_BMF-01      --------------------------------------------------
A0A671DWL6_BMF-02      --------------------------------------------------
A0A2K6FFN3_BMF-01      --------------------------------------------------
A0A2K6FFN3_BMF-02      --------------------------------------------------
A0A673TA87_BMF-01      --------------------------------------------------
L8IXF5_BMF-01          --------------------------------------------------
A0A4W2EII1_BMF-01      --------------------------------------------------
A0A4W2EII1_BMF-01      --------------------------------------------------
Q05KI3_BMF-01          --------------------------------------------------
Q05KI3_BMF-02          --------------------------------------------------
A0A4W2INA4_BMF-01      --------------------------------------------------
A0A4W2INA4_BMF-01      --------------------------------------------------
A0A452F2E0_BMF-01      --------------------------------------------------
A0A452F2E0_BMF-02      --------------------------------------------------
W5QFV1_BMF-01          --------------------------------------------------
H0WYH6_BMF-01          --------------------------------------------------
A0A337ST43_BMF-02      --------------------------------------------------
A0A337ST43_BMF-03      --------------------------------------------------
A0A337ST43_BMF-05      ctgggaaggcccagggaggaggtgtggagcctccttgagcagtgaggcag
A0A337ST43_BMF-01      --------------------------------------------------
A0A337ST43_BMF-04      ctgggaaggcccagggaggaggtgtggagcctccttgagcagtgaggcag
A0A667H967_BMF-01      --------------------------------------------------
M3YAD5_BMF-01          --------------------------------------------------
U6CSY8_BMF-01          --------------------------------------------------
A0A452SED0_BMF-01      --------------------------------------------------
A0A384D070_BMF-01      --------------------------------------------------
A0A5F4CJ04_BMF-04      --------------------------------------------------
A0A5F4CJ04_BMF-03      --------------------------------------------------
A0A5F4CJ04_BMF-01      --------------------------------------------------
A0A5F4CJ04_BMF-02      --------------------------------------------------
A0A4X1UQ42_BMF-01      --------------------------------------------------
A0A4X1UQ42_BMF-02      --------------------------------------------------
A0A287AIU8_BMF-01      --------------------------------------------------
A0A287AIU8_BMF-02      --------------------------------------------------
A0A3Q2HR24_BMF-01      --------------------------------------------------
A0A3Q2HR24_BMF-02      --------------------------------------------------
G1SR62_BMF-01          --------------------------------------------------
A0A286XXB0_BMF-03      --------------------------------------------------
A0A286XXB0_BMF-01      --------------------------------------------------
A0A286XXB0_BMF-02      --------------------------------------------------
A0A2K5KGP2_BMF-01      --------------------------------------------------
A0A0D9R4R5_BMF-01      --------------------------------------------------
A0A2K5VLE9_BMF-01      --------------------------------------------------
A0A2K5VLE9_BMF-02      --------------------------------------------------
A0A096NTE9_BMF-02      --------------------------------------------------
A0A096NTE9_BMF-01      --------------------------------------------------
A0A096NTE9_BMF-03      --------------------------------------------------
A0A5F7ZML1_BMF-01      --------------------------------------------------
A0A5F7ZML1_BMF-02      --------------------------------------------------
A0A5F7ZML1_BMF-03      --------------------------------------------------
A0A2K5MJW4_BMF-01      --------------------------------------------------
A0A2K6B5F6_BMF-03      --------------------------------------------------
A0A2K5Z4A9_BMF-02      --------------------------------------------------
A0A2K5MJW4_BMF-02      --------------------------------------------------
A0A2K6B5F6_BMF-01      --------------------------------------------------
A0A2K6B5F6_BMF-02      --------------------------------------------------
A0A2K6B5F6_BMF-04      --------------------------------------------------
A0A2K5Z4A9_BMF-01      --------------------------------------------------
A0A2K5KGP2_BMF-02      --------------------------------------------------
A0A2K6RAW1_BMF-02      --------------------------------------------------
A0A2K6RAW1_BMF-01      --------------------------------------------------
A0A2K6L919_BMF-01      --------------------------------------------------
A0A2K6L919_BMF-03      --------------------------------------------------
A0A2K6L919_BMF-02      --------------------------------------------------
A0A2U4BC98_BMF-01      --------------------------------------------------
G1PAU1_BMF-01          --------------------------------------------------
A0A2I3HD83_BMF-01      --------------------------------------------------
A0A2K6TW78_BMF-03      --------------------------------------------------
A0A2K6TW78_BMF-02      --------------------------------------------------
A0A2K6TW78_BMF-01      --------------------------------------------------
A0A2J8T301_BMF-01      --------------------------------------------------
G3T7Z4_BMF-01          ttggaaacaataccgcacggtgttgagtctcgtccaccagcgcccgccag
A0A2K5RN49_BMF-02      --------------------------------------------------
A0A2K5RN49_BMF-01      --------------------------------------------------
F7HZL0_BMF-01          --------------------------------------------------
A0A2K5E1Q4_BMF-02      --------------------------------------------------
A0A2K5E1Q4_BMF-01      --------------------------------------------------
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          --------------------------------------------------
Q96LC9_BMF-02          --------------------------------------------------
Q96LC9_BMF-03          --------------------------------------------------
Q96LC9_BMF-04          --------------------------------------------------
A0A2J8QDD5_BMF-01      --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
Q96LC9_BMF-06          --------------------------------------------------
A0A2I2Z168_BMF-02      --------------------------------------------------
A0A2I2Z168_BMF-01      --------------------------------------------------
Q96LC9_BMF-08          --------------------------------------------------
A0A2R9BS98_BMF-01      --------------------------------------------------
A0A2J8QDD5_BMF-02      --------------------------------------------------
                                                                         

A0A672RK14_BMF-01      --------------------------------------------------
A0A673JJ10_BMF-01      --------------------------------------------------
A0A3B4UNJ0_BMF-01      --------------------------------------------------
W5N4P7_BMF-01          --------------------------------------------------
A3KND0_BMF-01          --------------------------------------------------
Q0GKC7_BMF-01          --------------------------------------------------
A0A671M0H4_BMF-01      --------------------------------------------------
A0A671M0H4_BMF-02      --------------------------------------------------
A0A671MNR9_BMF-01      --------------------------------------------------
A0A672JWL9_BMF-01      --------------------------------------------------
A0A672JWL9_BMF-02      --------------------------------------------------
A0A673HDR4_BMF-01      --------------------------------------------------
A0A3B3RH63_BMF-01      --------------------------------------------------
K7FRX2_BMF-01          --------------------------------------------------
A0A452H3N6_BMF-01      --------------------------------------------------
A0A674IPL3_BMF-01      --------------------------------------------------
A0A493T7X1_BMF-01      --------------------------------------------------
A0A3Q2UCA0_BMF-01      --------------------------------------------------
A0A3Q2UCA0_BMF-02      --------------------------------------------------
A0A669PL85_BMF-02      --------------------------------------------------
A0A493T7X1_BMF-02      --------------------------------------------------
A0A3Q2UCA0_BMF-03      --------------------------------------------------
A0A3Q2UCA0_BMF-04      --------------------------------------------------
A9XRH0_BMF-01          --------------------------------------------------
G1NHG8_BMF-01          --------------------------------------------------
A0A669PL85_BMF-01      --------------------------------------------------
U3JS06_BMF-01          --------------------------------------------------
A0A674GIP8_BMF-03      --------------------------------------------------
A0A674GIP8_BMF-01      --------------------------------------------------
A0A674GIP8_BMF-02      --------------------------------------------------
A0A672V891_BMF-01      --------------------------------------------------
A0A663DZQ4_BMF-01      --------------------------------------------------
A0A663MPI8_BMF-01      --------------------------------------------------
A0A670XMZ5_BMF-01      --------------------------------------------------
H9GL49_BMF-01          --------------------------------------------------
A0A670JUU6_BMF-01      --------------------------------------------------
A0A670JUU6_BMF-05      --------------------------------------------------
A0A670JUU6_BMF-04      --------------------------------------------------
A0A670JUU6_BMF-02      --------------------------------------------------
A0A670JUU6_BMF-03      --------------------------------------------------
A0A4W3JXA1_BMF-01      --------------------------------------------------
A0A3Q2CXC4_BMF-01      --------------------------------------------------
A0A3Q2CXC4_BMF-02      --------------------------------------------------
A0A3B5QK08_BMF-01      --------------------------------------------------
A0A3B5QK08_BMF-02      --------------------------------------------------
A0A096LRV0_BMF-01      --------------------------------------------------
A0A3B3WU80_BMF-01      --------------------------------------------------
A0A3P9Q8E2_BMF-01      --------------------------------------------------
A0A3Q2PJX9_BMF-01      --------------------------------------------------
A0A3Q2PJX9_BMF-03      --------------------------------------------------
A0A3Q2PJX9_BMF-02      --------------------------------------------------
A0A3Q2YCX7_BMF-01      --------------------------------------------------
A0A3Q2YCX7_BMF-02      --------------------------------------------------
A0A3B5KWG6_BMF-02      --------------------------------------------------
A0A3B5KWG6_BMF-01      --------------------------------------------------
A0A3B5KWG6_BMF-03      --------------------------------------------------
A0A3B3CGR9_BMF-01      --------------------------------------------------
A0A3P9K487_BMF-01      --------------------------------------------------
A0A3P9K487_BMF-02      --------------------------------------------------
A0A3B3HAU1_BMF-01      --------------------------------------------------
A0A3B3HAU1_BMF-02      --------------------------------------------------
A0A3B3HAU1_BMF-03      --------------------------------------------------
A0A3B3HAU1_BMF-04      --------------------------------------------------
A0A3P9ICE1_BMF-04      --------------------------------------------------
A0A3P9ICE1_BMF-01      --------------------------------------------------
A0A3P9ICE1_BMF-02      --------------------------------------------------
A0A3P9ICE1_BMF-03      --------------------------------------------------
A0A3P9ICE1_BMF-05      --------------------------------------------------
A0A3P8NFE2_BMF-02      --------------------------------------------------
A0A668TQU8_BMF-01      --------------------------------------------------
I3K2D6_BMF-01          --------------------------------------------------
A0A3Q4G1I4_BMF-01      --------------------------------------------------
A0A3P8NFE2_BMF-01      --------------------------------------------------
A0A3P9DPJ5_BMF-01      --------------------------------------------------
A0A3P9DPJ5_BMF-02      --------------------------------------------------
A0A3B4ETH0_BMF-01      --------------------------------------------------
A0A3Q3C5V2_BMF-01      --------------------------------------------------
A0A672HG10_BMF-01      --------------------------------------------------
A0A3P8UA78_BMF-02      --------------------------------------------------
A0A3P8UA78_BMF-01      --------------------------------------------------
A0A3P8UA78_BMF-03      --------------------------------------------------
A0A3Q3GUU5_BMF-01      --------------------------------------------------
A0A3Q3VLX6_BMF-01      --------------------------------------------------
A0A3Q2ZA20_BMF-01      --------------------------------------------------
A0A667YNR9_BMF-01      --------------------------------------------------
A0A3Q3LME3_BMF-01      --------------------------------------------------
A0A3Q3LME3_BMF-02      --------------------------------------------------
A0A3Q3LME3_BMF-03      --------------------------------------------------
A0A3Q1IPR4_BMF-01      --------------------------------------------------
A0A3Q3QZ16_BMF-01      --------------------------------------------------
A0A3Q3QZ16_BMF-02      --------------------------------------------------
A0A665VG08_BMF-01      --------------------------------------------------
A0A673C8N3_BMF-01      --------------------------------------------------
A0A3Q1FVH7_BMF-01      --------------------------------------------------
A0A3Q1FVH7_BMF-02      --------------------------------------------------
A0A3B5B8F6_BMF-01      --------------------------------------------------
A0A3Q1D1K3_BMF-01      --------------------------------------------------
A0A3P8RKY9_BMF-01      --------------------------------------------------
A0A671X848_BMF-01      --------------------------------------------------
A0A0F8AD62_BMF-01      --------------------------------------------------
A0A4W6DUL1_BMF-01      --------------------------------------------------
A0A2U9CJH3_BMF-01      --------------------------------------------------
A0A3B4U5H8_BMF-01      --------------------------------------------------
A0A3B4WM88_BMF-01      --------------------------------------------------
A0A3P8ZIE7_BMF-01      --------------------------------------------------
A0A4W5N3A7_BMF-01      --------------------------------------------------
A0A6F9BGV6_BMF-01      --------------------------------------------------
A0A1S3SNN2_BMF-01      --------------------------------------------------
A0A674EF64_BMF-01      --------------------------------------------------
A0A1S3P5K4_BMF-01      --------------------------------------------------
A0A6F9B4C5_BMF-01      --------------------------------------------------
A0A4W5N721_BMF-01      --------------------------------------------------
A0A1S3P5K4_BMF-02      --------------------------------------------------
A0A673YQV3_BMF-01      --------------------------------------------------
A0A4W4DZH9_BMF-01      --------------------------------------------------
A0A3B4CNJ8_BMF-01      --------------------------------------------------
A0A3B1K1X5_BMF-01      --------------------------------------------------
A0A3B4B6Y3_BMF-01      --------------------------------------------------
A0A6I8NF73_BMF-01      --------------------------------------------------
A0A5F8GKJ8_BMF-01      --------------------------------------------------
G3WDQ2_BMF-01          --------------------------------------------------
A0A4X2KLG2_BMF-01      --------------------------------------------------
Q8K589_BMF-01          --------------------------------------------------
Q91ZE9_BMF-02          --------------------------------------------------
Q91ZE9_BMF-01          cagcagtcgctgccgcagcccgcgccaccgcctcccaccgcagcccgctg
Q91ZE9_BMF-06          --------------------------------------------------
A0A287CXH0_BMF-01      tgcgcagtggcctcctccggcgcccgccagagtccgcagccgccgccggc
A0A287CXH0_BMF-02      --------------------------------------------------
A0A671DWL6_BMF-01      --------------------------------------------------
A0A671DWL6_BMF-02      --------------------------------------------------
A0A2K6FFN3_BMF-01      --------------------------------------------------
A0A2K6FFN3_BMF-02      --------------------------------------------------
A0A673TA87_BMF-01      --------------------------------------------------
L8IXF5_BMF-01          --------------------------------------------------
A0A4W2EII1_BMF-01      --------------------------------------------------
A0A4W2EII1_BMF-01      --------------------------------------------------
Q05KI3_BMF-01          --------------------------------------------------
Q05KI3_BMF-02          --------------------------------------------------
A0A4W2INA4_BMF-01      --------------------------------------------------
A0A4W2INA4_BMF-01      --------------------------------------------------
A0A452F2E0_BMF-01      --------------------------------------------------
A0A452F2E0_BMF-02      --------------------------------------------------
W5QFV1_BMF-01          --------------------------------------------------
H0WYH6_BMF-01          --------------------------------------------------
A0A337ST43_BMF-02      --------------------------------------------------
A0A337ST43_BMF-03      --------------------------------------------------
A0A337ST43_BMF-05      gccacatttggggagggtgtcatcctcagtggtactttatcaccaggtcg
A0A337ST43_BMF-01      --------------------------------------------------
A0A337ST43_BMF-04      gccacatttggggagggtgtcatcctcagtggtactttatcaccaggtcg
A0A667H967_BMF-01      --------------------------------------------------
M3YAD5_BMF-01          --------------------------------------------------
U6CSY8_BMF-01          --------------------------------------------------
A0A452SED0_BMF-01      --------------------------------------------------
A0A384D070_BMF-01      --------------------------------------------------
A0A5F4CJ04_BMF-04      --------------------------------------------------
A0A5F4CJ04_BMF-03      --------------------------------------------------
A0A5F4CJ04_BMF-01      --------------------------------------------------
A0A5F4CJ04_BMF-02      --------------------------------------------------
A0A4X1UQ42_BMF-01      --------------------------------------------------
A0A4X1UQ42_BMF-02      --------------------------------------------------
A0A287AIU8_BMF-01      --------------------------------------------------
A0A287AIU8_BMF-02      --------------------------------------------------
A0A3Q2HR24_BMF-01      --------------------------------------------------
A0A3Q2HR24_BMF-02      --------------------------------------------------
G1SR62_BMF-01          --------------------------------------------------
A0A286XXB0_BMF-03      --------------------------------------------------
A0A286XXB0_BMF-01      --------------------------------------------------
A0A286XXB0_BMF-02      --------------------------atgcccggggcgggcgtattttgg
A0A2K5KGP2_BMF-01      --------------------------------------------------
A0A0D9R4R5_BMF-01      --------------------------------------------------
A0A2K5VLE9_BMF-01      --------------------------------------------------
A0A2K5VLE9_BMF-02      --------------------------------------------------
A0A096NTE9_BMF-02      --------------------------------------------------
A0A096NTE9_BMF-01      --------------------------------------------------
A0A096NTE9_BMF-03      --------------------------------------------------
A0A5F7ZML1_BMF-01      --------------------------------------------------
A0A5F7ZML1_BMF-02      --------------------------------------------------
A0A5F7ZML1_BMF-03      --------------------------------------------------
A0A2K5MJW4_BMF-01      --------------------------------------------------
A0A2K6B5F6_BMF-03      --------------------------------------------------
A0A2K5Z4A9_BMF-02      --------------------------------------------------
A0A2K5MJW4_BMF-02      --------------------------------------------------
A0A2K6B5F6_BMF-01      --------------------------------------------------
A0A2K6B5F6_BMF-02      --------------------------------------------------
A0A2K6B5F6_BMF-04      --------------------------------------------------
A0A2K5Z4A9_BMF-01      --------------------------------------------------
A0A2K5KGP2_BMF-02      --------------------------------------------------
A0A2K6RAW1_BMF-02      --------------------------------------------------
A0A2K6RAW1_BMF-01      --------------------------------------------------
A0A2K6L919_BMF-01      --------------------------------------------------
A0A2K6L919_BMF-03      --------------------------------------------------
A0A2K6L919_BMF-02      --------------------------------------------------
A0A2U4BC98_BMF-01      --------------------------------------------------
G1PAU1_BMF-01          --------------------------------------------------
A0A2I3HD83_BMF-01      --------------------------------------------------
A0A2K6TW78_BMF-03      --------------------------------------------------
A0A2K6TW78_BMF-02      --------------------------------------------------
A0A2K6TW78_BMF-01      --------------------------------------------------
A0A2J8T301_BMF-01      --------------------------------------------------
G3T7Z4_BMF-01          cgcttgctgccgccgccgtccgttcgccgcgcctgccgccgctgcccgct
A0A2K5RN49_BMF-02      --------------------------------------------------
A0A2K5RN49_BMF-01      --------------------------------------------------
F7HZL0_BMF-01          --------------------------------------------------
A0A2K5E1Q4_BMF-02      --------------------------------------------------
A0A2K5E1Q4_BMF-01      --------------------------------------------------
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          --------------------------------------------------
Q96LC9_BMF-02          --------------------------------------------------
Q96LC9_BMF-03          --------------------------------------------------
Q96LC9_BMF-04          --------------------------------------------------
A0A2J8QDD5_BMF-01      --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
Q96LC9_BMF-06          --------------------------------------------------
A0A2I2Z168_BMF-02      --------------------------------------------------
A0A2I2Z168_BMF-01      --------------------------------------------------
Q96LC9_BMF-08          --------------------------------------------------
A0A2R9BS98_BMF-01      --------------------------------------------------
A0A2J8QDD5_BMF-02      --------------------------------------------------
                                                                         

A0A672RK14_BMF-01      --------------------------------------------------
A0A673JJ10_BMF-01      --------------------------------------------------
A0A3B4UNJ0_BMF-01      --------------------------------------------------
W5N4P7_BMF-01          --------------------------------------------------
A3KND0_BMF-01          --------------------------------------------------
Q0GKC7_BMF-01          --------------------------------------------------
A0A671M0H4_BMF-01      --------------------------------------------------
A0A671M0H4_BMF-02      --------------------------------------------------
A0A671MNR9_BMF-01      --------------------------------------------------
A0A672JWL9_BMF-01      --------------------------------------------------
A0A672JWL9_BMF-02      --------------------------------------------------
A0A673HDR4_BMF-01      --------------------------------------------------
A0A3B3RH63_BMF-01      --------------------------------------------------
K7FRX2_BMF-01          --------------------------------------------------
A0A452H3N6_BMF-01      --------------------------------------------------
A0A674IPL3_BMF-01      --------------------------------------------------
A0A493T7X1_BMF-01      --------------------------------------------------
A0A3Q2UCA0_BMF-01      --------------------------------------------------
A0A3Q2UCA0_BMF-02      --------------------------------------------------
A0A669PL85_BMF-02      --------------------------------------------------
A0A493T7X1_BMF-02      --------------------------------------------------
A0A3Q2UCA0_BMF-03      --------------------------------------------------
A0A3Q2UCA0_BMF-04      --------------------------------------------------
A9XRH0_BMF-01          --------------------------------------------------
G1NHG8_BMF-01          --------------------------------------------------
A0A669PL85_BMF-01      --------------------------------------------------
U3JS06_BMF-01          --------------------------------------------------
A0A674GIP8_BMF-03      --------------------------------------------------
A0A674GIP8_BMF-01      --------------------------------------------------
A0A674GIP8_BMF-02      --------------------------------------------------
A0A672V891_BMF-01      --------------------------------------------------
A0A663DZQ4_BMF-01      --------------------------------------------------
A0A663MPI8_BMF-01      --------------------------------------------------
A0A670XMZ5_BMF-01      --------------------------------------------------
H9GL49_BMF-01          --------------------------------------------------
A0A670JUU6_BMF-01      --------------------------------------------------
A0A670JUU6_BMF-05      --------------------------------------------------
A0A670JUU6_BMF-04      --------------------------------------------------
A0A670JUU6_BMF-02      --------------------------------------------------
A0A670JUU6_BMF-03      --------------------------------------------------
A0A4W3JXA1_BMF-01      --------------------------------------------------
A0A3Q2CXC4_BMF-01      --------------------------------------------------
A0A3Q2CXC4_BMF-02      --------------------------------------------------
A0A3B5QK08_BMF-01      --------------------------------------------------
A0A3B5QK08_BMF-02      --------------------------------------------------
A0A096LRV0_BMF-01      --------------------------------------------------
A0A3B3WU80_BMF-01      --------------------------------------------------
A0A3P9Q8E2_BMF-01      --------------------------------------------------
A0A3Q2PJX9_BMF-01      --------------------------------------------------
A0A3Q2PJX9_BMF-03      --------------------------------------------------
A0A3Q2PJX9_BMF-02      --------------------------------------------------
A0A3Q2YCX7_BMF-01      --------------------------------------------------
A0A3Q2YCX7_BMF-02      --------------------------------------------------
A0A3B5KWG6_BMF-02      --------------------------------------------------
A0A3B5KWG6_BMF-01      --------------------------------------------------
A0A3B5KWG6_BMF-03      --------------------------------------------------
A0A3B3CGR9_BMF-01      --------------------------------------------------
A0A3P9K487_BMF-01      --------------------------------------------------
A0A3P9K487_BMF-02      --------------------------------------------------
A0A3B3HAU1_BMF-01      --------------------------------------------------
A0A3B3HAU1_BMF-02      --------------------------------------------------
A0A3B3HAU1_BMF-03      --------------------------------------------------
A0A3B3HAU1_BMF-04      --------------------------------------------------
A0A3P9ICE1_BMF-04      --------------------------------------------------
A0A3P9ICE1_BMF-01      --------------------------------------------------
A0A3P9ICE1_BMF-02      --------------------------------------------------
A0A3P9ICE1_BMF-03      --------------------------------------------------
A0A3P9ICE1_BMF-05      --------------------------------------------------
A0A3P8NFE2_BMF-02      --------------------------------------------------
A0A668TQU8_BMF-01      --------------------------------------------------
I3K2D6_BMF-01          --------------------------------------------------
A0A3Q4G1I4_BMF-01      --------------------------------------------------
A0A3P8NFE2_BMF-01      --------------------------------------------------
A0A3P9DPJ5_BMF-01      --------------------------------------------------
A0A3P9DPJ5_BMF-02      --------------------------------------------------
A0A3B4ETH0_BMF-01      --------------------------------------------------
A0A3Q3C5V2_BMF-01      --------------------------------------------------
A0A672HG10_BMF-01      --------------------------------------------------
A0A3P8UA78_BMF-02      --------------------------------------------------
A0A3P8UA78_BMF-01      --------------------------------------------------
A0A3P8UA78_BMF-03      --------------------------------------------------
A0A3Q3GUU5_BMF-01      --------------------------------------------------
A0A3Q3VLX6_BMF-01      --------------------------------------------------
A0A3Q2ZA20_BMF-01      --------------------------------------------------
A0A667YNR9_BMF-01      --------------------------------------------------
A0A3Q3LME3_BMF-01      --------------------------------------------------
A0A3Q3LME3_BMF-02      --------------------------------------------------
A0A3Q3LME3_BMF-03      --------------------------------------------------
A0A3Q1IPR4_BMF-01      --------------------------------------------------
A0A3Q3QZ16_BMF-01      --------------------------------------------------
A0A3Q3QZ16_BMF-02      --------------------------------------------------
A0A665VG08_BMF-01      --------------------------------------------------
A0A673C8N3_BMF-01      --------------------------------------------------
A0A3Q1FVH7_BMF-01      --------------------------------------------------
A0A3Q1FVH7_BMF-02      --------------------------------------------------
A0A3B5B8F6_BMF-01      --------------------------------------------------
A0A3Q1D1K3_BMF-01      --------------------------------------------------
A0A3P8RKY9_BMF-01      --------------------------------------------------
A0A671X848_BMF-01      --------------------------------------------------
A0A0F8AD62_BMF-01      --------------------------------------------------
A0A4W6DUL1_BMF-01      --------------------------------------------------
A0A2U9CJH3_BMF-01      --------------------------------------------------
A0A3B4U5H8_BMF-01      --------------------------------------------------
A0A3B4WM88_BMF-01      --------------------------------------------------
A0A3P8ZIE7_BMF-01      --------------------------------------------------
A0A4W5N3A7_BMF-01      --------------------------------------------------
A0A6F9BGV6_BMF-01      --------------------------------------------------
A0A1S3SNN2_BMF-01      --------------------------------------------------
A0A674EF64_BMF-01      --------------------------------------------------
A0A1S3P5K4_BMF-01      --------------------------------------------------
A0A6F9B4C5_BMF-01      --------------------------------------------------
A0A4W5N721_BMF-01      --------------------------------------------------
A0A1S3P5K4_BMF-02      --------------------------------------------------
A0A673YQV3_BMF-01      --------------------------------------------------
A0A4W4DZH9_BMF-01      --------------------------------------------------
A0A3B4CNJ8_BMF-01      --------------------------------------------------
A0A3B1K1X5_BMF-01      --------------------------------------------------
A0A3B4B6Y3_BMF-01      --------------------------------------------------
A0A6I8NF73_BMF-01      --------------------------------------------------
A0A5F8GKJ8_BMF-01      --------------------------------------------------
G3WDQ2_BMF-01          --------------------------------------------------
A0A4X2KLG2_BMF-01      --------------------------------------------------
Q8K589_BMF-01          --------------------------------------------------
Q91ZE9_BMF-02          --------------------------------------------------
Q91ZE9_BMF-01          gagtttgcccccttcttcccaatcgagtgtgggcaccaagccccccgagt
Q91ZE9_BMF-06          --------------------------------------------------
A0A287CXH0_BMF-01      cctgccagcggctcccgcctccctgggagcggagtctcgctcccccaagt
A0A287CXH0_BMF-02      --------------------------------------------------
A0A671DWL6_BMF-01      --------------------------------------------------
A0A671DWL6_BMF-02      --------------------------------------------------
A0A2K6FFN3_BMF-01      --------------------------------------------------
A0A2K6FFN3_BMF-02      --------------------------------------------------
A0A673TA87_BMF-01      ------------------------tgtttccaagggaaggttcgtacatt
L8IXF5_BMF-01          --------------------------------------------------
A0A4W2EII1_BMF-01      --------------------------------------------------
A0A4W2EII1_BMF-01      --------------------------------------------------
Q05KI3_BMF-01          --------------------------------------------------
Q05KI3_BMF-02          --------------------------------------------------
A0A4W2INA4_BMF-01      --------------------------------------------------
A0A4W2INA4_BMF-01      --------------------------------------------------
A0A452F2E0_BMF-01      --------------------------------------------------
A0A452F2E0_BMF-02      --------------------------------------------------
W5QFV1_BMF-01          --------------------------------------------------
H0WYH6_BMF-01          --------------------------------------------------
A0A337ST43_BMF-02      --------------------------------------------------
A0A337ST43_BMF-03      --------------------------------------------------
A0A337ST43_BMF-05      tttgtcatcagtgtcgggccccacttcccccaggtagaagggaaaggaga
A0A337ST43_BMF-01      --------------------------------------------------
A0A337ST43_BMF-04      tttgtcatcagtgtcgggccccacttcccccaggtagaagggaaaggaga
A0A667H967_BMF-01      --------------------------------------------------
M3YAD5_BMF-01          --------------------------------------------------
U6CSY8_BMF-01          --------------------------------------------------
A0A452SED0_BMF-01      --------------------------------------------------
A0A384D070_BMF-01      --------------------------------------------------
A0A5F4CJ04_BMF-04      ------------------------------atgggggcccgagaagggtt
A0A5F4CJ04_BMF-03      --------------------------------------------------
A0A5F4CJ04_BMF-01      --------------------------------------------------
A0A5F4CJ04_BMF-02      --------------------------------------------------
A0A4X1UQ42_BMF-01      --------------------------------------------------
A0A4X1UQ42_BMF-02      --------------------------------------------------
A0A287AIU8_BMF-01      --------------------------------------------------
A0A287AIU8_BMF-02      --------------------------------------------------
A0A3Q2HR24_BMF-01      --------------------------------------------------
A0A3Q2HR24_BMF-02      --------------------------------------------------
G1SR62_BMF-01          --------------------------------------------------
A0A286XXB0_BMF-03      --------------------------------------------------
A0A286XXB0_BMF-01      --------------------------------------------------
A0A286XXB0_BMF-02      aaacaataccgcgcgcgccgccgccgccgcggacccgaccccccccgagt
A0A2K5KGP2_BMF-01      --------------------------------------------------
A0A0D9R4R5_BMF-01      --------------------------------------------------
A0A2K5VLE9_BMF-01      --------------------------------------------------
A0A2K5VLE9_BMF-02      --------------------------------------------------
A0A096NTE9_BMF-02      --------------------------------------------------
A0A096NTE9_BMF-01      --------------------------------------------------
A0A096NTE9_BMF-03      --------------------------------------------------
A0A5F7ZML1_BMF-01      --------------------------------------------------
A0A5F7ZML1_BMF-02      --------------------------------------------------
A0A5F7ZML1_BMF-03      --------------------------------------------------
A0A2K5MJW4_BMF-01      --------------------------------------------------
A0A2K6B5F6_BMF-03      --------------------------------------------------
A0A2K5Z4A9_BMF-02      --------------------------------------------------
A0A2K5MJW4_BMF-02      --------------------------------------------------
A0A2K6B5F6_BMF-01      --------------------------------------------------
A0A2K6B5F6_BMF-02      --------------------------------------------------
A0A2K6B5F6_BMF-04      --------------------------------------------------
A0A2K5Z4A9_BMF-01      --------------------------------------------------
A0A2K5KGP2_BMF-02      --------------------------------------------------
A0A2K6RAW1_BMF-02      --------------------------------------------------
A0A2K6RAW1_BMF-01      --------------------------------------------------
A0A2K6L919_BMF-01      --------------------------------------------------
A0A2K6L919_BMF-03      --------------------------------------------------
A0A2K6L919_BMF-02      --------------------------------------------------
A0A2U4BC98_BMF-01      --------------------------------------------------
G1PAU1_BMF-01          --------------------------------------------------
A0A2I3HD83_BMF-01      --------------------------------------------------
A0A2K6TW78_BMF-03      --------------------------------------------------
A0A2K6TW78_BMF-02      --------------------------------------------------
A0A2K6TW78_BMF-01      --------------------------------------------------
A0A2J8T301_BMF-01      --------------------------------------------------
G3T7Z4_BMF-01          gagctttttccctccttcccaatcgaatctgggcgccaagccccccgagt
A0A2K5RN49_BMF-02      --------------------------------------------------
A0A2K5RN49_BMF-01      --------------------------------------------------
F7HZL0_BMF-01          --------------------------------------------------
A0A2K5E1Q4_BMF-02      --------------------------------------------------
A0A2K5E1Q4_BMF-01      --------------------------------------------------
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          --------------------------------------------------
Q96LC9_BMF-02          --------------------------------------------------
Q96LC9_BMF-03          --------------------------------------------------
Q96LC9_BMF-04          --------------------------------------------------
A0A2J8QDD5_BMF-01      --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
Q96LC9_BMF-06          --------------------------------------------------
A0A2I2Z168_BMF-02      --------------------------------------------------
A0A2I2Z168_BMF-01      --------------------------------------------------
Q96LC9_BMF-08          --------------------------------------------------
A0A2R9BS98_BMF-01      --------------------------------------------------
A0A2J8QDD5_BMF-02      --------------------------------------------------
                                                                         

A0A672RK14_BMF-01      --------------------------------------------------
A0A673JJ10_BMF-01      --------------------------------------------------
A0A3B4UNJ0_BMF-01      --------------------------------------------------
W5N4P7_BMF-01          --------------------------------------------------
A3KND0_BMF-01          --------------------------------------------------
Q0GKC7_BMF-01          --------------------------------------------------
A0A671M0H4_BMF-01      --------------------------------------------------
A0A671M0H4_BMF-02      --------------------------------------------------
A0A671MNR9_BMF-01      --------------------------------------------------
A0A672JWL9_BMF-01      --------------------------------------------------
A0A672JWL9_BMF-02      --------------------------------------------------
A0A673HDR4_BMF-01      --------------------------------------------------
A0A3B3RH63_BMF-01      --------------------------------------------------
K7FRX2_BMF-01          --------------------------------------------------
A0A452H3N6_BMF-01      --------------------------------------------------
A0A674IPL3_BMF-01      --------------------------------------------------
A0A493T7X1_BMF-01      --------------------------------------------------
A0A3Q2UCA0_BMF-01      --------------------------------------------------
A0A3Q2UCA0_BMF-02      --------------------------------------------------
A0A669PL85_BMF-02      --------------------------------------------------
A0A493T7X1_BMF-02      --------------------------------------------------
A0A3Q2UCA0_BMF-03      --------------------------------------------------
A0A3Q2UCA0_BMF-04      --------------------------------------------------
A9XRH0_BMF-01          --------------------------------------------------
G1NHG8_BMF-01          --------------------------------------------------
A0A669PL85_BMF-01      --------------------------------------------------
U3JS06_BMF-01          --------------------------------------------------
A0A674GIP8_BMF-03      --------------------------------------------------
A0A674GIP8_BMF-01      --------------------------------------------------
A0A674GIP8_BMF-02      --------------------------------------------------
A0A672V891_BMF-01      --------------------------------------------------
A0A663DZQ4_BMF-01      --------------------------------------------------
A0A663MPI8_BMF-01      ----------------------------atgttattgtcgtgtcttagct
A0A670XMZ5_BMF-01      --------------------------------------------------
H9GL49_BMF-01          --------------------------------------------------
A0A670JUU6_BMF-01      ----------------------atgaattcctatatagaagtcacattaa
A0A670JUU6_BMF-05      --------------------------------------------------
A0A670JUU6_BMF-04      ----------------------atgaattcctatatagaagtcacattaa
A0A670JUU6_BMF-02      --------------------------------------------------
A0A670JUU6_BMF-03      --------------------------------------------------
A0A4W3JXA1_BMF-01      --------------------------------------------------
A0A3Q2CXC4_BMF-01      --------------------------------------------------
A0A3Q2CXC4_BMF-02      --------------------------------------------------
A0A3B5QK08_BMF-01      --------------------------------------------------
A0A3B5QK08_BMF-02      --------------------------------------------------
A0A096LRV0_BMF-01      --------------------------------------------------
A0A3B3WU80_BMF-01      --------------------------------------------------
A0A3P9Q8E2_BMF-01      --------------------------------------------------
A0A3Q2PJX9_BMF-01      --------------------------------------------------
A0A3Q2PJX9_BMF-03      --------------------------------------------------
A0A3Q2PJX9_BMF-02      --------------------------------------------------
A0A3Q2YCX7_BMF-01      --------------------------------------------------
A0A3Q2YCX7_BMF-02      --------------------------------------------------
A0A3B5KWG6_BMF-02      --------------------------------------------------
A0A3B5KWG6_BMF-01      --------------------------------------------------
A0A3B5KWG6_BMF-03      --------------------------------------------------
A0A3B3CGR9_BMF-01      --------------------------------------------------
A0A3P9K487_BMF-01      --------------------------------------------------
A0A3P9K487_BMF-02      --------------------------------------------------
A0A3B3HAU1_BMF-01      --------------------------------------------------
A0A3B3HAU1_BMF-02      --------------------------------------------------
A0A3B3HAU1_BMF-03      --------------------------------------------------
A0A3B3HAU1_BMF-04      --------------------------------------------------
A0A3P9ICE1_BMF-04      --------------------------------------------------
A0A3P9ICE1_BMF-01      -------------------------------atgtgtctatcgggcatat
A0A3P9ICE1_BMF-02      --------------------------------------------------
A0A3P9ICE1_BMF-03      --------------------------------------------------
A0A3P9ICE1_BMF-05      --------------------------------------------------
A0A3P8NFE2_BMF-02      --------------------------------------------------
A0A668TQU8_BMF-01      --------------------------------------------------
I3K2D6_BMF-01          --------------------------------------------------
A0A3Q4G1I4_BMF-01      --------------------------------------------------
A0A3P8NFE2_BMF-01      --------------------------------------------------
A0A3P9DPJ5_BMF-01      --------------------------------------------------
A0A3P9DPJ5_BMF-02      --------------------------------------------------
A0A3B4ETH0_BMF-01      --------------------------------------------------
A0A3Q3C5V2_BMF-01      --------------------------------------------------
A0A672HG10_BMF-01      --------------------------------------------------
A0A3P8UA78_BMF-02      --------------------------------------------------
A0A3P8UA78_BMF-01      --------------------------------------------------
A0A3P8UA78_BMF-03      --------------------------------------------------
A0A3Q3GUU5_BMF-01      --------------------------------------------------
A0A3Q3VLX6_BMF-01      --------------------------------------------------
A0A3Q2ZA20_BMF-01      --------------------------------------------------
A0A667YNR9_BMF-01      --------------------------------------------------
A0A3Q3LME3_BMF-01      --------------------------------------------------
A0A3Q3LME3_BMF-02      --------------------------------------------------
A0A3Q3LME3_BMF-03      --------------------------------------------------
A0A3Q1IPR4_BMF-01      --------------------------------------------------
A0A3Q3QZ16_BMF-01      --------------------------------------------------
A0A3Q3QZ16_BMF-02      --------------------------------------------------
A0A665VG08_BMF-01      --------------------------------------------------
A0A673C8N3_BMF-01      --------------------------------------------------
A0A3Q1FVH7_BMF-01      --------------------------------------------------
A0A3Q1FVH7_BMF-02      --------------------------------------------------
A0A3B5B8F6_BMF-01      --------------------------------------------------
A0A3Q1D1K3_BMF-01      --------------------------------------------------
A0A3P8RKY9_BMF-01      --------------------------------------------------
A0A671X848_BMF-01      --------------------------------------------------
A0A0F8AD62_BMF-01      --------------------------------------------------
A0A4W6DUL1_BMF-01      --------------------------------------------------
A0A2U9CJH3_BMF-01      --------------------------------------------------
A0A3B4U5H8_BMF-01      --------------------------------------------------
A0A3B4WM88_BMF-01      --------------------------------------------------
A0A3P8ZIE7_BMF-01      --------------------------------------------------
A0A4W5N3A7_BMF-01      --------------------------------------------------
A0A6F9BGV6_BMF-01      -------------------------atgcagggtcaccctctgccccagc
A0A1S3SNN2_BMF-01      --------------------------------------------------
A0A674EF64_BMF-01      --------------------------------------------------
A0A1S3P5K4_BMF-01      --------------------------------------------------
A0A6F9B4C5_BMF-01      ----------------------------------atgtttagaatccaca
A0A4W5N721_BMF-01      --------------------------------------------------
A0A1S3P5K4_BMF-02      --------------------------------------------------
A0A673YQV3_BMF-01      --------------------------------------------------
A0A4W4DZH9_BMF-01      --------------------------------------------------
A0A3B4CNJ8_BMF-01      --------------------------------------------------
A0A3B1K1X5_BMF-01      --------------------------------------------------
A0A3B4B6Y3_BMF-01      --------------------------------------------------
A0A6I8NF73_BMF-01      ----------------------atgaagtggccttggccaggacggagat
A0A5F8GKJ8_BMF-01      --------------------------------------------------
G3WDQ2_BMF-01          --------------------------------------------------
A0A4X2KLG2_BMF-01      --------------------------------------------------
Q8K589_BMF-01          --------------------------------------------------
Q91ZE9_BMF-02          --------------------------------------------------
Q91ZE9_BMF-01          gttcttcaccctggaccctggcgcagagccctggcatcacaactcggagg
Q91ZE9_BMF-06          --------------------------------------------------
A0A287CXH0_BMF-01      gttcatcacgctggaccctggcgcagagccctggcatcacgactcggagg
A0A287CXH0_BMF-02      --------------------------------------------------
A0A671DWL6_BMF-01      --------------------------------------------------
A0A671DWL6_BMF-02      --------------------------------------------------
A0A2K6FFN3_BMF-01      --------------------------------------------------
A0A2K6FFN3_BMF-02      --------------------------------------------------
A0A673TA87_BMF-01      cgtgaccgtccctggcagtcgcccagcccgggacttggggctccactctc
L8IXF5_BMF-01          --------------------------------------------------
A0A4W2EII1_BMF-01      --------------------------------------------------
A0A4W2EII1_BMF-01      --------------------------------------------------
Q05KI3_BMF-01          --------------------------------------------------
Q05KI3_BMF-02          --------------------------------------------------
A0A4W2INA4_BMF-01      --------------------------------------------------
A0A4W2INA4_BMF-01      --------------------------------------------------
A0A452F2E0_BMF-01      --------------------------------------------------
A0A452F2E0_BMF-02      --------------------------------------------------
W5QFV1_BMF-01          --------------------------------------------------
H0WYH6_BMF-01          --------------------------------------------------
A0A337ST43_BMF-02      --------------------------------------------------
A0A337ST43_BMF-03      --------------------------------------------------
A0A337ST43_BMF-05      aaggaaagggggagtccttcaggttcggccttcgggcaggggacagcacc
A0A337ST43_BMF-01      --------------------------------------------------
A0A337ST43_BMF-04      aaggaaagggggagtccttcaggttcggccttcgggcaggggacagcacc
A0A667H967_BMF-01      --------------------------------------------------
M3YAD5_BMF-01          --------------------------------------------------
U6CSY8_BMF-01          --------------------------------------------------
A0A452SED0_BMF-01      --------------------------------------------------
A0A384D070_BMF-01      --------------------------------------------------
A0A5F4CJ04_BMF-04      gggctgcgggcgtgtggggggaccatggaggactggagcgccggggtgcg
A0A5F4CJ04_BMF-03      --------------------------------------------------
A0A5F4CJ04_BMF-01      --------------------------------------------------
A0A5F4CJ04_BMF-02      --------------------------------------------------
A0A4X1UQ42_BMF-01      --------------------------------------------------
A0A4X1UQ42_BMF-02      --------------------------------------------------
A0A287AIU8_BMF-01      --------------------------------------------------
A0A287AIU8_BMF-02      --------------------------------------------------
A0A3Q2HR24_BMF-01      --------------------------------------------------
A0A3Q2HR24_BMF-02      --------------------------------------------------
G1SR62_BMF-01          --------------------------------------------------
A0A286XXB0_BMF-03      --------------------------------------------------
A0A286XXB0_BMF-01      --------------------------------------------------
A0A286XXB0_BMF-02      gttcgtcacgctggaccctggcacagagccctggcaccacgactcggagg
A0A2K5KGP2_BMF-01      --------------------------------------------------
A0A0D9R4R5_BMF-01      --------------------------------------------------
A0A2K5VLE9_BMF-01      --------------------------------------------------
A0A2K5VLE9_BMF-02      --------------------------------------------------
A0A096NTE9_BMF-02      --------------------------------------------------
A0A096NTE9_BMF-01      --------------------------------------------------
A0A096NTE9_BMF-03      --------------------------------------------------
A0A5F7ZML1_BMF-01      --------------------------------------------------
A0A5F7ZML1_BMF-02      --------------------------------------------------
A0A5F7ZML1_BMF-03      --------------------------------------------------
A0A2K5MJW4_BMF-01      --------------------------------------------------
A0A2K6B5F6_BMF-03      --------------------------------------------------
A0A2K5Z4A9_BMF-02      --------------------------------------------------
A0A2K5MJW4_BMF-02      --------------------------------------------------
A0A2K6B5F6_BMF-01      --------------------------------------------------
A0A2K6B5F6_BMF-02      --------------------------------------------------
A0A2K6B5F6_BMF-04      --------------------------------------------------
A0A2K5Z4A9_BMF-01      --------------------------------------------------
A0A2K5KGP2_BMF-02      --------------------------------------------------
A0A2K6RAW1_BMF-02      --------------------------------------------------
A0A2K6RAW1_BMF-01      --------------------------------------------------
A0A2K6L919_BMF-01      --------------------------------------------------
A0A2K6L919_BMF-03      --------------------------------------------------
A0A2K6L919_BMF-02      --------------------------------------------------
A0A2U4BC98_BMF-01      --------------------------------------------------
G1PAU1_BMF-01          --------------------------------------------------
A0A2I3HD83_BMF-01      --------------------------------------------------
A0A2K6TW78_BMF-03      --------------------------------------------------
A0A2K6TW78_BMF-02      --------------------------------------------------
A0A2K6TW78_BMF-01      --------------------------------------------------
A0A2J8T301_BMF-01      --------------------------------------------------
G3T7Z4_BMF-01          gctcgtcacgctggaccctggcgcggagccctggcgtcacgacccggaga
A0A2K5RN49_BMF-02      --------------------------------------------------
A0A2K5RN49_BMF-01      --------------------------------------------------
F7HZL0_BMF-01          --------------------------------------------------
A0A2K5E1Q4_BMF-02      --------------------------------------------------
A0A2K5E1Q4_BMF-01      --------------------------------------------------
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          --------------------------------------------------
Q96LC9_BMF-02          --------------------------------------------------
Q96LC9_BMF-03          --------------------------------------------------
Q96LC9_BMF-04          --------------------------------------------------
A0A2J8QDD5_BMF-01      --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
Q96LC9_BMF-06          --------------------------------------------------
A0A2I2Z168_BMF-02      --------------------------------------------------
A0A2I2Z168_BMF-01      --------------------------------------------------
Q96LC9_BMF-08          --------------------------------------------------
A0A2R9BS98_BMF-01      --------------------------------------------------
A0A2J8QDD5_BMF-02      --------------------------------------------------
                                                                         

A0A672RK14_BMF-01      --------------------------------atggat------------
A0A673JJ10_BMF-01      --------------------------------atggat------------
A0A3B4UNJ0_BMF-01      --------------------------------atggat------------
W5N4P7_BMF-01          --------------------------------atggaa------------
A3KND0_BMF-01          --------------------------------atggat------------
Q0GKC7_BMF-01          --------------------------------atggat------------
A0A671M0H4_BMF-01      --------------------------------atggat------------
A0A671M0H4_BMF-02      --------------------------------atggat------------
A0A671MNR9_BMF-01      --------------------------------atggat------------
A0A672JWL9_BMF-01      --------------------------------atggat------------
A0A672JWL9_BMF-02      --------------------------------atggat------------
A0A673HDR4_BMF-01      --------------------------------atggat------------
A0A3B3RH63_BMF-01      --------------------------------atggac------------
K7FRX2_BMF-01          --------------------------------atggatccccccagctac
A0A452H3N6_BMF-01      --------------------------------atggatccccccaactac
A0A674IPL3_BMF-01      --------------------------------atggatccccccagctac
A0A493T7X1_BMF-01      --------------------------------atggatcgccccagctac
A0A3Q2UCA0_BMF-01      --------------------------------atggatcgccccagctac
A0A3Q2UCA0_BMF-02      --------------------------------atggatcgccccagctac
A0A669PL85_BMF-02      --------------------------------atggatcgccccagctac
A0A493T7X1_BMF-02      --------------------------------atggatcgccccagctac
A0A3Q2UCA0_BMF-03      --------------------------------atggatcgccccagctac
A0A3Q2UCA0_BMF-04      --------------------------------atggatcgccccagctac
A9XRH0_BMF-01          --------------------------------atggatcgccccagctac
G1NHG8_BMF-01          --------------------------------atggatcgccccagctac
A0A669PL85_BMF-01      --------------------------------atggatcgccccagctac
U3JS06_BMF-01          --------------------------------atggatcgccccagctac
A0A674GIP8_BMF-03      --------------------------------atggatcgccccagctac
A0A674GIP8_BMF-01      --------------------------------atggatcgccccagctac
A0A674GIP8_BMF-02      --------------------------------atggatcgccccagctac
A0A672V891_BMF-01      --------------------------------atggatcgccccagctac
A0A663DZQ4_BMF-01      --------------------------------atggatcgccccagctac
A0A663MPI8_BMF-01      gtttcctcaaatgtccctttattgcaggagcaatggatcgccccagctac
A0A670XMZ5_BMF-01      --------------------------------atggatcctcctgtttac
H9GL49_BMF-01          --------------------------------atggatcctcccggctac
A0A670JUU6_BMF-01      cctcagtgggaatggacttatttccaggtgaaatggattcccctgactac
A0A670JUU6_BMF-05      --------------------------------atggattcccctgactac
A0A670JUU6_BMF-04      cctcagtgggaatggacttatttccaggtgaaatggattcccctgactac
A0A670JUU6_BMF-02      --------------------------------atggattcccctgactac
A0A670JUU6_BMF-03      --------------------------------atggattcccctgactac
A0A4W3JXA1_BMF-01      --------------------------------atggatctgtctgacact
A0A3Q2CXC4_BMF-01      --------------------------------atggag------------
A0A3Q2CXC4_BMF-02      --------------------------------atggag------------
A0A3B5QK08_BMF-01      --------------------------------atggag------------
A0A3B5QK08_BMF-02      --------------------------------atggag------------
A0A096LRV0_BMF-01      --------------------------------atggag------------
A0A3B3WU80_BMF-01      --------------------------------atggag------------
A0A3P9Q8E2_BMF-01      --------------------------------atggag------------
A0A3Q2PJX9_BMF-01      --------------------------------atggag------------
A0A3Q2PJX9_BMF-03      --------------------------------atggag------------
A0A3Q2PJX9_BMF-02      --------------------------------atggag------------
A0A3Q2YCX7_BMF-01      --------------------------------atggag------------
A0A3Q2YCX7_BMF-02      --------------------------------atggag------------
A0A3B5KWG6_BMF-02      --------------------------------atggac------------
A0A3B5KWG6_BMF-01      --------------------------------atggac------------
A0A3B5KWG6_BMF-03      --------------------------------atggac------------
A0A3B3CGR9_BMF-01      --------------------------------atggac------------
A0A3P9K487_BMF-01      --------------------------------atggac------------
A0A3P9K487_BMF-02      --------------------------------atggac------------
A0A3B3HAU1_BMF-01      --------------------------------atggac------------
A0A3B3HAU1_BMF-02      --------------------------------atggac------------
A0A3B3HAU1_BMF-03      --------------------------------atggac------------
A0A3B3HAU1_BMF-04      --------------------------------atggac------------
A0A3P9ICE1_BMF-04      --------------------------------atggac------------
A0A3P9ICE1_BMF-01      caggtcactcgtcttacagtgcccccccccgtatggac------------
A0A3P9ICE1_BMF-02      --------------------------------atggac------------
A0A3P9ICE1_BMF-03      --------------------------------atggac------------
A0A3P9ICE1_BMF-05      --------------------------------atggac------------
A0A3P8NFE2_BMF-02      --------------------------------atggac------------
A0A668TQU8_BMF-01      --------------------------------atggac------------
I3K2D6_BMF-01          --------------------------------atggac------------
A0A3Q4G1I4_BMF-01      --------------------------------atggac------------
A0A3P8NFE2_BMF-01      --------------------------------atggac------------
A0A3P9DPJ5_BMF-01      --------------------------------atggac------------
A0A3P9DPJ5_BMF-02      --------------------------------atggac------------
A0A3B4ETH0_BMF-01      --------------------------------atggac------------
A0A3Q3C5V2_BMF-01      --------------------------------atggac------------
A0A672HG10_BMF-01      --------------------------------atggac------------
A0A3P8UA78_BMF-02      --------------------------------atggat------------
A0A3P8UA78_BMF-01      --------------------------------atggat------------
A0A3P8UA78_BMF-03      --------------------------------atggat------------
A0A3Q3GUU5_BMF-01      --------------------------------atggac------------
A0A3Q3VLX6_BMF-01      --------------------------------atggac------------
A0A3Q2ZA20_BMF-01      --------------------------------atggac------------
A0A667YNR9_BMF-01      --------------------------------atggac------------
A0A3Q3LME3_BMF-01      --------------------------------atggac------------
A0A3Q3LME3_BMF-02      --------------------------------atggac------------
A0A3Q3LME3_BMF-03      --------------------------------atggac------------
A0A3Q1IPR4_BMF-01      --------------------------------atggac------------
A0A3Q3QZ16_BMF-01      --------------------------------atggac------------
A0A3Q3QZ16_BMF-02      --------------------------------atggac------------
A0A665VG08_BMF-01      --------------------------------atggat------------
A0A673C8N3_BMF-01      --------------------------------atggag------------
A0A3Q1FVH7_BMF-01      --------------------------------atggac------------
A0A3Q1FVH7_BMF-02      --------------------------------atggac------------
A0A3B5B8F6_BMF-01      --------------------------------atggac------------
A0A3Q1D1K3_BMF-01      --------------------------------atggac------------
A0A3P8RKY9_BMF-01      --------------------------------atggac------------
A0A671X848_BMF-01      --------------------------------atggac------------
A0A0F8AD62_BMF-01      --------------------------------atggac------------
A0A4W6DUL1_BMF-01      --------------------------------atggac------------
A0A2U9CJH3_BMF-01      --------------------------------atggac------------
A0A3B4U5H8_BMF-01      --------------------------------atggac------------
A0A3B4WM88_BMF-01      --------------------------------atggac------------
A0A3P8ZIE7_BMF-01      --------------------------------atggag------------
A0A4W5N3A7_BMF-01      --------------------------------atggat------------
A0A6F9BGV6_BMF-01      tgtccaagcaggacttagcagatttctgccgtatggat------------
A0A1S3SNN2_BMF-01      --------------------------------atggat------------
A0A674EF64_BMF-01      --------------------------------atggat------------
A0A1S3P5K4_BMF-01      --------------------------------atggac------------
A0A6F9B4C5_BMF-01      ttgatttgaaggtcttggcagatcgccgccgtatggac------------
A0A4W5N721_BMF-01      --------------------------------atggac------------
A0A1S3P5K4_BMF-02      --------------------------------atggac------------
A0A673YQV3_BMF-01      --------------------------------atggac------------
A0A4W4DZH9_BMF-01      --------------------------------atggat------------
A0A3B4CNJ8_BMF-01      --------------------------------atggat------------
A0A3B1K1X5_BMF-01      --------------------------------atggac------------
A0A3B4B6Y3_BMF-01      --------------------------------atggag------------
A0A6I8NF73_BMF-01      acggatgcgcccgctctctctccgcaggcaggatggagttgtcccag-ta
A0A5F8GKJ8_BMF-01      --------------------------------atggagcctcctcac-ta
G3WDQ2_BMF-01          --------------------------------atggagtctcctcat-ta
A0A4X2KLG2_BMF-01      --------------------------------atggagcctcctcat-ta
Q8K589_BMF-01          --------------------------------atggagccacctcag-tg
Q91ZE9_BMF-02          ----------------------cccaggagagatggagccacctcag-tg
Q91ZE9_BMF-01          ctgagacgctgtcctggagtcacccaggagagatggagccacctcag-tg
Q91ZE9_BMF-06          --------------------------------atggagccacctcag-tg
A0A287CXH0_BMF-01      ccgagactctctcctggagtcacccaggtgagatggagccgcctcag-tg
A0A287CXH0_BMF-02      ----------------------cccagaggagatggagccgcctcag-tg
A0A671DWL6_BMF-01      --------------------------------atggagccgcctcag-tg
A0A671DWL6_BMF-02      -----atgccttattatgccctaacaggggagatggagccgcctcag-tg
A0A2K6FFN3_BMF-01      --------------------------------atggagccatcccac-tg
A0A2K6FFN3_BMF-02      --------------------------------atggagccatcccac-tg
A0A673TA87_BMF-01      cattggccggccgtgggcgtgacgcgcgggaggcggggcctcatcagctg
L8IXF5_BMF-01          --------------------------------atggagccaccccag-tg
A0A4W2EII1_BMF-01      --------------------------------atggagccaccccag-tg
A0A4W2EII1_BMF-01      --------------------------------atggagccaccccag-tg
Q05KI3_BMF-01          --------------------------------atggagccaccccag-tg
Q05KI3_BMF-02          --------------------------------atggagccaccccag-tg
A0A4W2INA4_BMF-01      --------------------------------atggagccaccccag-tg
A0A4W2INA4_BMF-01      --------------------------------atggagccaccccag-tg
A0A452F2E0_BMF-01      --------------------------------atggagccaccccag-tg
A0A452F2E0_BMF-02      --------------------------------atggagccaccccag-tg
W5QFV1_BMF-01          --------------------ctcacaggggagatggagccaccccag-tg
H0WYH6_BMF-01          --------------------------------atggagccatcgcag-tg
A0A337ST43_BMF-02      --------------------------------atggagccgcctcag-tg
A0A337ST43_BMF-03      --------------------------------atggagccgcctcag-tg
A0A337ST43_BMF-05      ccagatgcctgcattgcaccccagcaggggagatggagccgcctcag-tg
A0A337ST43_BMF-01      --------------------------------atggagccgcctcag-tg
A0A337ST43_BMF-04      ccagatgcctgcattgcaccccagcaggggagatggagccgcctcag-tg
A0A667H967_BMF-01      --------------------------------atggagccgcctcag-tg
M3YAD5_BMF-01          --------------------------------atggagccgcctcag-tg
U6CSY8_BMF-01          --------------------------------atggagccgcctcag-tg
A0A452SED0_BMF-01      --------------------------------atggagccgcctcag-tg
A0A384D070_BMF-01      --------------------------------atggagccgcctcag-tg
A0A5F4CJ04_BMF-04      ggaacgcggtgcaggacccttatctaggggagatggagccgcctcag-tg
A0A5F4CJ04_BMF-03      --------------------------------atggagccgcctcag-tg
A0A5F4CJ04_BMF-01      --------------------------------atggagccgcctcag-tg
A0A5F4CJ04_BMF-02      --------------------------------atggagccgcctcag-tg
A0A4X1UQ42_BMF-01      --------------------------------atggagccacctcag-tg
A0A4X1UQ42_BMF-02      --------------------------------atggagccacctcag-tg
A0A287AIU8_BMF-01      --------------------------------atggagccacctcag-tg
A0A287AIU8_BMF-02      --------------------------------atggagccacctcag-tg
A0A3Q2HR24_BMF-01      --------------------------------atggagccgcctcag-tg
A0A3Q2HR24_BMF-02      --------------------------------atggagccgcctcag-tg
G1SR62_BMF-01          --------------------------------atggagccacctcag-tg
A0A286XXB0_BMF-03      -----------------gttttcccaagggagatggagccacctcag-tg
A0A286XXB0_BMF-01      --------------------------------atggagccacctcag-tg
A0A286XXB0_BMF-02      ccgattctctctcctggagtcacccaggggagatggagccacctcag-tg
A0A2K5KGP2_BMF-01      --------------------------------atggagccatctcgg-tg
A0A0D9R4R5_BMF-01      --------------------------------atggagccatctcgg-tg
A0A2K5VLE9_BMF-01      --------------------------------atggagccatctcgg-tg
A0A2K5VLE9_BMF-02      --------------------------------atggagccatctcgg-tg
A0A096NTE9_BMF-02      --------------------------------atggagccatctcgg-tg
A0A096NTE9_BMF-01      --------------------------------atggagccatctcgg-tg
A0A096NTE9_BMF-03      --------------------------------atggagccatctcgg-tg
A0A5F7ZML1_BMF-01      --------------------------------atggagccatctcgg-tg
A0A5F7ZML1_BMF-02      --------------------------------atggagccatctcgg-tg
A0A5F7ZML1_BMF-03      --------------------------------atggagccatctcgg-tg
A0A2K5MJW4_BMF-01      --------------------------------atggagccatctcgg-tg
A0A2K6B5F6_BMF-03      --------------------------------atggagccatctcgg-tg
A0A2K5Z4A9_BMF-02      --------------------------------atggagccatctcgg-tg
A0A2K5MJW4_BMF-02      --------------------------------atggagccatctcgg-tg
A0A2K6B5F6_BMF-01      --------------------------------atggagccatctcgg-tg
A0A2K6B5F6_BMF-02      --------------------------------atggagccatctcgg-tg
A0A2K6B5F6_BMF-04      --------------------------------atggagccatctcgg-tg
A0A2K5Z4A9_BMF-01      --------------------------------atggagccatctcgg-tg
A0A2K5KGP2_BMF-02      --------------------------------atggagccatctcgg-tg
A0A2K6RAW1_BMF-02      --------------------------------atggagccatctcgg-tg
A0A2K6RAW1_BMF-01      --------------------------------atggagccatctcgg-tg
A0A2K6L919_BMF-01      --------------------------------atggagccatctcgg-tg
A0A2K6L919_BMF-03      --------------------------------atggagccatctcgg-tg
A0A2K6L919_BMF-02      --------------------------------atggagccatctcgg-tg
A0A2U4BC98_BMF-01      --------------------------------atggagccaccccag-tg
G1PAU1_BMF-01          --------------------------------atggagccacctcag-tg
A0A2I3HD83_BMF-01      --------------------------------atggagccatctcag-tg
A0A2K6TW78_BMF-03      --------------------------------atggagccatctcag-tg
A0A2K6TW78_BMF-02      --------------------------------atggagccatctcag-tg
A0A2K6TW78_BMF-01      --------------------------------atggagccatctcag-tg
A0A2J8T301_BMF-01      --------------------------------atggagccatctcag-tg
G3T7Z4_BMF-01          ctgacactctttcctggagtcacccaggggagatggagccatctcag-tg
A0A2K5RN49_BMF-02      --------------------------------atggagccatctcag-tg
A0A2K5RN49_BMF-01      --------------------------------atggagccatctcag-tg
F7HZL0_BMF-01          --------------------------------atggagccatctcag-tg
A0A2K5E1Q4_BMF-02      --------------------------------atggagccatctcag-tg
A0A2K5E1Q4_BMF-01      --------------------------------atggagccatctcag-tg
Q96LC9_BMF-09          --------------------------------atggagccatctcag-tg
Q96LC9_BMF-05          --------------------------------atggagccatctcag-tg
Q96LC9_BMF-07          --------------------------------atggagccatctcag-tg
Q96LC9_BMF-01          --------------------------------atggagccatctcag-tg
Q96LC9_BMF-02          --------------------------------atggagccatctcag-tg
Q96LC9_BMF-03          --------------------------------atggagccatctcag-tg
Q96LC9_BMF-04          --------------------------------atggagccatctcag-tg
A0A2J8QDD5_BMF-01      --------------------------------atggagccatctcag-tg
A0A2R9BS98_BMF-02      --------------------------------atggagccatctcag-tg
Q96LC9_BMF-06          --------------------------------atggagccatctcag-tg
A0A2I2Z168_BMF-02      --------------------------------atggagccatctcag-tg
A0A2I2Z168_BMF-01      --------------------------------atggagccatctcag-tg
Q96LC9_BMF-08          --------------------------------atggagccatctcag-tg
A0A2R9BS98_BMF-01      --------------------------------atggagccatctcag-tg
A0A2J8QDD5_BMF-02      --------------------------------atggagccatctcag-tg
                                                         **              

A0A672RK14_BMF-01      ------------------------------------------gatgagga
A0A673JJ10_BMF-01      ------------------------------------------gatgagga
A0A3B4UNJ0_BMF-01      ------------------------------------------gatgagga
W5N4P7_BMF-01          ------------------------------------------gaggatga
A3KND0_BMF-01          ------------------------------------------gagttaga
Q0GKC7_BMF-01          ------------------------------------------gaggacga
A0A671M0H4_BMF-01      ------------------------------------------gaggatga
A0A671M0H4_BMF-02      ------------------------------------------gaggatga
A0A671MNR9_BMF-01      ------------------------------------------gaggatga
A0A672JWL9_BMF-01      ------------------------------------------gaggatga
A0A672JWL9_BMF-02      ------------------------------------------gaggatga
A0A673HDR4_BMF-01      ------------------------------------------gaggatga
A0A3B3RH63_BMF-01      ------------------------------------------gatgacga
K7FRX2_BMF-01          ctggaagaagactattctagcctggac---------------gggctgga
A0A452H3N6_BMF-01      ctggaagacgactattccagcctggac---------------gggctgga
A0A674IPL3_BMF-01      ctggaagaggactattccagcctggat---------------gggctgga
A0A493T7X1_BMF-01      ctggaagaggactattctagcctggat---------------gggctgga
A0A3Q2UCA0_BMF-01      ctggaagaggactattctagcctggat---------------gggctgga
A0A3Q2UCA0_BMF-02      ctggaagaggactattctagcctggat---------------gggctgga
A0A669PL85_BMF-02      ctggaagaggactattctagcctggat---------------gggctgga
A0A493T7X1_BMF-02      ctggaagaggactattctagcctggat---------------gggctgga
A0A3Q2UCA0_BMF-03      ctggaagaggactattctagcctggat---------------gggctgga
A0A3Q2UCA0_BMF-04      ctggaagaggactattctagcctggat---------------gggctgga
A9XRH0_BMF-01          ctggaagaggactattctagcctggat---------------gggctgga
G1NHG8_BMF-01          ctggaagaggactattctagcctggat---------------gggctgga
A0A669PL85_BMF-01      ctggaagaggactattctagcctggat---------------gggctgga
U3JS06_BMF-01          ctggaagaggactattctagcctggat---------------gggctgga
A0A674GIP8_BMF-03      ctggaagaggactattctagcctggat---------------gggctgga
A0A674GIP8_BMF-01      ctggaagaggactattctagcctggat---------------gggctgga
A0A674GIP8_BMF-02      ctggaagaggactattctagcctggat---------------gggctgga
A0A672V891_BMF-01      ctggaagaggactattctagcctggat---------------gggctgga
A0A663DZQ4_BMF-01      ctggaagaggactattctagcctggat---------------gggctgga
A0A663MPI8_BMF-01      ctggaagaggactattctagcctggat---------------gggctgga
A0A670XMZ5_BMF-01      ttggaagatgatttttcccatttggat---------------gggttaga
H9GL49_BMF-01          ttggatgatgacttctccactttggat---------------gggctgga
A0A670JUU6_BMF-01      ctggaggaggatttctccaatctagat---------------gggctgga
A0A670JUU6_BMF-05      ctggaggaggatttctccaatctagat---------------gggctgga
A0A670JUU6_BMF-04      ctggaggaggatttctccaatctagat---------------gggctgga
A0A670JUU6_BMF-02      ctggaggaggatttctccaatctagat---------------gggctgga
A0A670JUU6_BMF-03      ctggaggaggatttctccaatctagat---------------gggctgga
A0A4W3JXA1_BMF-01      gaagagctg---------------------------------gacagtga
A0A3Q2CXC4_BMF-01      ------------------------------------------gaggagga
A0A3Q2CXC4_BMF-02      ------------------------------------------gaggagga
A0A3B5QK08_BMF-01      ------------------------------------------gatgagga
A0A3B5QK08_BMF-02      ------------------------------------------gatgagga
A0A096LRV0_BMF-01      ------------------------------------------gatgagga
A0A3B3WU80_BMF-01      ------------------------------------------gatgagga
A0A3P9Q8E2_BMF-01      ------------------------------------------gatgagga
A0A3Q2PJX9_BMF-01      ------------------------------------------gatgagga
A0A3Q2PJX9_BMF-03      ------------------------------------------gatgagga
A0A3Q2PJX9_BMF-02      ------------------------------------------gatgagga
A0A3Q2YCX7_BMF-01      ------------------------------------------gatgagga
A0A3Q2YCX7_BMF-02      ------------------------------------------gatgagga
A0A3B5KWG6_BMF-02      ------------------------------------------gatgagga
A0A3B5KWG6_BMF-01      ------------------------------------------gatgagga
A0A3B5KWG6_BMF-03      ------------------------------------------gatgagga
A0A3B3CGR9_BMF-01      ------------------------------------------gatgagga
A0A3P9K487_BMF-01      ------------------------------------------gatgagga
A0A3P9K487_BMF-02      ------------------------------------------gatgagga
A0A3B3HAU1_BMF-01      ------------------------------------------gatgagga
A0A3B3HAU1_BMF-02      ------------------------------------------gatgagga
A0A3B3HAU1_BMF-03      ------------------------------------------gatgagga
A0A3B3HAU1_BMF-04      ------------------------------------------gatgagga
A0A3P9ICE1_BMF-04      ------------------------------------------gatgagga
A0A3P9ICE1_BMF-01      ------------------------------------------gatgagga
A0A3P9ICE1_BMF-02      ------------------------------------------gatgagga
A0A3P9ICE1_BMF-03      ------------------------------------------gatgagga
A0A3P9ICE1_BMF-05      ------------------------------------------gatgagga
A0A3P8NFE2_BMF-02      ------------------------------------------gatgagga
A0A668TQU8_BMF-01      ------------------------------------------gatgagga
I3K2D6_BMF-01          ------------------------------------------gatgagga
A0A3Q4G1I4_BMF-01      ------------------------------------------gatgagga
A0A3P8NFE2_BMF-01      ------------------------------------------gatgagga
A0A3P9DPJ5_BMF-01      ------------------------------------------gatgagga
A0A3P9DPJ5_BMF-02      ------------------------------------------gatgagga
A0A3B4ETH0_BMF-01      ------------------------------------------gatgagga
A0A3Q3C5V2_BMF-01      ------------------------------------------gatgagga
A0A672HG10_BMF-01      ------------------------------------------gatgagga
A0A3P8UA78_BMF-02      ------------------------------------------gacgagga
A0A3P8UA78_BMF-01      ------------------------------------------gacgagga
A0A3P8UA78_BMF-03      ------------------------------------------gacgagga
A0A3Q3GUU5_BMF-01      ------------------------------------------gatgaaga
A0A3Q3VLX6_BMF-01      ------------------------------------------gatgacga
A0A3Q2ZA20_BMF-01      ------------------------------------------gatgagga
A0A667YNR9_BMF-01      ------------------------------------------gatgagga
A0A3Q3LME3_BMF-01      ------------------------------------------gatgagga
A0A3Q3LME3_BMF-02      ------------------------------------------gatgagga
A0A3Q3LME3_BMF-03      ------------------------------------------gatgagga
A0A3Q1IPR4_BMF-01      ------------------------------------------gatgagga
A0A3Q3QZ16_BMF-01      ------------------------------------------gatgagga
A0A3Q3QZ16_BMF-02      ------------------------------------------gatgagga
A0A665VG08_BMF-01      ------------------------------------------gatgagga
A0A673C8N3_BMF-01      ------------------------------------------gatgagga
A0A3Q1FVH7_BMF-01      ------------------------------------------gatgagga
A0A3Q1FVH7_BMF-02      ------------------------------------------gatgagga
A0A3B5B8F6_BMF-01      ------------------------------------------gatgagga
A0A3Q1D1K3_BMF-01      ------------------------------------------gatgagga
A0A3P8RKY9_BMF-01      ------------------------------------------gatgagga
A0A671X848_BMF-01      ------------------------------------------gatgagga
A0A0F8AD62_BMF-01      ------------------------------------------gatgagga
A0A4W6DUL1_BMF-01      ------------------------------------------gatgagga
A0A2U9CJH3_BMF-01      ------------------------------------------gatgagga
A0A3B4U5H8_BMF-01      ------------------------------------------gatgagga
A0A3B4WM88_BMF-01      ------------------------------------------gatgagga
A0A3P8ZIE7_BMF-01      ------------------------------------------gatgagga
A0A4W5N3A7_BMF-01      ------------------------------------------gatgagga
A0A6F9BGV6_BMF-01      ------------------------------------------gatgagga
A0A1S3SNN2_BMF-01      ------------------------------------------gatgagga
A0A674EF64_BMF-01      ------------------------------------------gatgagga
A0A1S3P5K4_BMF-01      ------------------------------------------gatgagga
A0A6F9B4C5_BMF-01      ------------------------------------------gatgagga
A0A4W5N721_BMF-01      ------------------------------------------gatgagga
A0A1S3P5K4_BMF-02      ------------------------------------------gatgagga
A0A673YQV3_BMF-01      ------------------------------------------gatgagga
A0A4W4DZH9_BMF-01      ------------------------------------------gacgaaga
A0A3B4CNJ8_BMF-01      ------------------------------------------gaagatga
A0A3B1K1X5_BMF-01      ------------------------------------------gatgagga
A0A3B4B6Y3_BMF-01      ------------------------------------------gatgagga
A0A6I8NF73_BMF-01      cgaggaggagctggaggagctgacggggctggag--------gagctgga
A0A5F8GKJ8_BMF-01      tg---------------------------tggaa--------gagctaga
G3WDQ2_BMF-01          tg---------------------------tggaa--------gagctgga
A0A4X2KLG2_BMF-01      tg---------------------------tcgaa--------gagctgga
Q8K589_BMF-01          tg---------------------------tggag--------gaactaga
Q91ZE9_BMF-02          tg---------------------------tggag--------gagctaga
Q91ZE9_BMF-01          tg---------------------------tggag--------gagctaga
Q91ZE9_BMF-06          tg---------------------------tggag--------gagctaga
A0A287CXH0_BMF-01      tg---------------------------tggag--------gagctgga
A0A287CXH0_BMF-02      tg---------------------------tggag--------gagctgga
A0A671DWL6_BMF-01      tg---------------------------tggaa--------gagctgga
A0A671DWL6_BMF-02      tg---------------------------tggaa--------gagctgga
A0A2K6FFN3_BMF-01      tg---------------------------tggag--------gagctgga
A0A2K6FFN3_BMF-02      tg---------------------------tggag--------gagctgga
A0A673TA87_BMF-01      tt---------------------------tgcgggatgccccgagcgggc
L8IXF5_BMF-01          tg---------------------------tggag--------gagctgga
A0A4W2EII1_BMF-01      tg---------------------------tggag--------gagctgga
A0A4W2EII1_BMF-01      tg---------------------------tggag--------gagctgga
Q05KI3_BMF-01          tg---------------------------tggag--------gagctgga
Q05KI3_BMF-02          tg---------------------------tggag--------gagctgga
A0A4W2INA4_BMF-01      tg---------------------------tggag--------gagctgga
A0A4W2INA4_BMF-01      tg---------------------------tggag--------gagctgga
A0A452F2E0_BMF-01      tg---------------------------tggag--------gagctgga
A0A452F2E0_BMF-02      tg---------------------------tggag--------gagctgga
W5QFV1_BMF-01          tg---------------------------tggag--------gagctgga
H0WYH6_BMF-01          tg---------------------------tggag--------gaactgga
A0A337ST43_BMF-02      tg---------------------------tggag--------gagctaga
A0A337ST43_BMF-03      tg---------------------------tggag--------gagctaga
A0A337ST43_BMF-05      tg---------------------------tggag--------gagctaga
A0A337ST43_BMF-01      tg---------------------------tggag--------gagctaga
A0A337ST43_BMF-04      tg---------------------------tggag--------gagctaga
A0A667H967_BMF-01      tg---------------------------tggag--------gagctgga
M3YAD5_BMF-01          tg---------------------------tggag--------gagctgga
U6CSY8_BMF-01          tg---------------------------tggag--------gagctgga
A0A452SED0_BMF-01      tg---------------------------tggag--------gagctgga
A0A384D070_BMF-01      tg---------------------------tggag--------gagctgga
A0A5F4CJ04_BMF-04      tg---------------------------tggag--------gagctgga
A0A5F4CJ04_BMF-03      tg---------------------------tggag--------gagctgga
A0A5F4CJ04_BMF-01      tg---------------------------tggag--------gagctgga
A0A5F4CJ04_BMF-02      tg---------------------------tggag--------gagctgga
A0A4X1UQ42_BMF-01      tg---------------------------tggag--------gagctgga
A0A4X1UQ42_BMF-02      tg---------------------------tggag--------gagctgga
A0A287AIU8_BMF-01      tg---------------------------tggag--------gagctgga
A0A287AIU8_BMF-02      tg---------------------------tggag--------gagctgga
A0A3Q2HR24_BMF-01      tg---------------------------tagag--------gagctgga
A0A3Q2HR24_BMF-02      tg---------------------------tagag--------gagctgga
G1SR62_BMF-01          tg---------------------------tggag--------gagctgga
A0A286XXB0_BMF-03      tg---------------------------tggag--------gagctgga
A0A286XXB0_BMF-01      tg---------------------------tggag--------gagctgga
A0A286XXB0_BMF-02      tg---------------------------tggag--------gagctgga
A0A2K5KGP2_BMF-01      tg---------------------------tggag--------gagctgga
A0A0D9R4R5_BMF-01      tg---------------------------tggag--------gagctgga
A0A2K5VLE9_BMF-01      tg---------------------------tggag--------gagctgga
A0A2K5VLE9_BMF-02      tg---------------------------tggag--------gagctgga
A0A096NTE9_BMF-02      tg---------------------------tggag--------gagctgga
A0A096NTE9_BMF-01      tg---------------------------tggag--------gagctgga
A0A096NTE9_BMF-03      tg---------------------------tggag--------gagctgga
A0A5F7ZML1_BMF-01      tg---------------------------tggag--------gagctgga
A0A5F7ZML1_BMF-02      tg---------------------------tggag--------gagctgga
A0A5F7ZML1_BMF-03      tg---------------------------tggag--------gagctgga
A0A2K5MJW4_BMF-01      tg---------------------------tggag--------gagctgga
A0A2K6B5F6_BMF-03      tg---------------------------tggag--------gagctgga
A0A2K5Z4A9_BMF-02      tg---------------------------tggag--------gagctgga
A0A2K5MJW4_BMF-02      tg---------------------------tggag--------gagctgga
A0A2K6B5F6_BMF-01      tg---------------------------tggag--------gagctgga
A0A2K6B5F6_BMF-02      tg---------------------------tggag--------gagctgga
A0A2K6B5F6_BMF-04      tg---------------------------tggag--------gagctgga
A0A2K5Z4A9_BMF-01      tg---------------------------tggag--------gagctgga
A0A2K5KGP2_BMF-02      tg---------------------------tggag--------gagctgga
A0A2K6RAW1_BMF-02      tg---------------------------tggag--------gagctgga
A0A2K6RAW1_BMF-01      tg---------------------------tggag--------gagctgga
A0A2K6L919_BMF-01      tg---------------------------tggag--------gagctgga
A0A2K6L919_BMF-03      tg---------------------------tggag--------gagctgga
A0A2K6L919_BMF-02      tg---------------------------tggag--------gagctgga
A0A2U4BC98_BMF-01      tg---------------------------tggag--------gagctgga
G1PAU1_BMF-01          tg---------------------------tggag--------gagctgga
A0A2I3HD83_BMF-01      tg---------------------------tggag--------gagctaga
A0A2K6TW78_BMF-03      tg---------------------------tggag--------gagctgga
A0A2K6TW78_BMF-02      tg---------------------------tggag--------gagctgga
A0A2K6TW78_BMF-01      tg---------------------------tggag--------gagctgga
A0A2J8T301_BMF-01      tg---------------------------tggag--------gagctgga
G3T7Z4_BMF-01          tg---------------------------tggag--------gagctgga
A0A2K5RN49_BMF-02      tg---------------------------tggag--------gagctgga
A0A2K5RN49_BMF-01      tg---------------------------tggag--------gagctgga
F7HZL0_BMF-01          tg---------------------------tggag--------gagctgga
A0A2K5E1Q4_BMF-02      tg---------------------------tggag--------gagctgga
A0A2K5E1Q4_BMF-01      tg---------------------------tggag--------gagctgga
Q96LC9_BMF-09          tg---------------------------tggag--------gagctgga
Q96LC9_BMF-05          tg---------------------------tggag--------gagctgga
Q96LC9_BMF-07          tg---------------------------tggag--------gagctgga
Q96LC9_BMF-01          tg---------------------------tggag--------gagctgga
Q96LC9_BMF-02          tg---------------------------tggag--------gagctgga
Q96LC9_BMF-03          tg---------------------------tggag--------gagctgga
Q96LC9_BMF-04          tg---------------------------tggag--------gagctgga
A0A2J8QDD5_BMF-01      tg---------------------------tggag--------gagctgga
A0A2R9BS98_BMF-02      tg---------------------------tggag--------gagctgga
Q96LC9_BMF-06          tg---------------------------tggag--------gagctgga
A0A2I2Z168_BMF-02      tg---------------------------tggag--------gagctgga
A0A2I2Z168_BMF-01      tg---------------------------tggag--------gagctgga
Q96LC9_BMF-08          tg---------------------------tggag--------gagctgga
A0A2R9BS98_BMF-01      tg---------------------------tggag--------gagctgga
A0A2J8QDD5_BMF-02      tg---------------------------tggag--------gagctgga
                                                                 *     * 

A0A672RK14_BMF-01      ggacgaac------------------------------------------
A0A673JJ10_BMF-01      agacgaac------------------------------------------
A0A3B4UNJ0_BMF-01      ggaggaca------------------------------------------
W5N4P7_BMF-01          agatgacg------------------------------------------
A3KND0_BMF-01          tgatgatg------------------------------------------
Q0GKC7_BMF-01          ggatgatg------------------------------------------
A0A671M0H4_BMF-01      ggatgatg------------------------------------------
A0A671M0H4_BMF-02      ggatgatg------------------------------------------
A0A671MNR9_BMF-01      ggatgatg------------------------------------------
A0A672JWL9_BMF-01      ggatgatg------------------------------------------
A0A672JWL9_BMF-02      ggatgatg------------------------------------------
A0A673HDR4_BMF-01      ggatgatg------------------------------------------
A0A3B3RH63_BMF-01      tgacgatg------------------------------------------
K7FRX2_BMF-01          cgatgacg------------------------------------------
A0A452H3N6_BMF-01      cgatgacg------------------------------------------
A0A674IPL3_BMF-01      cgatgacg------------------------------------------
A0A493T7X1_BMF-01      cgatgacg------------------------------------------
A0A3Q2UCA0_BMF-01      cgatgacg------------------------------------------
A0A3Q2UCA0_BMF-02      cgatgacg------------------------------------------
A0A669PL85_BMF-02      cgatgacg------------------------------------------
A0A493T7X1_BMF-02      cgatgacg------------------------------------------
A0A3Q2UCA0_BMF-03      cgatgacg------------------------------------------
A0A3Q2UCA0_BMF-04      cgatgacg------------------------------------------
A9XRH0_BMF-01          cgatgacg------------------------------------------
G1NHG8_BMF-01          cgatgacg------------------------------------------
A0A669PL85_BMF-01      cgatgacg------------------------------------------
U3JS06_BMF-01          cgatgacg------------------------------------------
A0A674GIP8_BMF-03      cgatgacg------------------------------------------
A0A674GIP8_BMF-01      cgatgacg------------------------------------------
A0A674GIP8_BMF-02      cgatgacg------------------------------------------
A0A672V891_BMF-01      cgatgatg------------------------------------------
A0A663DZQ4_BMF-01      cgatgacg------------------------------------------
A0A663MPI8_BMF-01      cgatgacg------------------------------------------
A0A670XMZ5_BMF-01      tgatgatg------------------------------------------
H9GL49_BMF-01          ggatgatg------------------------------------------
A0A670JUU6_BMF-01      ggatgatg------------------------------------------
A0A670JUU6_BMF-05      ggatgatg------------------------------------------
A0A670JUU6_BMF-04      ggatgatg------------------------------------------
A0A670JUU6_BMF-02      ggatgatg------------------------------------------
A0A670JUU6_BMF-03      ggatgatg------------------------------------------
A0A4W3JXA1_BMF-01      cgacgaag------------------------------------------
A0A3Q2CXC4_BMF-01      ggatgatg------------------------------------------
A0A3Q2CXC4_BMF-02      ggatgatg------------------------------------------
A0A3B5QK08_BMF-01      ggatgatg------------------------------------------
A0A3B5QK08_BMF-02      ggatgatg------------------------------------------
A0A096LRV0_BMF-01      ggatgatg------------------------------------------
A0A3B3WU80_BMF-01      ggatgatg------------------------------------------
A0A3P9Q8E2_BMF-01      ggatgatg------------------------------------------
A0A3Q2PJX9_BMF-01      ggatgatg------------------------------------------
A0A3Q2PJX9_BMF-03      ggatgatg------------------------------------------
A0A3Q2PJX9_BMF-02      ggatgatg------------------------------------------
A0A3Q2YCX7_BMF-01      ggatgatg------------------------------------------
A0A3Q2YCX7_BMF-02      ggatgatg------------------------------------------
A0A3B5KWG6_BMF-02      ggatgatg------------------------------------------
A0A3B5KWG6_BMF-01      ggatgatg------------------------------------------
A0A3B5KWG6_BMF-03      ggatgatg------------------------------------------
A0A3B3CGR9_BMF-01      agacgatg------------------------------------------
A0A3P9K487_BMF-01      agacgatg------------------------------------------
A0A3P9K487_BMF-02      agacgatg------------------------------------------
A0A3B3HAU1_BMF-01      agacgatg------------------------------------------
A0A3B3HAU1_BMF-02      agacgatg------------------------------------------
A0A3B3HAU1_BMF-03      agacgatg------------------------------------------
A0A3B3HAU1_BMF-04      agacgatg------------------------------------------
A0A3P9ICE1_BMF-04      agacgatg------------------------------------------
A0A3P9ICE1_BMF-01      agacgatg------------------------------------------
A0A3P9ICE1_BMF-02      agacgatg------------------------------------------
A0A3P9ICE1_BMF-03      agacgatg------------------------------------------
A0A3P9ICE1_BMF-05      agacgatg------------------------------------------
A0A3P8NFE2_BMF-02      ggacgatg------------------------------------------
A0A668TQU8_BMF-01      ggacgatg------------------------------------------
I3K2D6_BMF-01          ggacgatg------------------------------------------
A0A3Q4G1I4_BMF-01      ggacgatg------------------------------------------
A0A3P8NFE2_BMF-01      ggacgatg------------------------------------------
A0A3P9DPJ5_BMF-01      ggacgatg------------------------------------------
A0A3P9DPJ5_BMF-02      ggacgatg------------------------------------------
A0A3B4ETH0_BMF-01      ggacgatg------------------------------------------
A0A3Q3C5V2_BMF-01      ggacgatg------------------------------------------
A0A672HG10_BMF-01      ggatgatg------------------------------------------
A0A3P8UA78_BMF-02      ggacgatg------------------------------------------
A0A3P8UA78_BMF-01      ggacgatg------------------------------------------
A0A3P8UA78_BMF-03      ggacgatg------------------------------------------
A0A3Q3GUU5_BMF-01      ggatgatg------------------------------------------
A0A3Q3VLX6_BMF-01      ggatgatg------------------------------------------
A0A3Q2ZA20_BMF-01      ggatgatg------------------------------------------
A0A667YNR9_BMF-01      ggatgatg------------------------------------------
A0A3Q3LME3_BMF-01      ggatgatg------------------------------------------
A0A3Q3LME3_BMF-02      ggatgatg------------------------------------------
A0A3Q3LME3_BMF-03      ggatgatg------------------------------------------
A0A3Q1IPR4_BMF-01      ggatgatg------------------------------------------
A0A3Q3QZ16_BMF-01      ggatgatg------------------------------------------
A0A3Q3QZ16_BMF-02      ggatgatg------------------------------------------
A0A665VG08_BMF-01      agatgatg------------------------------------------
A0A673C8N3_BMF-01      ggatgatg------------------------------------------
A0A3Q1FVH7_BMF-01      ggatgatg------------------------------------------
A0A3Q1FVH7_BMF-02      ggatgatg------------------------------------------
A0A3B5B8F6_BMF-01      ggatgatg------------------------------------------
A0A3Q1D1K3_BMF-01      ggatgatg------------------------------------------
A0A3P8RKY9_BMF-01      ggatgatg------------------------------------------
A0A671X848_BMF-01      ggatgatg------------------------------------------
A0A0F8AD62_BMF-01      ggatgatg------------------------------------------
A0A4W6DUL1_BMF-01      ggatgatg------------------------------------------
A0A2U9CJH3_BMF-01      ggatgatg------------------------------------------
A0A3B4U5H8_BMF-01      ggatgatg------------------------------------------
A0A3B4WM88_BMF-01      ggatgatg------------------------------------------
A0A3P8ZIE7_BMF-01      ggatgatg------------------------------------------
A0A4W5N3A7_BMF-01      ggatgatg------------------------------------------
A0A6F9BGV6_BMF-01      ggatgatg------------------------------------------
A0A1S3SNN2_BMF-01      ggatgatg------------------------------------------
A0A674EF64_BMF-01      ggatgatg------------------------------------------
A0A1S3P5K4_BMF-01      ggatgatg------------------------------------------
A0A6F9B4C5_BMF-01      ggatgatg------------------------------------------
A0A4W5N721_BMF-01      ggatgatg------------------------------------------
A0A1S3P5K4_BMF-02      ggatgatg------------------------------------------
A0A673YQV3_BMF-01      ggatgatg------------------------------------------
A0A4W4DZH9_BMF-01      ggatgatg------------------------------------------
A0A3B4CNJ8_BMF-01      agatgatg------------------------------------------
A0A3B1K1X5_BMF-01      ggatgatg------------------------------------------
A0A3B4B6Y3_BMF-01      ggatgatg------------------------------------------
A0A6I8NF73_BMF-01      ggatgacg------------------------------------------
A0A5F8GKJ8_BMF-01      ggacgatg------------------------------------------
G3WDQ2_BMF-01          ggacgatg------------------------------------------
A0A4X2KLG2_BMF-01      ggacgatg------------------------------------------
Q8K589_BMF-01          agatgatg------------------------------------------
Q91ZE9_BMF-02          agatgatg------------------------------------------
Q91ZE9_BMF-01          agatgatg------------------------------------------
Q91ZE9_BMF-06          agatgatg------------------------------------------
A0A287CXH0_BMF-01      agatgatg------------------------------------------
A0A287CXH0_BMF-02      agatgatg------------------------------------------
A0A671DWL6_BMF-01      ggatgatg------------------------------------------
A0A671DWL6_BMF-02      ggatgatg------------------------------------------
A0A2K6FFN3_BMF-01      ggatgatg------------------------------------------
A0A2K6FFN3_BMF-02      ggatgatg------------------------------------------
A0A673TA87_BMF-01      gtattttggaaacaatacggcgcgggccacggtggcctccacccgcgcca
L8IXF5_BMF-01          ggatgacg------------------------------------------
A0A4W2EII1_BMF-01      ggatgacg------------------------------------------
A0A4W2EII1_BMF-01      ggatgacg------------------------------------------
Q05KI3_BMF-01          ggatgacg------------------------------------------
Q05KI3_BMF-02          ggatgacg------------------------------------------
A0A4W2INA4_BMF-01      ggatgacg------------------------------------------
A0A4W2INA4_BMF-01      ggatgacg------------------------------------------
A0A452F2E0_BMF-01      ggatgacg------------------------------------------
A0A452F2E0_BMF-02      ggatgacg------------------------------------------
W5QFV1_BMF-01          ggatgacg------------------------------------------
H0WYH6_BMF-01          ggatgacg------------------------------------------
A0A337ST43_BMF-02      ggatgatg------------------------------------------
A0A337ST43_BMF-03      ggatgatg------------------------------------------
A0A337ST43_BMF-05      ggatgatg------------------------------------------
A0A337ST43_BMF-01      ggatgatg------------------------------------------
A0A337ST43_BMF-04      ggatgatg------------------------------------------
A0A667H967_BMF-01      ggatgatg------------------------------------------
M3YAD5_BMF-01          ggatgacg------------------------------------------
U6CSY8_BMF-01          ggatgatg------------------------------------------
A0A452SED0_BMF-01      ggatgatg------------------------------------------
A0A384D070_BMF-01      ggatgatg------------------------------------------
A0A5F4CJ04_BMF-04      ggatgatg------------------------------------------
A0A5F4CJ04_BMF-03      ggatgatg------------------------------------------
A0A5F4CJ04_BMF-01      ggatgatg------------------------------------------
A0A5F4CJ04_BMF-02      ggatgatg------------------------------------------
A0A4X1UQ42_BMF-01      ggatgatg------------------------------------------
A0A4X1UQ42_BMF-02      ggatgatg------------------------------------------
A0A287AIU8_BMF-01      ggatgatg------------------------------------------
A0A287AIU8_BMF-02      ggatgatg------------------------------------------
A0A3Q2HR24_BMF-01      ggatgatg------------------------------------------
A0A3Q2HR24_BMF-02      ggatgatg------------------------------------------
G1SR62_BMF-01          ggatgacg------------------------------------------
A0A286XXB0_BMF-03      ggatgatg------------------------------------------
A0A286XXB0_BMF-01      ggatgatg------------------------------------------
A0A286XXB0_BMF-02      ggatgatg------------------------------------------
A0A2K5KGP2_BMF-01      ggatgacg------------------------------------------
A0A0D9R4R5_BMF-01      ggatgatg------------------------------------------
A0A2K5VLE9_BMF-01      ggatgatg------------------------------------------
A0A2K5VLE9_BMF-02      ggatgatg------------------------------------------
A0A096NTE9_BMF-02      ggatgatg------------------------------------------
A0A096NTE9_BMF-01      ggatgatg------------------------------------------
A0A096NTE9_BMF-03      ggatgatg------------------------------------------
A0A5F7ZML1_BMF-01      ggatgatg------------------------------------------
A0A5F7ZML1_BMF-02      ggatgatg------------------------------------------
A0A5F7ZML1_BMF-03      ggatgatg------------------------------------------
A0A2K5MJW4_BMF-01      ggatgatg------------------------------------------
A0A2K6B5F6_BMF-03      ggatgatg------------------------------------------
A0A2K5Z4A9_BMF-02      ggatgatg------------------------------------------
A0A2K5MJW4_BMF-02      ggatgatg------------------------------------------
A0A2K6B5F6_BMF-01      ggatgatg------------------------------------------
A0A2K6B5F6_BMF-02      ggatgatg------------------------------------------
A0A2K6B5F6_BMF-04      ggatgatg------------------------------------------
A0A2K5Z4A9_BMF-01      ggatgatg------------------------------------------
A0A2K5KGP2_BMF-02      ggatgacg------------------------------------------
A0A2K6RAW1_BMF-02      agatgatg------------------------------------------
A0A2K6RAW1_BMF-01      agatgatg------------------------------------------
A0A2K6L919_BMF-01      ggatgatg------------------------------------------
A0A2K6L919_BMF-03      ggatgatg------------------------------------------
A0A2K6L919_BMF-02      ggatgatg------------------------------------------
A0A2U4BC98_BMF-01      ggatgatg------------------------------------------
G1PAU1_BMF-01          ggatgatg------------------------------------------
A0A2I3HD83_BMF-01      ggatgatg------------------------------------------
A0A2K6TW78_BMF-03      ggatgatg------------------------------------------
A0A2K6TW78_BMF-02      ggatgatg------------------------------------------
A0A2K6TW78_BMF-01      ggatgatg------------------------------------------
A0A2J8T301_BMF-01      ggatgatg------------------------------------------
G3T7Z4_BMF-01          ggatgatg------------------------------------------
A0A2K5RN49_BMF-02      ggatgatg------------------------------------------
A0A2K5RN49_BMF-01      ggatgatg------------------------------------------
F7HZL0_BMF-01          ggatgatg------------------------------------------
A0A2K5E1Q4_BMF-02      ggatgatg------------------------------------------
A0A2K5E1Q4_BMF-01      ggatgatg------------------------------------------
Q96LC9_BMF-09          ggatgat-------------------------------------------
Q96LC9_BMF-05          ggatgatg------------------------------------------
Q96LC9_BMF-07          ggatgatg------------------------------------------
Q96LC9_BMF-01          ggatgatg------------------------------------------
Q96LC9_BMF-02          ggatgatg------------------------------------------
Q96LC9_BMF-03          ggatgatg------------------------------------------
Q96LC9_BMF-04          ggatgatg------------------------------------------
A0A2J8QDD5_BMF-01      ggatgatg------------------------------------------
A0A2R9BS98_BMF-02      ggatgatg------------------------------------------
Q96LC9_BMF-06          ggatgatg------------------------------------------
A0A2I2Z168_BMF-02      ggatgatg------------------------------------------
A0A2I2Z168_BMF-01      ggatgatg------------------------------------------
Q96LC9_BMF-08          ggatgatg------------------------------------------
A0A2R9BS98_BMF-01      ggatgatg------------------------------------------
A0A2J8QDD5_BMF-02      ggatgatg------------------------------------------
                         *                                               

A0A672RK14_BMF-01      -------------------agcttc-------------------------
A0A673JJ10_BMF-01      -------------------agcttc-------------------------
A0A3B4UNJ0_BMF-01      -------------------tgtcacagcccat------------------
W5N4P7_BMF-01          -------------------tgttccacccg--------------------
A3KND0_BMF-01          -------------------tgttttatcctga------------------
Q0GKC7_BMF-01          -------------------tgttcaggaaggg------------------
A0A671M0H4_BMF-01      -------------------tgcgcaggaaggg------------------
A0A671M0H4_BMF-02      -------------------tgcgcaggaaggg------------------
A0A671MNR9_BMF-01      -------------------tgcgcaggaaggg------------------
A0A672JWL9_BMF-01      -------------------tgcgcaggaaggg------------------
A0A672JWL9_BMF-02      -------------------tgcgcaggaaggg------------------
A0A673HDR4_BMF-01      -------------------tgcgcaggaaggg------------------
A0A3B3RH63_BMF-01      -------------------tgttccacacgga------------------
K7FRX2_BMF-01          -------------------tgtttcactctgat-----------------
A0A452H3N6_BMF-01      -------------------tgtttcactc---t-----------------
A0A674IPL3_BMF-01      -------------------tgtttcactc---t-----------------
A0A493T7X1_BMF-01      -------------------tgtttcactctgat-----------------
A0A3Q2UCA0_BMF-01      -------------------tgtttcactctgat-----------------
A0A3Q2UCA0_BMF-02      -------------------tgtttcactctgat-----------------
A0A669PL85_BMF-02      -------------------tgtttcactctgat-----------------
A0A493T7X1_BMF-02      -------------------tgtttcactctgat-----------------
A0A3Q2UCA0_BMF-03      -------------------tgtttcactctgat-----------------
A0A3Q2UCA0_BMF-04      -------------------tgtttcactctgat-----------------
A9XRH0_BMF-01          -------------------tgtttcactctgat-----------------
G1NHG8_BMF-01          -------------------tgtttcactctgat-----------------
A0A669PL85_BMF-01      -------------------tgtttcactctgat-----------------
U3JS06_BMF-01          -------------------tgtttcactctgat-----------------
A0A674GIP8_BMF-03      -------------------tgtttcactctgat-----------------
A0A674GIP8_BMF-01      -------------------tgtttcactctgat-----------------
A0A674GIP8_BMF-02      -------------------tgtttcactctgat-----------------
A0A672V891_BMF-01      -------------------tgtttcactctgat-----------------
A0A663DZQ4_BMF-01      -------------------tgtttcactctgat-----------------
A0A663MPI8_BMF-01      -------------------tgtttcactctgat-----------------
A0A670XMZ5_BMF-01      -------------------tattccactctgac-----------------
H9GL49_BMF-01          -------------------tgttccatgcagaa-----------------
A0A670JUU6_BMF-01      -------------------tcttccactctgaa-----------------
A0A670JUU6_BMF-05      -------------------tcttccactctgaa-----------------
A0A670JUU6_BMF-04      -------------------tcttccactctgaa-----------------
A0A670JUU6_BMF-02      -------------------tcttccactctgaa-----------------
A0A670JUU6_BMF-03      -------------------tcttccactctgaa-----------------
A0A4W3JXA1_BMF-01      -------------------tctttgcccagga------------------
A0A3Q2CXC4_BMF-01      -------------------tgtttgagccaga------------------
A0A3Q2CXC4_BMF-02      -------------------tgtttgagccaga------------------
A0A3B5QK08_BMF-01      -------------------tgtttgagccaga------------------
A0A3B5QK08_BMF-02      -------------------tgtttgagccaga------------------
A0A096LRV0_BMF-01      -------------------tgtttgagccaga------------------
A0A3B3WU80_BMF-01      -------------------tgtttgagccaga------------------
A0A3P9Q8E2_BMF-01      -------------------tgtttgagccaga------------------
A0A3Q2PJX9_BMF-01      -------------------tgtttgagccaga------------------
A0A3Q2PJX9_BMF-03      -------------------tgtttgagccaga------------------
A0A3Q2PJX9_BMF-02      -------------------tgtttgagccaga------------------
A0A3Q2YCX7_BMF-01      -------------------tgtttgagccaga------------------
A0A3Q2YCX7_BMF-02      -------------------tgtttgagccaga------------------
A0A3B5KWG6_BMF-02      -------------------tatttcagccaga------------------
A0A3B5KWG6_BMF-01      -------------------tatttcagccaga------------------
A0A3B5KWG6_BMF-03      -------------------tatttcagccaga------------------
A0A3B3CGR9_BMF-01      -------------------tgttcgagccgga------------------
A0A3P9K487_BMF-01      -------------------tgttcgagccgga------------------
A0A3P9K487_BMF-02      -------------------tgttcgagccgga------------------
A0A3B3HAU1_BMF-01      -------------------tgttcgagccgga------------------
A0A3B3HAU1_BMF-02      -------------------tgttcgagccgga------------------
A0A3B3HAU1_BMF-03      -------------------tgttcgagccgga------------------
A0A3B3HAU1_BMF-04      -------------------tgttcgagccgga------------------
A0A3P9ICE1_BMF-04      -------------------tcttcgagccgga------------------
A0A3P9ICE1_BMF-01      -------------------tcttcgagccgga------------------
A0A3P9ICE1_BMF-02      -------------------tcttcgagccgga------------------
A0A3P9ICE1_BMF-03      -------------------tcttcgagccgga------------------
A0A3P9ICE1_BMF-05      -------------------tcttcgagccgga------------------
A0A3P8NFE2_BMF-02      -------------------tgtttgagccaaa------------------
A0A668TQU8_BMF-01      -------------------tgtttgagccaaa------------------
I3K2D6_BMF-01          -------------------tgtttgagccaaa------------------
A0A3Q4G1I4_BMF-01      -------------------tgtttgagccaaa------------------
A0A3P8NFE2_BMF-01      -------------------tgtttgagccaaa------------------
A0A3P9DPJ5_BMF-01      -------------------tgtttgagccaaa------------------
A0A3P9DPJ5_BMF-02      -------------------tgtttgagccaaa------------------
A0A3B4ETH0_BMF-01      -------------------tgtttgagccaaa------------------
A0A3Q3C5V2_BMF-01      -------------------tgtttgagccaaa------------------
A0A672HG10_BMF-01      -------------------tgtttgagccaga------------------
A0A3P8UA78_BMF-02      -------------------tctttgagccaga------------------
A0A3P8UA78_BMF-01      -------------------tctttgagccaga------------------
A0A3P8UA78_BMF-03      -------------------tctttgagccaga------------------
A0A3Q3GUU5_BMF-01      -------------------tgttcgagccgga------------------
A0A3Q3VLX6_BMF-01      -------------------tatttgagccaga------------------
A0A3Q2ZA20_BMF-01      -------------------tgtttgagccaga------------------
A0A667YNR9_BMF-01      -------------------tgtttgagccaga------------------
A0A3Q3LME3_BMF-01      -------------------tgtttgagccaga------------------
A0A3Q3LME3_BMF-02      -------------------tgtttgagccaga------------------
A0A3Q3LME3_BMF-03      -------------------tgtttgagccaga------------------
A0A3Q1IPR4_BMF-01      -------------------tgtttgagccaga------------------
A0A3Q3QZ16_BMF-01      -------------------tgtttgagccaga------------------
A0A3Q3QZ16_BMF-02      -------------------tgtttgagccaga------------------
A0A665VG08_BMF-01      -------------------tgtttgagccaga------------------
A0A673C8N3_BMF-01      -------------------tgtttgagccaga------------------
A0A3Q1FVH7_BMF-01      -------------------tgtttgagccaga------------------
A0A3Q1FVH7_BMF-02      -------------------tgtttgagccaga------------------
A0A3B5B8F6_BMF-01      -------------------tttttgagccaga------------------
A0A3Q1D1K3_BMF-01      -------------------tttttgagccaga------------------
A0A3P8RKY9_BMF-01      -------------------tttttgagccaga------------------
A0A671X848_BMF-01      -------------------tgttcgagccaga------------------
A0A0F8AD62_BMF-01      -------------------tgtttgagccaga------------------
A0A4W6DUL1_BMF-01      -------------------tgtttgagccaga------------------
A0A2U9CJH3_BMF-01      -------------------tctttgagccaga------------------
A0A3B4U5H8_BMF-01      -------------------tgtttgagccaga------------------
A0A3B4WM88_BMF-01      -------------------tgtttgagccaga------------------
A0A3P8ZIE7_BMF-01      -------------------tgtttgagccaga------------------
A0A4W5N3A7_BMF-01      -------------------tgtttgtgccagac-----------------
A0A6F9BGV6_BMF-01      -------------------tgtttgtgccagac-----------------
A0A1S3SNN2_BMF-01      -------------------tgtttgtgccagac-----------------
A0A674EF64_BMF-01      -------------------tgtttgtgccagac-----------------
A0A1S3P5K4_BMF-01      -------------------tgtttgaaccaga------------------
A0A6F9B4C5_BMF-01      -------------------tgtttgagccaga------------------
A0A4W5N721_BMF-01      -------------------tgtttgagccaga------------------
A0A1S3P5K4_BMF-02      -------------------tgtttgaaccaga------------------
A0A673YQV3_BMF-01      -------------------tgtttgaaccaga------------------
A0A4W4DZH9_BMF-01      -------------------tgttc--------------------------
A0A3B4CNJ8_BMF-01      -------------------tttttgtgatggat-----------------
A0A3B1K1X5_BMF-01      -------------------tgttc--------------------------
A0A3B4B6Y3_BMF-01      -------------------tgtttgagccaga------------------
A0A6I8NF73_BMF-01      -------------------tcttccaccctgagacgcct-----------
A0A5F8GKJ8_BMF-01      -------------------tgttccacccggag-----------------
G3WDQ2_BMF-01          -------------------tgttccacccagag-----------------
A0A4X2KLG2_BMF-01      -------------------tgttccacccggag-----------------
Q8K589_BMF-01          -------------------tgttccagccagag-----------------
Q91ZE9_BMF-02          -------------------tgttccagtcagag-----------------
Q91ZE9_BMF-01          -------------------tgttccagtcagag-----------------
Q91ZE9_BMF-06          -------------------tgttccagtcagag-----------------
A0A287CXH0_BMF-01      -------------------tgttccagccagag-----------------
A0A287CXH0_BMF-02      -------------------tgttccagccagag-----------------
A0A671DWL6_BMF-01      -------------------tgtttcagccagag-----------------
A0A671DWL6_BMF-02      -------------------tgtttcagccagag-----------------
A0A2K6FFN3_BMF-01      -------------------tgttccagccagag-----------------
A0A2K6FFN3_BMF-02      -------------------tgttccagccagag-----------------
A0A673TA87_BMF-01      gcccgccagctgccgctgccgcccctgccagcgcctcccgccacccgccg
L8IXF5_BMF-01          -------------------tattccagcccgag-----------------
A0A4W2EII1_BMF-01      -------------------tattccagcccgag-----------------
A0A4W2EII1_BMF-01      -------------------tattccagcccgag-----------------
Q05KI3_BMF-01          -------------------tattccagcccgag-----------------
Q05KI3_BMF-02          -------------------tattccagcccgag-----------------
A0A4W2INA4_BMF-01      -------------------tattccagcccgag-----------------
A0A4W2INA4_BMF-01      -------------------tattccagcccgag-----------------
A0A452F2E0_BMF-01      -------------------tattccagccagag-----------------
A0A452F2E0_BMF-02      -------------------tattccagccagag-----------------
W5QFV1_BMF-01          -------------------tattccagccagag-----------------
H0WYH6_BMF-01          -------------------tgttccaaccagag-----------------
A0A337ST43_BMF-02      -------------------tgttccagccagag-----------------
A0A337ST43_BMF-03      -------------------tgttccagccagag-----------------
A0A337ST43_BMF-05      -------------------tgttccagccagag-----------------
A0A337ST43_BMF-01      -------------------tgttccagccagag-----------------
A0A337ST43_BMF-04      -------------------tgttccagccagag-----------------
A0A667H967_BMF-01      -------------------tgttccagccagag-----------------
M3YAD5_BMF-01          -------------------tgttccagccagag-----------------
U6CSY8_BMF-01          -------------------tgttccagccagag-----------------
A0A452SED0_BMF-01      -------------------tgttccagccagag-----------------
A0A384D070_BMF-01      -------------------tgttccagccagag-----------------
A0A5F4CJ04_BMF-04      -------------------tgttccagccagag-----------------
A0A5F4CJ04_BMF-03      -------------------tgttccagccagag-----------------
A0A5F4CJ04_BMF-01      -------------------tgttccagccagag-----------------
A0A5F4CJ04_BMF-02      -------------------tgttccagccagag-----------------
A0A4X1UQ42_BMF-01      -------------------tgttccagccagag-----------------
A0A4X1UQ42_BMF-02      -------------------tgttccagccagag-----------------
A0A287AIU8_BMF-01      -------------------tgttccagccagag-----------------
A0A287AIU8_BMF-02      -------------------tgttccagccagag-----------------
A0A3Q2HR24_BMF-01      -------------------tgttccagccagag-----------------
A0A3Q2HR24_BMF-02      -------------------tgttccagccagag-----------------
G1SR62_BMF-01          -------------------tgttccagccagag-----------------
A0A286XXB0_BMF-03      -------------------tgttccaacccgag-----------------
A0A286XXB0_BMF-01      -------------------tgttccaacccgag-----------------
A0A286XXB0_BMF-02      -------------------tgttccaacccgag-----------------
A0A2K5KGP2_BMF-01      -------------------tgttccagccggag-----------------
A0A0D9R4R5_BMF-01      -------------------tgttccagccggag-----------------
A0A2K5VLE9_BMF-01      -------------------tgttccagccggag-----------------
A0A2K5VLE9_BMF-02      -------------------tgttccagccggag-----------------
A0A096NTE9_BMF-02      -------------------tgttccagccggag-----------------
A0A096NTE9_BMF-01      -------------------tgttccagccggag-----------------
A0A096NTE9_BMF-03      -------------------tgttccagccggag-----------------
A0A5F7ZML1_BMF-01      -------------------tgttccagccggag-----------------
A0A5F7ZML1_BMF-02      -------------------tgttccagccggag-----------------
A0A5F7ZML1_BMF-03      -------------------tgttccagccggag-----------------
A0A2K5MJW4_BMF-01      -------------------tgttccagccggag-----------------
A0A2K6B5F6_BMF-03      -------------------tgttccagccggag-----------------
A0A2K5Z4A9_BMF-02      -------------------tgttccagccggag-----------------
A0A2K5MJW4_BMF-02      -------------------tgttccagccggag-----------------
A0A2K6B5F6_BMF-01      -------------------tgttccagccggag-----------------
A0A2K6B5F6_BMF-02      -------------------tgttccagccggag-----------------
A0A2K6B5F6_BMF-04      -------------------tgttccagccggag-----------------
A0A2K5Z4A9_BMF-01      -------------------tgttccagccggag-----------------
A0A2K5KGP2_BMF-02      -------------------tgttccagccggag-----------------
A0A2K6RAW1_BMF-02      -------------------tgttccagccggag-----------------
A0A2K6RAW1_BMF-01      -------------------tgttccagccggag-----------------
A0A2K6L919_BMF-01      -------------------tgttccagccggag-----------------
A0A2K6L919_BMF-03      -------------------tgttccagccggag-----------------
A0A2K6L919_BMF-02      -------------------tgttccagccggag-----------------
A0A2U4BC98_BMF-01      -------------------tgttccagccagag-----------------
G1PAU1_BMF-01          -------------------tgtttcagccagag-----------------
A0A2I3HD83_BMF-01      -------------------tgttccaaccagag-----------------
A0A2K6TW78_BMF-03      -------------------tgttccagccagag-----------------
A0A2K6TW78_BMF-02      -------------------tgttccagccagag-----------------
A0A2K6TW78_BMF-01      -------------------tgttccagccagag-----------------
A0A2J8T301_BMF-01      -------------------tgttccaaccagag-----------------
G3T7Z4_BMF-01          -------------------tattccaaccagag-----------------
A0A2K5RN49_BMF-02      -------------------tgttccagccagag-----------------
A0A2K5RN49_BMF-01      -------------------tgttccagccagag-----------------
F7HZL0_BMF-01          -------------------tgttccagccagag-----------------
A0A2K5E1Q4_BMF-02      -------------------tgttccagtcagag-----------------
A0A2K5E1Q4_BMF-01      -------------------tgttccagtcagag-----------------
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          -------------------tgttccaaccagag-----------------
Q96LC9_BMF-07          -------------------tgttccaaccagag-----------------
Q96LC9_BMF-01          -------------------tgttccaaccagag-----------------
Q96LC9_BMF-02          -------------------tgttccaaccagag-----------------
Q96LC9_BMF-03          -------------------tgttccaaccagag-----------------
Q96LC9_BMF-04          -------------------tgttccaaccagag-----------------
A0A2J8QDD5_BMF-01      -------------------tgttccaaccagag-----------------
A0A2R9BS98_BMF-02      -------------------tgttccaaccagag-----------------
Q96LC9_BMF-06          -------------------tgttccaaccagag-----------------
A0A2I2Z168_BMF-02      -------------------tgttccaaccagag-----------------
A0A2I2Z168_BMF-01      -------------------tgttccaaccagag-----------------
Q96LC9_BMF-08          -------------------tgttccaaccagag-----------------
A0A2R9BS98_BMF-01      -------------------tgttccaaccagag-----------------
A0A2J8QDD5_BMF-02      -------------------tgttccaaccagag-----------------
                                                                         

A0A672RK14_BMF-01      --------------------------------------------------
A0A673JJ10_BMF-01      --------------------------------------------------
A0A3B4UNJ0_BMF-01      --------------------------------------------------
W5N4P7_BMF-01          --------------------------------------------------
A3KND0_BMF-01          --------------------------------------------------
Q0GKC7_BMF-01          --------------------------------------------------
A0A671M0H4_BMF-01      --------------------------------------------------
A0A671M0H4_BMF-02      --------------------------------------------------
A0A671MNR9_BMF-01      --------------------------------------------------
A0A672JWL9_BMF-01      --------------------------------------------------
A0A672JWL9_BMF-02      --------------------------------------------------
A0A673HDR4_BMF-01      --------------------------------------------------
A0A3B3RH63_BMF-01      --------------------------------------------------
K7FRX2_BMF-01          --------------------------------------------------
A0A452H3N6_BMF-01      --------------------------------------------------
A0A674IPL3_BMF-01      --------------------------------------------------
A0A493T7X1_BMF-01      --------------------------------------------------
A0A3Q2UCA0_BMF-01      --------------------------------------------------
A0A3Q2UCA0_BMF-02      --------------------------------------------------
A0A669PL85_BMF-02      --------------------------------------------------
A0A493T7X1_BMF-02      --------------------------------------------------
A0A3Q2UCA0_BMF-03      --------------------------------------------------
A0A3Q2UCA0_BMF-04      --------------------------------------------------
A9XRH0_BMF-01          --------------------------------------------------
G1NHG8_BMF-01          --------------------------------------------------
A0A669PL85_BMF-01      --------------------------------------------------
U3JS06_BMF-01          --------------------------------------------------
A0A674GIP8_BMF-03      --------------------------------------------------
A0A674GIP8_BMF-01      --------------------------------------------------
A0A674GIP8_BMF-02      --------------------------------------------------
A0A672V891_BMF-01      --------------------------------------------------
A0A663DZQ4_BMF-01      --------------------------------------------------
A0A663MPI8_BMF-01      --------------------------------------------------
A0A670XMZ5_BMF-01      --------------------------------------------------
H9GL49_BMF-01          --------------------------------------------------
A0A670JUU6_BMF-01      --------------------------------------------------
A0A670JUU6_BMF-05      --------------------------------------------------
A0A670JUU6_BMF-04      --------------------------------------------------
A0A670JUU6_BMF-02      --------------------------------------------------
A0A670JUU6_BMF-03      --------------------------------------------------
A0A4W3JXA1_BMF-01      --------------------------------------------------
A0A3Q2CXC4_BMF-01      --------------------------------------------------
A0A3Q2CXC4_BMF-02      --------------------------------------------------
A0A3B5QK08_BMF-01      --------------------------------------------------
A0A3B5QK08_BMF-02      --------------------------------------------------
A0A096LRV0_BMF-01      --------------------------------------------------
A0A3B3WU80_BMF-01      --------------------------------------------------
A0A3P9Q8E2_BMF-01      --------------------------------------------------
A0A3Q2PJX9_BMF-01      --------------------------------------------------
A0A3Q2PJX9_BMF-03      --------------------------------------------------
A0A3Q2PJX9_BMF-02      --------------------------------------------------
A0A3Q2YCX7_BMF-01      --------------------------------------------------
A0A3Q2YCX7_BMF-02      --------------------------------------------------
A0A3B5KWG6_BMF-02      --------------------------------------------------
A0A3B5KWG6_BMF-01      --------------------------------------------------
A0A3B5KWG6_BMF-03      --------------------------------------------------
A0A3B3CGR9_BMF-01      --------------------------------------------------
A0A3P9K487_BMF-01      --------------------------------------------------
A0A3P9K487_BMF-02      --------------------------------------------------
A0A3B3HAU1_BMF-01      --------------------------------------------------
A0A3B3HAU1_BMF-02      --------------------------------------------------
A0A3B3HAU1_BMF-03      --------------------------------------------------
A0A3B3HAU1_BMF-04      --------------------------------------------------
A0A3P9ICE1_BMF-04      --------------------------------------------------
A0A3P9ICE1_BMF-01      --------------------------------------------------
A0A3P9ICE1_BMF-02      --------------------------------------------------
A0A3P9ICE1_BMF-03      --------------------------------------------------
A0A3P9ICE1_BMF-05      --------------------------------------------------
A0A3P8NFE2_BMF-02      --------------------------------------------------
A0A668TQU8_BMF-01      --------------------------------------------------
I3K2D6_BMF-01          --------------------------------------------------
A0A3Q4G1I4_BMF-01      --------------------------------------------------
A0A3P8NFE2_BMF-01      --------------------------------------------------
A0A3P9DPJ5_BMF-01      --------------------------------------------------
A0A3P9DPJ5_BMF-02      --------------------------------------------------
A0A3B4ETH0_BMF-01      --------------------------------------------------
A0A3Q3C5V2_BMF-01      --------------------------------------------------
A0A672HG10_BMF-01      --------------------------------------------------
A0A3P8UA78_BMF-02      --------------------------------------------------
A0A3P8UA78_BMF-01      --------------------------------------------------
A0A3P8UA78_BMF-03      --------------------------------------------------
A0A3Q3GUU5_BMF-01      --------------------------------------------------
A0A3Q3VLX6_BMF-01      --------------------------------------------------
A0A3Q2ZA20_BMF-01      --------------------------------------------------
A0A667YNR9_BMF-01      --------------------------------------------------
A0A3Q3LME3_BMF-01      --------------------------------------------------
A0A3Q3LME3_BMF-02      --------------------------------------------------
A0A3Q3LME3_BMF-03      --------------------------------------------------
A0A3Q1IPR4_BMF-01      --------------------------------------------------
A0A3Q3QZ16_BMF-01      --------------------------------------------------
A0A3Q3QZ16_BMF-02      --------------------------------------------------
A0A665VG08_BMF-01      --------------------------------------------------
A0A673C8N3_BMF-01      --------------------------------------------------
A0A3Q1FVH7_BMF-01      --------------------------------------------------
A0A3Q1FVH7_BMF-02      --------------------------------------------------
A0A3B5B8F6_BMF-01      --------------------------------------------------
A0A3Q1D1K3_BMF-01      --------------------------------------------------
A0A3P8RKY9_BMF-01      --------------------------------------------------
A0A671X848_BMF-01      --------------------------------------------------
A0A0F8AD62_BMF-01      --------------------------------------------------
A0A4W6DUL1_BMF-01      --------------------------------------------------
A0A2U9CJH3_BMF-01      --------------------------------------------------
A0A3B4U5H8_BMF-01      --------------------------------------------------
A0A3B4WM88_BMF-01      --------------------------------------------------
A0A3P8ZIE7_BMF-01      --------------------------------------------------
A0A4W5N3A7_BMF-01      --------------------------------------------------
A0A6F9BGV6_BMF-01      --------------------------------------------------
A0A1S3SNN2_BMF-01      --------------------------------------------------
A0A674EF64_BMF-01      --------------------------------------------------
A0A1S3P5K4_BMF-01      --------------------------------------------------
A0A6F9B4C5_BMF-01      --------------------------------------------------
A0A4W5N721_BMF-01      --------------------------------------------------
A0A1S3P5K4_BMF-02      --------------------------------------------------
A0A673YQV3_BMF-01      --------------------------------------------------
A0A4W4DZH9_BMF-01      --------------------------------------------------
A0A3B4CNJ8_BMF-01      --------------------------------------------------
A0A3B1K1X5_BMF-01      --------------------------------------------------
A0A3B4B6Y3_BMF-01      --------------------------------------------------
A0A6I8NF73_BMF-01      --------------------------------------------------
A0A5F8GKJ8_BMF-01      --------------------------------------------------
G3WDQ2_BMF-01          --------------------------------------------------
A0A4X2KLG2_BMF-01      --------------------------------------------------
Q8K589_BMF-01          --------------------------------------------------
Q91ZE9_BMF-02          --------------------------------------------------
Q91ZE9_BMF-01          --------------------------------------------------
Q91ZE9_BMF-06          --------------------------------------------------
A0A287CXH0_BMF-01      --------------------------------------------------
A0A287CXH0_BMF-02      --------------------------------------------------
A0A671DWL6_BMF-01      --------------------------------------------------
A0A671DWL6_BMF-02      --------------------------------------------------
A0A2K6FFN3_BMF-01      --------------------------------------------------
A0A2K6FFN3_BMF-02      --------------------------------------------------
A0A673TA87_BMF-01      cagcccgctgggctctttccctccttcccaattgagtctgggcgccaagc
L8IXF5_BMF-01          --------------------------------------------------
A0A4W2EII1_BMF-01      --------------------------------------------------
A0A4W2EII1_BMF-01      --------------------------------------------------
Q05KI3_BMF-01          --------------------------------------------------
Q05KI3_BMF-02          --------------------------------------------------
A0A4W2INA4_BMF-01      --------------------------------------------------
A0A4W2INA4_BMF-01      --------------------------------------------------
A0A452F2E0_BMF-01      --------------------------------------------------
A0A452F2E0_BMF-02      --------------------------------------------------
W5QFV1_BMF-01          --------------------------------------------------
H0WYH6_BMF-01          --------------------------------------------------
A0A337ST43_BMF-02      --------------------------------------------------
A0A337ST43_BMF-03      --------------------------------------------------
A0A337ST43_BMF-05      --------------------------------------------------
A0A337ST43_BMF-01      --------------------------------------------------
A0A337ST43_BMF-04      --------------------------------------------------
A0A667H967_BMF-01      --------------------------------------------------
M3YAD5_BMF-01          --------------------------------------------------
U6CSY8_BMF-01          --------------------------------------------------
A0A452SED0_BMF-01      --------------------------------------------------
A0A384D070_BMF-01      --------------------------------------------------
A0A5F4CJ04_BMF-04      --------------------------------------------------
A0A5F4CJ04_BMF-03      --------------------------------------------------
A0A5F4CJ04_BMF-01      --------------------------------------------------
A0A5F4CJ04_BMF-02      --------------------------------------------------
A0A4X1UQ42_BMF-01      --------------------------------------------------
A0A4X1UQ42_BMF-02      --------------------------------------------------
A0A287AIU8_BMF-01      --------------------------------------------------
A0A287AIU8_BMF-02      --------------------------------------------------
A0A3Q2HR24_BMF-01      --------------------------------------------------
A0A3Q2HR24_BMF-02      --------------------------------------------------
G1SR62_BMF-01          --------------------------------------------------
A0A286XXB0_BMF-03      --------------------------------------------------
A0A286XXB0_BMF-01      --------------------------------------------------
A0A286XXB0_BMF-02      --------------------------------------------------
A0A2K5KGP2_BMF-01      --------------------------------------------------
A0A0D9R4R5_BMF-01      --------------------------------------------------
A0A2K5VLE9_BMF-01      --------------------------------------------------
A0A2K5VLE9_BMF-02      --------------------------------------------------
A0A096NTE9_BMF-02      --------------------------------------------------
A0A096NTE9_BMF-01      --------------------------------------------------
A0A096NTE9_BMF-03      --------------------------------------------------
A0A5F7ZML1_BMF-01      --------------------------------------------------
A0A5F7ZML1_BMF-02      --------------------------------------------------
A0A5F7ZML1_BMF-03      --------------------------------------------------
A0A2K5MJW4_BMF-01      --------------------------------------------------
A0A2K6B5F6_BMF-03      --------------------------------------------------
A0A2K5Z4A9_BMF-02      --------------------------------------------------
A0A2K5MJW4_BMF-02      --------------------------------------------------
A0A2K6B5F6_BMF-01      --------------------------------------------------
A0A2K6B5F6_BMF-02      --------------------------------------------------
A0A2K6B5F6_BMF-04      --------------------------------------------------
A0A2K5Z4A9_BMF-01      --------------------------------------------------
A0A2K5KGP2_BMF-02      --------------------------------------------------
A0A2K6RAW1_BMF-02      --------------------------------------------------
A0A2K6RAW1_BMF-01      --------------------------------------------------
A0A2K6L919_BMF-01      --------------------------------------------------
A0A2K6L919_BMF-03      --------------------------------------------------
A0A2K6L919_BMF-02      --------------------------------------------------
A0A2U4BC98_BMF-01      --------------------------------------------------
G1PAU1_BMF-01          --------------------------------------------------
A0A2I3HD83_BMF-01      --------------------------------------------------
A0A2K6TW78_BMF-03      --------------------------------------------------
A0A2K6TW78_BMF-02      --------------------------------------------------
A0A2K6TW78_BMF-01      --------------------------------------------------
A0A2J8T301_BMF-01      --------------------------------------------------
G3T7Z4_BMF-01          --------------------------------------------------
A0A2K5RN49_BMF-02      --------------------------------------------------
A0A2K5RN49_BMF-01      --------------------------------------------------
F7HZL0_BMF-01          --------------------------------------------------
A0A2K5E1Q4_BMF-02      --------------------------------------------------
A0A2K5E1Q4_BMF-01      --------------------------------------------------
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          --------------------------------------------------
Q96LC9_BMF-02          --------------------------------------------------
Q96LC9_BMF-03          --------------------------------------------------
Q96LC9_BMF-04          --------------------------------------------------
A0A2J8QDD5_BMF-01      --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
Q96LC9_BMF-06          --------------------------------------------------
A0A2I2Z168_BMF-02      --------------------------------------------------
A0A2I2Z168_BMF-01      --------------------------------------------------
Q96LC9_BMF-08          --------------------------------------------------
A0A2R9BS98_BMF-01      --------------------------------------------------
A0A2J8QDD5_BMF-02      --------------------------------------------------
                                                                         

A0A672RK14_BMF-01      --------------------------------------------------
A0A673JJ10_BMF-01      --------------------------------------------------
A0A3B4UNJ0_BMF-01      --------------------------------------------------
W5N4P7_BMF-01          --------------------------------------------------
A3KND0_BMF-01          --------------------------------------------------
Q0GKC7_BMF-01          --------------------------------------------------
A0A671M0H4_BMF-01      --------------------------------------------------
A0A671M0H4_BMF-02      --------------------------------------------------
A0A671MNR9_BMF-01      --------------------------------------------------
A0A672JWL9_BMF-01      --------------------------------------------------
A0A672JWL9_BMF-02      --------------------------------------------------
A0A673HDR4_BMF-01      --------------------------------------------------
A0A3B3RH63_BMF-01      --------------------------------------------------
K7FRX2_BMF-01          ------------------------------------------------ga
A0A452H3N6_BMF-01      ------------------------------------------------ga
A0A674IPL3_BMF-01      ------------------------------------------------ga
A0A493T7X1_BMF-01      ------------------------------------------------ga
A0A3Q2UCA0_BMF-01      ------------------------------------------------ga
A0A3Q2UCA0_BMF-02      ------------------------------------------------ga
A0A669PL85_BMF-02      ------------------------------------------------ga
A0A493T7X1_BMF-02      ------------------------------------------------ga
A0A3Q2UCA0_BMF-03      ------------------------------------------------ga
A0A3Q2UCA0_BMF-04      ------------------------------------------------ga
A9XRH0_BMF-01          ------------------------------------------------ga
G1NHG8_BMF-01          ------------------------------------------------ga
A0A669PL85_BMF-01      ------------------------------------------------ga
U3JS06_BMF-01          ------------------------------------------------ga
A0A674GIP8_BMF-03      ------------------------------------------------ga
A0A674GIP8_BMF-01      ------------------------------------------------ga
A0A674GIP8_BMF-02      ------------------------------------------------ga
A0A672V891_BMF-01      ------------------------------------------------ga
A0A663DZQ4_BMF-01      ------------------------------------------------ga
A0A663MPI8_BMF-01      ------------------------------------------------ga
A0A670XMZ5_BMF-01      ------------------------------------------------ga
H9GL49_BMF-01          ------------------------------------------------ga
A0A670JUU6_BMF-01      ------------------------------------------------ga
A0A670JUU6_BMF-05      ------------------------------------------------ga
A0A670JUU6_BMF-04      ------------------------------------------------ga
A0A670JUU6_BMF-02      ------------------------------------------------ga
A0A670JUU6_BMF-03      ------------------------------------------------ga
A0A4W3JXA1_BMF-01      --------------------------------------------------
A0A3Q2CXC4_BMF-01      --------------------------------------------------
A0A3Q2CXC4_BMF-02      --------------------------------------------------
A0A3B5QK08_BMF-01      --------------------------------------------------
A0A3B5QK08_BMF-02      --------------------------------------------------
A0A096LRV0_BMF-01      --------------------------------------------------
A0A3B3WU80_BMF-01      --------------------------------------------------
A0A3P9Q8E2_BMF-01      --------------------------------------------------
A0A3Q2PJX9_BMF-01      --------------------------------------------------
A0A3Q2PJX9_BMF-03      --------------------------------------------------
A0A3Q2PJX9_BMF-02      --------------------------------------------------
A0A3Q2YCX7_BMF-01      --------------------------------------------------
A0A3Q2YCX7_BMF-02      --------------------------------------------------
A0A3B5KWG6_BMF-02      --------------------------------------------------
A0A3B5KWG6_BMF-01      --------------------------------------------------
A0A3B5KWG6_BMF-03      --------------------------------------------------
A0A3B3CGR9_BMF-01      --------------------------------------------------
A0A3P9K487_BMF-01      --------------------------------------------------
A0A3P9K487_BMF-02      --------------------------------------------------
A0A3B3HAU1_BMF-01      --------------------------------------------------
A0A3B3HAU1_BMF-02      --------------------------------------------------
A0A3B3HAU1_BMF-03      --------------------------------------------------
A0A3B3HAU1_BMF-04      --------------------------------------------------
A0A3P9ICE1_BMF-04      --------------------------------------------------
A0A3P9ICE1_BMF-01      --------------------------------------------------
A0A3P9ICE1_BMF-02      --------------------------------------------------
A0A3P9ICE1_BMF-03      --------------------------------------------------
A0A3P9ICE1_BMF-05      --------------------------------------------------
A0A3P8NFE2_BMF-02      --------------------------------------------------
A0A668TQU8_BMF-01      --------------------------------------------------
I3K2D6_BMF-01          --------------------------------------------------
A0A3Q4G1I4_BMF-01      --------------------------------------------------
A0A3P8NFE2_BMF-01      --------------------------------------------------
A0A3P9DPJ5_BMF-01      --------------------------------------------------
A0A3P9DPJ5_BMF-02      --------------------------------------------------
A0A3B4ETH0_BMF-01      --------------------------------------------------
A0A3Q3C5V2_BMF-01      --------------------------------------------------
A0A672HG10_BMF-01      --------------------------------------------------
A0A3P8UA78_BMF-02      --------------------------------------------------
A0A3P8UA78_BMF-01      --------------------------------------------------
A0A3P8UA78_BMF-03      --------------------------------------------------
A0A3Q3GUU5_BMF-01      --------------------------------------------------
A0A3Q3VLX6_BMF-01      --------------------------------------------------
A0A3Q2ZA20_BMF-01      --------------------------------------------------
A0A667YNR9_BMF-01      --------------------------------------------------
A0A3Q3LME3_BMF-01      --------------------------------------------------
A0A3Q3LME3_BMF-02      --------------------------------------------------
A0A3Q3LME3_BMF-03      --------------------------------------------------
A0A3Q1IPR4_BMF-01      --------------------------------------------------
A0A3Q3QZ16_BMF-01      --------------------------------------------------
A0A3Q3QZ16_BMF-02      --------------------------------------------------
A0A665VG08_BMF-01      --------------------------------------------------
A0A673C8N3_BMF-01      --------------------------------------------------
A0A3Q1FVH7_BMF-01      --------------------------------------------------
A0A3Q1FVH7_BMF-02      --------------------------------------------------
A0A3B5B8F6_BMF-01      --------------------------------------------------
A0A3Q1D1K3_BMF-01      --------------------------------------------------
A0A3P8RKY9_BMF-01      --------------------------------------------------
A0A671X848_BMF-01      --------------------------------------------------
A0A0F8AD62_BMF-01      --------------------------------------------------
A0A4W6DUL1_BMF-01      --------------------------------------------------
A0A2U9CJH3_BMF-01      --------------------------------------------------
A0A3B4U5H8_BMF-01      --------------------------------------------------
A0A3B4WM88_BMF-01      --------------------------------------------------
A0A3P8ZIE7_BMF-01      --------------------------------------------------
A0A4W5N3A7_BMF-01      --------------------------------------------------
A0A6F9BGV6_BMF-01      --------------------------------------------------
A0A1S3SNN2_BMF-01      --------------------------------------------------
A0A674EF64_BMF-01      --------------------------------------------------
A0A1S3P5K4_BMF-01      --------------------------------------------------
A0A6F9B4C5_BMF-01      --------------------------------------------------
A0A4W5N721_BMF-01      --------------------------------------------------
A0A1S3P5K4_BMF-02      --------------------------------------------------
A0A673YQV3_BMF-01      --------------------------------------------------
A0A4W4DZH9_BMF-01      --------------------------------------------------
A0A3B4CNJ8_BMF-01      --------------------------------------------------
A0A3B1K1X5_BMF-01      ------------------------------------------------gt
A0A3B4B6Y3_BMF-01      --------------------------------------------------
A0A6I8NF73_BMF-01      ------------------------------------------------gt
A0A5F8GKJ8_BMF-01      ------------------------------------------------ga
G3WDQ2_BMF-01          ------------------------------------------------ga
A0A4X2KLG2_BMF-01      ------------------------------------------------ga
Q8K589_BMF-01          ------------------------------------------------ga
Q91ZE9_BMF-02          ------------------------------------------------ga
Q91ZE9_BMF-01          ------------------------------------------------ga
Q91ZE9_BMF-06          ------------------------------------------------ga
A0A287CXH0_BMF-01      ------------------------------------------------ga
A0A287CXH0_BMF-02      ------------------------------------------------ga
A0A671DWL6_BMF-01      ------------------------------------------------ga
A0A671DWL6_BMF-02      ------------------------------------------------ga
A0A2K6FFN3_BMF-01      ------------------------------------------------ga
A0A2K6FFN3_BMF-02      ------------------------------------------------ga
A0A673TA87_BMF-01      ccccgagtgttcgtcacgctggaccctggcgcggagccctggcatcacga
L8IXF5_BMF-01          ------------------------------------------------ga
A0A4W2EII1_BMF-01      ------------------------------------------------ga
A0A4W2EII1_BMF-01      ------------------------------------------------ga
Q05KI3_BMF-01          ------------------------------------------------ga
Q05KI3_BMF-02          ------------------------------------------------ga
A0A4W2INA4_BMF-01      ------------------------------------------------ga
A0A4W2INA4_BMF-01      ------------------------------------------------ga
A0A452F2E0_BMF-01      ------------------------------------------------ga
A0A452F2E0_BMF-02      ------------------------------------------------ga
W5QFV1_BMF-01          ------------------------------------------------ga
H0WYH6_BMF-01          ------------------------------------------------ga
A0A337ST43_BMF-02      ------------------------------------------------ga
A0A337ST43_BMF-03      ------------------------------------------------ga
A0A337ST43_BMF-05      ------------------------------------------------ga
A0A337ST43_BMF-01      ------------------------------------------------ga
A0A337ST43_BMF-04      ------------------------------------------------ga
A0A667H967_BMF-01      ------------------------------------------------ga
M3YAD5_BMF-01          ------------------------------------------------ga
U6CSY8_BMF-01          ------------------------------------------------ga
A0A452SED0_BMF-01      ------------------------------------------------ga
A0A384D070_BMF-01      ------------------------------------------------ga
A0A5F4CJ04_BMF-04      ------------------------------------------------ga
A0A5F4CJ04_BMF-03      ------------------------------------------------ga
A0A5F4CJ04_BMF-01      ------------------------------------------------ga
A0A5F4CJ04_BMF-02      ------------------------------------------------ga
A0A4X1UQ42_BMF-01      ------------------------------------------------ga
A0A4X1UQ42_BMF-02      ------------------------------------------------ga
A0A287AIU8_BMF-01      ------------------------------------------------ga
A0A287AIU8_BMF-02      ------------------------------------------------ga
A0A3Q2HR24_BMF-01      ------------------------------------------------ga
A0A3Q2HR24_BMF-02      ------------------------------------------------ga
G1SR62_BMF-01          ------------------------------------------------ga
A0A286XXB0_BMF-03      ------------------------------------------------ga
A0A286XXB0_BMF-01      ------------------------------------------------ga
A0A286XXB0_BMF-02      ------------------------------------------------ga
A0A2K5KGP2_BMF-01      ------------------------------------------------ga
A0A0D9R4R5_BMF-01      ------------------------------------------------ga
A0A2K5VLE9_BMF-01      ------------------------------------------------ga
A0A2K5VLE9_BMF-02      ------------------------------------------------ga
A0A096NTE9_BMF-02      ------------------------------------------------ga
A0A096NTE9_BMF-01      ------------------------------------------------ga
A0A096NTE9_BMF-03      ------------------------------------------------ga
A0A5F7ZML1_BMF-01      ------------------------------------------------ga
A0A5F7ZML1_BMF-02      ------------------------------------------------ga
A0A5F7ZML1_BMF-03      ------------------------------------------------ga
A0A2K5MJW4_BMF-01      ------------------------------------------------ga
A0A2K6B5F6_BMF-03      ------------------------------------------------ga
A0A2K5Z4A9_BMF-02      ------------------------------------------------ga
A0A2K5MJW4_BMF-02      ------------------------------------------------ga
A0A2K6B5F6_BMF-01      ------------------------------------------------ga
A0A2K6B5F6_BMF-02      ------------------------------------------------ga
A0A2K6B5F6_BMF-04      ------------------------------------------------ga
A0A2K5Z4A9_BMF-01      ------------------------------------------------ga
A0A2K5KGP2_BMF-02      ------------------------------------------------ga
A0A2K6RAW1_BMF-02      ------------------------------------------------ga
A0A2K6RAW1_BMF-01      ------------------------------------------------ga
A0A2K6L919_BMF-01      ------------------------------------------------ga
A0A2K6L919_BMF-03      ------------------------------------------------ga
A0A2K6L919_BMF-02      ------------------------------------------------ga
A0A2U4BC98_BMF-01      ------------------------------------------------ga
G1PAU1_BMF-01          ------------------------------------------------ga
A0A2I3HD83_BMF-01      ------------------------------------------------ga
A0A2K6TW78_BMF-03      ------------------------------------------------ga
A0A2K6TW78_BMF-02      ------------------------------------------------ga
A0A2K6TW78_BMF-01      ------------------------------------------------ga
A0A2J8T301_BMF-01      ------------------------------------------------ga
G3T7Z4_BMF-01          ------------------------------------------------ga
A0A2K5RN49_BMF-02      ------------------------------------------------ga
A0A2K5RN49_BMF-01      ------------------------------------------------ga
F7HZL0_BMF-01          ------------------------------------------------ga
A0A2K5E1Q4_BMF-02      ------------------------------------------------ga
A0A2K5E1Q4_BMF-01      ------------------------------------------------ga
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          ------------------------------------------------ga
Q96LC9_BMF-07          ------------------------------------------------ga
Q96LC9_BMF-01          ------------------------------------------------ga
Q96LC9_BMF-02          ------------------------------------------------ga
Q96LC9_BMF-03          ------------------------------------------------ga
Q96LC9_BMF-04          ------------------------------------------------ga
A0A2J8QDD5_BMF-01      ------------------------------------------------ga
A0A2R9BS98_BMF-02      ------------------------------------------------ga
Q96LC9_BMF-06          ------------------------------------------------ga
A0A2I2Z168_BMF-02      ------------------------------------------------ga
A0A2I2Z168_BMF-01      ------------------------------------------------ga
Q96LC9_BMF-08          ------------------------------------------------ga
A0A2R9BS98_BMF-01      ------------------------------------------------ga
A0A2J8QDD5_BMF-02      ------------------------------------------------ga
                                                                         

A0A672RK14_BMF-01      --------------------------------------------------
A0A673JJ10_BMF-01      --------------------------------------------------
A0A3B4UNJ0_BMF-01      --------------------------------------------------
W5N4P7_BMF-01          --------------------------------------------------
A3KND0_BMF-01          -------------------------------------tgcatttggatac
Q0GKC7_BMF-01          --------------------------------------------------
A0A671M0H4_BMF-01      --------------------------------------------------
A0A671M0H4_BMF-02      --------------------------------------------------
A0A671MNR9_BMF-01      --------------------------------------------------
A0A672JWL9_BMF-01      --------------------------------------------------
A0A672JWL9_BMF-02      --------------------------------------------------
A0A673HDR4_BMF-01      --------------------------------------------------
A0A3B3RH63_BMF-01      --------------------------------------------------
K7FRX2_BMF-01          ctttggactcacagg----------------------------------t
A0A452H3N6_BMF-01      ctttggactcacagg----------------------------------t
A0A674IPL3_BMF-01      ctttggactcacagg----------------------------------t
A0A493T7X1_BMF-01      ctttggacttgcagg----------------------------------t
A0A3Q2UCA0_BMF-01      ctttggacttgcagg----------------------------------t
A0A3Q2UCA0_BMF-02      ctttggacttgcagg----------------------------------t
A0A669PL85_BMF-02      ctttggacttgcagg----------------------------------t
A0A493T7X1_BMF-02      ctttggacttgcagg----------------------------------t
A0A3Q2UCA0_BMF-03      ctttggacttgcagg----------------------------------t
A0A3Q2UCA0_BMF-04      ctttggacttgcagg----------------------------------t
A9XRH0_BMF-01          ctttggacttgca-------------------------------------
G1NHG8_BMF-01          ctttggacttgcagg----------------------------------t
A0A669PL85_BMF-01      ctttggacttgcagg----------------------------------t
U3JS06_BMF-01          ctttggacttgcagg----------------------------------t
A0A674GIP8_BMF-03      ctttggacttgcagg----------------------------------t
A0A674GIP8_BMF-01      ctttggacttgcagg----------------------------------t
A0A674GIP8_BMF-02      ctttggacttgcagg----------------------------------t
A0A672V891_BMF-01      ctttggacttgcagg----------------------------------t
A0A663DZQ4_BMF-01      ctttggacttgcagg----------------------------------t
A0A663MPI8_BMF-01      ctttggacttgcagg----------------------------------t
A0A670XMZ5_BMF-01      ctgtgaactggtcag----------------------------------t
H9GL49_BMF-01          ctgtggacttgccag----------------------------------t
A0A670JUU6_BMF-01      ctgtggacttgccag----------------------------------t
A0A670JUU6_BMF-05      ctgtggacttgccag----------------------------------t
A0A670JUU6_BMF-04      ctgtggacttgccag----------------------------------t
A0A670JUU6_BMF-02      ctgtggacttgccag----------------------------------t
A0A670JUU6_BMF-03      ctgtggacttgccag----------------------------------t
A0A4W3JXA1_BMF-01      ----------------------------------------cctgacggcc
A0A3Q2CXC4_BMF-01      --------------------------------------------------
A0A3Q2CXC4_BMF-02      --------------------------------------------------
A0A3B5QK08_BMF-01      --------------------------------------------------
A0A3B5QK08_BMF-02      --------------------------------------------------
A0A096LRV0_BMF-01      --------------------------------------------------
A0A3B3WU80_BMF-01      --------------------------------------------------
A0A3P9Q8E2_BMF-01      --------------------------------------------------
A0A3Q2PJX9_BMF-01      --------------------------------------------------
A0A3Q2PJX9_BMF-03      --------------------------------------------------
A0A3Q2PJX9_BMF-02      --------------------------------------------------
A0A3Q2YCX7_BMF-01      --------------------------------------------------
A0A3Q2YCX7_BMF-02      --------------------------------------------------
A0A3B5KWG6_BMF-02      --------------------------------------------------
A0A3B5KWG6_BMF-01      --------------------------------------------------
A0A3B5KWG6_BMF-03      --------------------------------------------------
A0A3B3CGR9_BMF-01      --------------------------------------------------
A0A3P9K487_BMF-01      --------------------------------------------------
A0A3P9K487_BMF-02      --------------------------------------------------
A0A3B3HAU1_BMF-01      --------------------------------------------------
A0A3B3HAU1_BMF-02      --------------------------------------------------
A0A3B3HAU1_BMF-03      --------------------------------------------------
A0A3B3HAU1_BMF-04      --------------------------------------------------
A0A3P9ICE1_BMF-04      --------------------------------------------------
A0A3P9ICE1_BMF-01      --------------------------------------------------
A0A3P9ICE1_BMF-02      --------------------------------------------------
A0A3P9ICE1_BMF-03      --------------------------------------------------
A0A3P9ICE1_BMF-05      --------------------------------------------------
A0A3P8NFE2_BMF-02      --------------------------------------------------
A0A668TQU8_BMF-01      --------------------------------------------------
I3K2D6_BMF-01          --------------------------------------------------
A0A3Q4G1I4_BMF-01      --------------------------------------------------
A0A3P8NFE2_BMF-01      --------------------------------------------------
A0A3P9DPJ5_BMF-01      --------------------------------------------------
A0A3P9DPJ5_BMF-02      --------------------------------------------------
A0A3B4ETH0_BMF-01      --------------------------------------------------
A0A3Q3C5V2_BMF-01      --------------------------------------------------
A0A672HG10_BMF-01      --------------------------------------------------
A0A3P8UA78_BMF-02      --------------------------------------------------
A0A3P8UA78_BMF-01      --------------------------------------------------
A0A3P8UA78_BMF-03      --------------------------------------------------
A0A3Q3GUU5_BMF-01      --------------------------------------------------
A0A3Q3VLX6_BMF-01      --------------------------------------------------
A0A3Q2ZA20_BMF-01      --------------------------------------------------
A0A667YNR9_BMF-01      --------------------------------------------------
A0A3Q3LME3_BMF-01      --------------------------------------------------
A0A3Q3LME3_BMF-02      --------------------------------------------------
A0A3Q3LME3_BMF-03      --------------------------------------------------
A0A3Q1IPR4_BMF-01      --------------------------------------------------
A0A3Q3QZ16_BMF-01      --------------------------------------------------
A0A3Q3QZ16_BMF-02      --------------------------------------------------
A0A665VG08_BMF-01      --------------------------------------------------
A0A673C8N3_BMF-01      --------------------------------------------------
A0A3Q1FVH7_BMF-01      --------------------------------------------------
A0A3Q1FVH7_BMF-02      --------------------------------------------------
A0A3B5B8F6_BMF-01      --------------------------------------------------
A0A3Q1D1K3_BMF-01      --------------------------------------------------
A0A3P8RKY9_BMF-01      --------------------------------------------------
A0A671X848_BMF-01      --------------------------------------------------
A0A0F8AD62_BMF-01      --------------------------------------------------
A0A4W6DUL1_BMF-01      --------------------------------------------------
A0A2U9CJH3_BMF-01      --------------------------------------------------
A0A3B4U5H8_BMF-01      --------------------------------------------------
A0A3B4WM88_BMF-01      --------------------------------------------------
A0A3P8ZIE7_BMF-01      --------------------------------------------------
A0A4W5N3A7_BMF-01      --------------------------------------------------
A0A6F9BGV6_BMF-01      --------------------------------------------------
A0A1S3SNN2_BMF-01      --------------------------------------------------
A0A674EF64_BMF-01      --------------------------------------------------
A0A1S3P5K4_BMF-01      --------------------------------------------------
A0A6F9B4C5_BMF-01      --------------------------------------------------
A0A4W5N721_BMF-01      --------------------------------------------------
A0A1S3P5K4_BMF-02      --------------------------------------------------
A0A673YQV3_BMF-01      --------------------------------------------------
A0A4W4DZH9_BMF-01      --------------------------------------------------
A0A3B4CNJ8_BMF-01      --------------------------------------------------
A0A3B1K1X5_BMF-01      tacggatccagagcc-----------------------------------
A0A3B4B6Y3_BMF-01      --------------------------------------------------
A0A6I8NF73_BMF-01      ggcggagtccctggc----------------------------------a
A0A5F8GKJ8_BMF-01      ctcagagcctggtgc----------------------------------t
G3WDQ2_BMF-01          ctcagagcctggtgc----------------------------------t
A0A4X2KLG2_BMF-01      ttcagagcctggtgc----------------------------------g
Q8K589_BMF-01          tggggagccagggac----------------------------------a
Q91ZE9_BMF-02          tggggagccagggac----------------------------------a
Q91ZE9_BMF-01          tggggagccagggac----------------------------------a
Q91ZE9_BMF-06          tggggagccagggac----------------------------------a
A0A287CXH0_BMF-01      tggggagccagggac----------------------------------c
A0A287CXH0_BMF-02      tggggagccagggac----------------------------------c
A0A671DWL6_BMF-01      tggggatctggggac----------------------------------c
A0A671DWL6_BMF-02      tggggatctggggac----------------------------------c
A0A2K6FFN3_BMF-01      tggggagtcggggac----------------------------------c
A0A2K6FFN3_BMF-02      tggggagtcggggac----------------------------------c
A0A673TA87_BMF-01      ctcggaggcggagactctctcctggagtcacccagcaggggagatggagc
L8IXF5_BMF-01          tggggagccggggac----------------------------------c
A0A4W2EII1_BMF-01      tggggagccggggac----------------------------------c
A0A4W2EII1_BMF-01      tggggagccggggac----------------------------------c
Q05KI3_BMF-01          tggggagccggggac----------------------------------c
Q05KI3_BMF-02          tggggagccggggac----------------------------------c
A0A4W2INA4_BMF-01      tggggagccggggac----------------------------------c
A0A4W2INA4_BMF-01      tggggagccggggac----------------------------------c
A0A452F2E0_BMF-01      tggggaaccaggggc----------------------------------c
A0A452F2E0_BMF-02      tggggaaccaggggc----------------------------------c
W5QFV1_BMF-01          tggggagccaggggc----------------------------------c
H0WYH6_BMF-01          tggggagctgggga------------------------------------
A0A337ST43_BMF-02      tgtggagccggggac----------------------------------c
A0A337ST43_BMF-03      tgtggagccggggac----------------------------------c
A0A337ST43_BMF-05      tgtggagccggggac----------------------------------c
A0A337ST43_BMF-01      tgtggagccggggac----------------------------------c
A0A337ST43_BMF-04      tgtggagccggggac----------------------------------c
A0A667H967_BMF-01      tggggagccggggac----------------------------------c
M3YAD5_BMF-01          tggggagccggggac----------------------------------c
U6CSY8_BMF-01          tggggagccggggac----------------------------------c
A0A452SED0_BMF-01      cggggagccggggac----------------------------------c
A0A384D070_BMF-01      tggggagccggggac----------------------------------c
A0A5F4CJ04_BMF-04      tggggagccggggac----------------------------------c
A0A5F4CJ04_BMF-03      tggggagccggggac----------------------------------c
A0A5F4CJ04_BMF-01      tggggagccggggac----------------------------------c
A0A5F4CJ04_BMF-02      tggggagccggggac----------------------------------c
A0A4X1UQ42_BMF-01      aggggagccggggac----------------------------------c
A0A4X1UQ42_BMF-02      aggggagccggggac----------------------------------c
A0A287AIU8_BMF-01      aggggagccggggac----------------------------------c
A0A287AIU8_BMF-02      aggggagccggggac----------------------------------c
A0A3Q2HR24_BMF-01      tggggagccggggac----------------------------------c
A0A3Q2HR24_BMF-02      tggggagccggggac----------------------------------c
G1SR62_BMF-01          cggggagccggggac----------------------------------c
A0A286XXB0_BMF-03      tggggagccggggac----------------------------------c
A0A286XXB0_BMF-01      tggggagccggggac----------------------------------c
A0A286XXB0_BMF-02      tggggagccggggac----------------------------------c
A0A2K5KGP2_BMF-01      cggggagccgggggc----------------------------------c
A0A0D9R4R5_BMF-01      cggagagccgggggc----------------------------------c
A0A2K5VLE9_BMF-01      cggggagccggggtc----------------------------------c
A0A2K5VLE9_BMF-02      cggggagccggggtc----------------------------------c
A0A096NTE9_BMF-02      cggggagccgggggc----------------------------------c
A0A096NTE9_BMF-01      cggggagccgggggc----------------------------------c
A0A096NTE9_BMF-03      cggggagccgggggc----------------------------------c
A0A5F7ZML1_BMF-01      cggggagccgggggc----------------------------------c
A0A5F7ZML1_BMF-02      cggggagccgggggc----------------------------------c
A0A5F7ZML1_BMF-03      cggggagccgggggc----------------------------------c
A0A2K5MJW4_BMF-01      cggggagccaggggc----------------------------------c
A0A2K6B5F6_BMF-03      cggggagccgggggc----------------------------------c
A0A2K5Z4A9_BMF-02      cggggagccgggggc----------------------------------c
A0A2K5MJW4_BMF-02      cggggagccaggggc----------------------------------c
A0A2K6B5F6_BMF-01      cggggagccgggggc----------------------------------c
A0A2K6B5F6_BMF-02      cggggagccgggggc----------------------------------c
A0A2K6B5F6_BMF-04      cggggagccgggggc----------------------------------c
A0A2K5Z4A9_BMF-01      cggggagccgggggc----------------------------------c
A0A2K5KGP2_BMF-02      cggggagccgggggc----------------------------------c
A0A2K6RAW1_BMF-02      cggggagccgggggc----------------------------------c
A0A2K6RAW1_BMF-01      cggggagccgggggc----------------------------------c
A0A2K6L919_BMF-01      cggggagccgggggc----------------------------------c
A0A2K6L919_BMF-03      cggggagccgggggc----------------------------------c
A0A2K6L919_BMF-02      cggggagccgggggc----------------------------------c
A0A2U4BC98_BMF-01      tggggagccggggac----------------------------------c
G1PAU1_BMF-01          t---gagctggggac----------------------------------c
A0A2I3HD83_BMF-01      tggggagccgggcac----------------------------------c
A0A2K6TW78_BMF-03      tggggagccagggac----------------------------------c
A0A2K6TW78_BMF-02      tggggagccagggac----------------------------------c
A0A2K6TW78_BMF-01      tggggagccagggac----------------------------------c
A0A2J8T301_BMF-01      tggggagccggggac----------------------------------c
G3T7Z4_BMF-01          gggggagcctgggac----------------------------------c
A0A2K5RN49_BMF-02      tggggagccagggac----------------------------------c
A0A2K5RN49_BMF-01      tggggagccagggac----------------------------------c
F7HZL0_BMF-01          tggggagccagggac----------------------------------c
A0A2K5E1Q4_BMF-02      tggggagccagggac----------------------------------c
A0A2K5E1Q4_BMF-01      tggggagccagggac----------------------------------c
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          tggggagccggtgac----------------------------------c
Q96LC9_BMF-07          tggggagccggtgac----------------------------------c
Q96LC9_BMF-01          tggggagccggtgac----------------------------------c
Q96LC9_BMF-02          tggggagccggtgac----------------------------------c
Q96LC9_BMF-03          tggggagccggtgac----------------------------------c
Q96LC9_BMF-04          tggggagccggtgac----------------------------------c
A0A2J8QDD5_BMF-01      tggggagccggtgac----------------------------------c
A0A2R9BS98_BMF-02      tggggagccggtgac----------------------------------c
Q96LC9_BMF-06          tggggagccggtgac----------------------------------c
A0A2I2Z168_BMF-02      tggggagccggtgac----------------------------------c
A0A2I2Z168_BMF-01      tggggagccggtgac----------------------------------c
Q96LC9_BMF-08          tggggagccggtgac----------------------------------c
A0A2R9BS98_BMF-01      tggggagccggtgac----------------------------------c
A0A2J8QDD5_BMF-02      tggggagccggtgac----------------------------------c
                                                                         

A0A672RK14_BMF-01      --------------------------------------------------
A0A673JJ10_BMF-01      --------------------------------------------------
A0A3B4UNJ0_BMF-01      --------------------------------------------------
W5N4P7_BMF-01          --------------------------------------------------
A3KND0_BMF-01          ccagatcagaccataacttcctcctcattattcaaccagagccagtccta
Q0GKC7_BMF-01          --------------------------------------------------
A0A671M0H4_BMF-01      --------------------------------------------------
A0A671M0H4_BMF-02      --------------------------------------------------
A0A671MNR9_BMF-01      --------------------------------------------------
A0A672JWL9_BMF-01      --------------------------------------------------
A0A672JWL9_BMF-02      --------------------------------------------------
A0A673HDR4_BMF-01      --------------------------------------------------
A0A3B3RH63_BMF-01      --------------------------------------------------
K7FRX2_BMF-01          cagcctggtgagatgactcctactggcattttcacacagaaccaatcgta
A0A452H3N6_BMF-01      cagcctggtgagatgacccctcctggcattttcacacagaaccaatccta
A0A674IPL3_BMF-01      cagcctggtgagatgacccctcctggcattttcacacagaaccaatccta
A0A493T7X1_BMF-01      cagcctggtgagatgactgcaacaggcattttcacacagaaccagtccta
A0A3Q2UCA0_BMF-01      cagcctggtgagatgactgcaactggcattttcacacagaaccagtccta
A0A3Q2UCA0_BMF-02      cagcctggtgagatgactgcaactggcattttcacacagaaccagtccta
A0A669PL85_BMF-02      cagcctggtgagatgactgcaactggcattttcacacagaaccagtccta
A0A493T7X1_BMF-02      cagcctggtgagatgactgcaacaggcattttcacacagaaccagtccta
A0A3Q2UCA0_BMF-03      cagcctggtgagatgactgcaactggcattttcacacagaaccagtccta
A0A3Q2UCA0_BMF-04      cagcctggtgagatgactgcaactggcattttcacacagaaccagtccta
A9XRH0_BMF-01          --------------------------------------------------
G1NHG8_BMF-01          cagcctggtgagatgactgcaactggcattttcacacagaaccagtccta
A0A669PL85_BMF-01      cagcctggtgagatgactgcaactggcattttcacacagaaccagtccta
U3JS06_BMF-01          cagcctggtgagatgactgcaactggctttttcacacagaaccagtccta
A0A674GIP8_BMF-03      cagcctggtgagatgactgcaactggctttttcacacagaaccagtccta
A0A674GIP8_BMF-01      cagcctggtgagatgactgcaactggctttttcacacagaaccagtccta
A0A674GIP8_BMF-02      cagcctggtgagatgactgcaactggctttttcacacagaaccagtccta
A0A672V891_BMF-01      cagcctggtgagatgactgcaactggcattttcacacagaaccagtccta
A0A663DZQ4_BMF-01      cagcctggtgagatgactgcaactggcattttcacacagaaccagtccta
A0A663MPI8_BMF-01      cagcctggtgaaatgactgcaactggcattttcacacagaaccagtccta
A0A670XMZ5_BMF-01      cagtccagcaagatggcctttcgtggcattttcactcaaagcaaatctta
H9GL49_BMF-01          caacccagtgagatgacctttcctggcattttcactcagagcaaatccta
A0A670JUU6_BMF-01      caacccaatgagatgacatttcctggcattttcacacagagtaaatctta
A0A670JUU6_BMF-05      caacccaatgagatgacatttcctggcattttcacacagagtaaatctta
A0A670JUU6_BMF-04      caacccaatgagatgacatttcctggcattttcacacagagtaaatctta
A0A670JUU6_BMF-02      caacccaatgagatgacatttcctggcattttcacacagagtaaatctta
A0A670JUU6_BMF-03      caacccaatgagatgacatttcctggcattttcacacagagtaaatctta
A0A4W3JXA1_BMF-01      cccgacagcggctacagcgacaacacctctggcacccacgagtctctgac
A0A3Q2CXC4_BMF-01      --------------------------------------------------
A0A3Q2CXC4_BMF-02      --------------------------------------------------
A0A3B5QK08_BMF-01      --------------------------------------------------
A0A3B5QK08_BMF-02      --------------------------------------------------
A0A096LRV0_BMF-01      --------------------------------------------------
A0A3B3WU80_BMF-01      --------------------------------------------------
A0A3P9Q8E2_BMF-01      --------------------------------------------------
A0A3Q2PJX9_BMF-01      --------------------------------------------------
A0A3Q2PJX9_BMF-03      --------------------------------------------------
A0A3Q2PJX9_BMF-02      --------------------------------------------------
A0A3Q2YCX7_BMF-01      --------------------------------------------------
A0A3Q2YCX7_BMF-02      --------------------------------------------------
A0A3B5KWG6_BMF-02      --------------------------------------------------
A0A3B5KWG6_BMF-01      --------------------------------------------------
A0A3B5KWG6_BMF-03      --------------------------------------------------
A0A3B3CGR9_BMF-01      --------------------------------------------------
A0A3P9K487_BMF-01      --------------------------------------------------
A0A3P9K487_BMF-02      --------------------------------------------------
A0A3B3HAU1_BMF-01      --------------------------------------------------
A0A3B3HAU1_BMF-02      --------------------------------------------------
A0A3B3HAU1_BMF-03      --------------------------------------------------
A0A3B3HAU1_BMF-04      --------------------------------------------------
A0A3P9ICE1_BMF-04      --------------------------------------------------
A0A3P9ICE1_BMF-01      --------------------------------------------------
A0A3P9ICE1_BMF-02      --------------------------------------------------
A0A3P9ICE1_BMF-03      --------------------------------------------------
A0A3P9ICE1_BMF-05      --------------------------------------------------
A0A3P8NFE2_BMF-02      --------------------------------------------------
A0A668TQU8_BMF-01      --------------------------------------------------
I3K2D6_BMF-01          --------------------------------------------------
A0A3Q4G1I4_BMF-01      --------------------------------------------------
A0A3P8NFE2_BMF-01      --------------------------------------------------
A0A3P9DPJ5_BMF-01      --------------------------------------------------
A0A3P9DPJ5_BMF-02      --------------------------------------------------
A0A3B4ETH0_BMF-01      --------------------------------------------------
A0A3Q3C5V2_BMF-01      --------------------------------------------------
A0A672HG10_BMF-01      --------------------------------------------------
A0A3P8UA78_BMF-02      --------------------------------------------------
A0A3P8UA78_BMF-01      --------------------------------------------------
A0A3P8UA78_BMF-03      --------------------------------------------------
A0A3Q3GUU5_BMF-01      --------------------------------------------------
A0A3Q3VLX6_BMF-01      --------------------------------------------------
A0A3Q2ZA20_BMF-01      --------------------------------------------------
A0A667YNR9_BMF-01      --------------------------------------------------
A0A3Q3LME3_BMF-01      --------------------------------------------------
A0A3Q3LME3_BMF-02      --------------------------------------------------
A0A3Q3LME3_BMF-03      --------------------------------------------------
A0A3Q1IPR4_BMF-01      --------------------------------------------------
A0A3Q3QZ16_BMF-01      --------------------------------------------------
A0A3Q3QZ16_BMF-02      --------------------------------------------------
A0A665VG08_BMF-01      --------------------------------------------------
A0A673C8N3_BMF-01      --------------------------------------------------
A0A3Q1FVH7_BMF-01      --------------------------------------------------
A0A3Q1FVH7_BMF-02      --------------------------------------------------
A0A3B5B8F6_BMF-01      --------------------------------------------------
A0A3Q1D1K3_BMF-01      --------------------------------------------------
A0A3P8RKY9_BMF-01      --------------------------------------------------
A0A671X848_BMF-01      --------------------------------------------------
A0A0F8AD62_BMF-01      --------------------------------------------------
A0A4W6DUL1_BMF-01      --------------------------------------------------
A0A2U9CJH3_BMF-01      --------------------------------------------------
A0A3B4U5H8_BMF-01      --------------------------------------------------
A0A3B4WM88_BMF-01      --------------------------------------------------
A0A3P8ZIE7_BMF-01      --------------------------------------------------
A0A4W5N3A7_BMF-01      --------------------------------------------------
A0A6F9BGV6_BMF-01      --------------------------------------------------
A0A1S3SNN2_BMF-01      --------------------------------------------------
A0A674EF64_BMF-01      --------------------------------------------------
A0A1S3P5K4_BMF-01      --------------------------------------------------
A0A6F9B4C5_BMF-01      --------------------------------------------------
A0A4W5N721_BMF-01      --------------------------------------------------
A0A1S3P5K4_BMF-02      --------------------------------------------------
A0A673YQV3_BMF-01      --------------------------------------------------
A0A4W4DZH9_BMF-01      --------aggattgcc----------------gcacagtactggccaca
A0A3B4CNJ8_BMF-01      --------------------------------------------------
A0A3B1K1X5_BMF-01      ------------ttggcgttccccgatcagtgtg----------------
A0A3B4B6Y3_BMF-01      ------------------tctgc---------------------------
A0A6I8NF73_BMF-01      cagcccggcggcccggcccccgctgccccactcacccccggtcagcccta
A0A5F8GKJ8_BMF-01      cagccagggggcctgacctcagctgctctgtttgcccagagccagcctga
G3WDQ2_BMF-01          cagccagggggcctgacctcgccagctctgtttgcccagagccagcctga
A0A4X2KLG2_BMF-01      cagccagggggcctgacctcggctgctctgtttgcccagagccagcccga
Q8K589_BMF-01          cagcctgggagcttgctctctgctgacctgtttgcccagagccagctgga
Q91ZE9_BMF-02          cagcctgggggcttgctctctgctgacctgtttgcccagagccagctgga
Q91ZE9_BMF-01          cagcctgggggcttgctctctgctgacctgtttgcccagagccagctgga
Q91ZE9_BMF-06          cagcctgggggcttgctctctgctgacctgtttgcccagagccagctgga
A0A287CXH0_BMF-01      cagcctgggagcttgctctctgctgacttgtttgcccagagccagctgga
A0A287CXH0_BMF-02      cagcctgggagcttgctctctgctgacttgtttgcccagagccagctgga
A0A671DWL6_BMF-01      cagcctgggagcttgccctctgctgacctgtttgctcagagccagctgga
A0A671DWL6_BMF-02      cagcctgggagcttgccctctgctgacctgtttgctcagagccagctgga
A0A2K6FFN3_BMF-01      cagcccgggagcgtgctctctgctgacctgtttgcccagagccagctgga
A0A2K6FFN3_BMF-02      cagcccgggagcgtgctctctgctgacctgtttgcccagagccagctgga
A0A673TA87_BMF-01      cagcctgggagcttgctgtctgccaacctgtttgcccagagccaactgga
L8IXF5_BMF-01          cagcccaggagcttgctctctgctgacctgtttgcccagagccagctgga
A0A4W2EII1_BMF-01      cagcccaggagcttgctctctgctgacctgtttgcccagagccagctgga
A0A4W2EII1_BMF-01      cagcccaggagcttgctctctgctgacctgtttgcccagagccagctgga
Q05KI3_BMF-01          cagcccaggagcttgctctctgctgacctgtttgcccagagccagctgga
Q05KI3_BMF-02          cagcccaggagcttgctctctgctgacctgtttgcccagagccagctgga
A0A4W2INA4_BMF-01      cagcccaggagcttgctctctgctgacctgtttgcccagagccagctgga
A0A4W2INA4_BMF-01      cagcccaggagcttgctctctgctgacctgtttgcccagagccagctgga
A0A452F2E0_BMF-01      cagcccaggaggttgctctctgctgacctgtttgcccagagccagctgga
A0A452F2E0_BMF-02      cagcccaggaggttgctctctgctgacctgtttgcccagagccagctgga
W5QFV1_BMF-01          cagcccaggaggttgctctctgctgacctgtttgcccagagccagctgga
H0WYH6_BMF-01          ----ctgggaatgtgctctctgctgacctgtttgcccagagccagctgga
A0A337ST43_BMF-02      cagcctgggagcttgctgtctgctaacctgtttgcccagagccagctgga
A0A337ST43_BMF-03      cagcctgggagcttgctgtctgctaacctgtttgcccagagccagctgga
A0A337ST43_BMF-05      cagcctgggagcttgctgtctgctaacctgtttgcccagagccagctgga
A0A337ST43_BMF-01      cagcctgggagcttgctgtctgctaacctgtttgcccagagccagctgga
A0A337ST43_BMF-04      cagcctgggagcttgctgtctgctaacctgtttgcccagagccagctgga
A0A667H967_BMF-01      cagcctgggagcttgctgtctgctaacctgtttgcccagagccagctgga
M3YAD5_BMF-01          cagcctgggagcttgctctctgctgacctgtttgcccagagccagctgga
U6CSY8_BMF-01          cagcctgggagcttgctctctgctgacctgtttgcccagagccagctgga
A0A452SED0_BMF-01      cagcctgggagcttgctctctgctgacctgtttgcccagagccagctgga
A0A384D070_BMF-01      cagcctgggagcttgctctctgctgacctgtttgcccagagccagctgga
A0A5F4CJ04_BMF-04      cagcctgggagcttgctctctgctgacctgtttgcccagagccagctgga
A0A5F4CJ04_BMF-03      cagcctgggagcttgctctctgctgacctgtttgcccagagccagctgga
A0A5F4CJ04_BMF-01      cagcctgggagcttgctctctgctgacctgtttgcccagagccagctgga
A0A5F4CJ04_BMF-02      cagcctgggagcttgctctctgctgacctgtttgcccagagccagctgga
A0A4X1UQ42_BMF-01      cagcccaggag---ggtctctgctgacccgtttgtccagagccagctgga
A0A4X1UQ42_BMF-02      cagcccaggag---ggtctctgctgacccgtttgtccagagccagctgga
A0A287AIU8_BMF-01      cagcccaggag---ggtctctgctgacccgtttgtccagagccagctgga
A0A287AIU8_BMF-02      cagcccaggag---ggtctctgctgacccgtttgtccagagccagctgga
A0A3Q2HR24_BMF-01      cagcccaggagcttgctctctgctgacctgtttgccccgagccagctgga
A0A3Q2HR24_BMF-02      cagcccaggagcttgctctctgctgacctgtttgccccgagccagctgga
G1SR62_BMF-01          cagccccaaagcttgctctctgctgacccgtttgcccagagccagctgga
A0A286XXB0_BMF-03      cagcctgggagcctgctctctgctgatctctttgcccagagccagctgga
A0A286XXB0_BMF-01      cagcctgggagcctgctctctgctgatctctttgcccagagccagctgga
A0A286XXB0_BMF-02      cagcctgggagcctgctctctgctgatctctttgcccagagccagctgga
A0A2K5KGP2_BMF-01      caacccgggagctcgctctctgccgatctgtttgcccagagcttacttga
A0A0D9R4R5_BMF-01      caacccgggagctcgctctctgccgatctgtttgcccagagcctacttga
A0A2K5VLE9_BMF-01      caacccgggagctctctctctgccgatctgtttgcccagagcctacttga
A0A2K5VLE9_BMF-02      caacccgggagctctctctctgccgatctgtttgcccagagcctacttga
A0A096NTE9_BMF-02      caacccgggagctcgctctctgccgatctgtttgcccagagcctacttga
A0A096NTE9_BMF-01      caacccgggagctcgctctctgccgatctgtttgcccagagcctacttga
A0A096NTE9_BMF-03      caacccgggagctcgctctctgccgatctgtttgcccagagcctacttga
A0A5F7ZML1_BMF-01      caacccgggagctcgctctctgccgatctgtttgcccagagcctacttga
A0A5F7ZML1_BMF-02      caacccgggagctcgctctctgccgatctgtttgcccagagcctacttga
A0A5F7ZML1_BMF-03      caacccgggagctcgctctctgccgatctgtttgcccagagcctacttga
A0A2K5MJW4_BMF-01      caacccgggagctcgctctctgccgatctgtttgcccagagcctacttga
A0A2K6B5F6_BMF-03      caacccgggagctcgctctctgccgatctgtttgcccagagcctacttga
A0A2K5Z4A9_BMF-02      caacccgggagctcgctctctgccgatctgtttgcccagagcctacttga
A0A2K5MJW4_BMF-02      caacccgggagctcgctctctgccgatctgtttgcccagagcctacttga
A0A2K6B5F6_BMF-01      caacccgggagctcgctctctgccgatctgtttgcccagagcctacttga
A0A2K6B5F6_BMF-02      caacccgggagctcgctctctgccgatctgtttgcccagagcctacttga
A0A2K6B5F6_BMF-04      caacccgggagctcgctctctgccgatctgtttgcccagagcctacttga
A0A2K5Z4A9_BMF-01      caacccgggagctcgctctctgccgatctgtttgcccagagcctacttga
A0A2K5KGP2_BMF-02      caacccgggagctcgctctctgccgatctgtttgcccagagcttacttga
A0A2K6RAW1_BMF-02      caacctgggagctcgctctctgccgatctgtttgcccagagcctacttga
A0A2K6RAW1_BMF-01      caacctgggagctcgctctctgccgatctgtttgcccagagcctacttga
A0A2K6L919_BMF-01      caacctgggagctcgctctctgccgatctgtttgcccagagcctacttga
A0A2K6L919_BMF-03      caacctgggagctcgctctctgccgatctgtttgcccagagcctacttga
A0A2K6L919_BMF-02      caacctgggagctcgctctctgccgatctgtttgcccagagcctacttga
A0A2U4BC98_BMF-01      cagcctgggagcttgctctctgctgacctgtttgcccagagccagctgga
G1PAU1_BMF-01          cagcctgggagtttgccctctgctgacctgtttgcccagagccagctgga
A0A2I3HD83_BMF-01      caacccgggagcttgctctctgctgacctgtttgcccagagcctactgga
A0A2K6TW78_BMF-03      caacccgggagcttgctctctgctgacctgtttgcccagagcctactgga
A0A2K6TW78_BMF-02      caacccgggagcttgctctctgctgacctgtttgcccagagcctactgga
A0A2K6TW78_BMF-01      caacccgggagcttgctctctgctgacctgtttgcccagagcctactgga
A0A2J8T301_BMF-01      caatccggaagcttgctctctgctgacctgtttgcccagagcctactgga
G3T7Z4_BMF-01          cagcccgggggcttgctctctgctgacctgtttgcccagagccagctgga
A0A2K5RN49_BMF-02      caacccgggagcttgctctctgctgacctgtttgcccagagcctactgga
A0A2K5RN49_BMF-01      caacccgggagcttgctctctgctgacctgtttgcccagagcctactgga
F7HZL0_BMF-01          caacccgggagcttgctctctgctgacctatttgcccagagcctactgga
A0A2K5E1Q4_BMF-02      caacccgggagcttgctctctgctgacctgtttgcccagagcctactgga
A0A2K5E1Q4_BMF-01      caacccgggagcttgctctctgctgacctgtttgcccagagcctactgga
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          caacccgggagcttgctctctgctgacctgtttgcccagagcctactgga
Q96LC9_BMF-07          caacccgggagcttgctctctgctgacctgtttgcccagagcctactgga
Q96LC9_BMF-01          caacccgggagcttgctctctgctgacctgtttgcccagagcctactgga
Q96LC9_BMF-02          caacccgggagcttgctctctgctgacctgtttgcccagagcctactgga
Q96LC9_BMF-03          caacccgggagcttgctctctgctgacctgtttgcccagagcctactgga
Q96LC9_BMF-04          caacccgggagcttgctctctgctgacctgtttgcccagagcctactgga
A0A2J8QDD5_BMF-01      caacccgggagcttgctctctgctgacctgtttgcccagagcctactgga
A0A2R9BS98_BMF-02      caacccgggagcttgctctctgctgacctgtttgcccagagcctactgga
Q96LC9_BMF-06          caacccgggagcttgctctctgctgacctgtttgcccagagcctactgga
A0A2I2Z168_BMF-02      caacccgggagcttgctctctgctgacctgtttgcccagagcctactgga
A0A2I2Z168_BMF-01      caacccgggagcttgctctctgctgacctgtttgcccagagcctactgga
Q96LC9_BMF-08          caacccgggagcttgctctctgctgacctgtttgcccagagcctactgga
A0A2R9BS98_BMF-01      caacccgggagcttgctctctgctgacctgtttgcccagagcctactgga
A0A2J8QDD5_BMF-02      caacccgggagcttgctctctgctgacctgtttgcccagagcctactgga
                                                                         

A0A672RK14_BMF-01      --------------------------------------------ctcact
A0A673JJ10_BMF-01      --------------------------------------------ctcact
A0A3B4UNJ0_BMF-01      ------------------------------------ct------cgcacc
W5N4P7_BMF-01          ----------------------------tcacatttct------cacact
A3KND0_BMF-01          cacatgcctgctcggccgctttcacctcttcccatttt------ctcact
Q0GKC7_BMF-01          ------------------------------------tc------tccagc
A0A671M0H4_BMF-01      ------------------------------------tc------tacagc
A0A671M0H4_BMF-02      ------------------------------------tc------tacagc
A0A671MNR9_BMF-01      ------------------------------------tc------tacagc
A0A672JWL9_BMF-01      ------------------------------------tc------tacagc
A0A672JWL9_BMF-02      ------------------------------------tc------tacagc
A0A673HDR4_BMF-01      ------------------------------------tc------tacagc
A0A3B3RH63_BMF-01      ------------------------------------cc------cgctca
K7FRX2_BMF-01          cagctgcctcctggggaggtttcaactgttcccactca------cacact
A0A452H3N6_BMF-01      cagctgtctcctggggaggtttcaactgttccccctca------cacact
A0A674IPL3_BMF-01      cagctgtctcctggggaggtttcaactattcccactca------cacact
A0A493T7X1_BMF-01      cagctgccttctggggaggtttcaactatttcccctca------cacact
A0A3Q2UCA0_BMF-01      cagctgccttctggggaggtttcaactatttcccctca------cacact
A0A3Q2UCA0_BMF-02      cagctgccttctggggaggtttcaactatttcccctca------cacact
A0A669PL85_BMF-02      cagctgccttctggggaggtttcaactatttcccctca------cacact
A0A493T7X1_BMF-02      cagctgccttctggggaggtttcaactatttcccctca------cacact
A0A3Q2UCA0_BMF-03      cagctgccttctggggaggtttcaactatttcccctca------cacact
A0A3Q2UCA0_BMF-04      cagctgccttctggggaggtttcaactatttcccctca------cacact
A9XRH0_BMF-01          --------------------------------------------------
G1NHG8_BMF-01          cagctgccttctggggaggtttcaactatttcccctca------cacact
A0A669PL85_BMF-01      cagctgccttctggggaggtttcaactatttcccctca------cacact
U3JS06_BMF-01          cagctgccttctggggaggtttcaactattccccctca------cacact
A0A674GIP8_BMF-03      cagctgccttctggggaggtttcaactattccccctca------cacact
A0A674GIP8_BMF-01      cagctgccttctggggaggtttcaactattccccctca------cacact
A0A674GIP8_BMF-02      cagctgccttctggggaggtttcaactattccccctca------cacact
A0A672V891_BMF-01      cagctgccttctggggaggtttcaactattccccctca------cacact
A0A663DZQ4_BMF-01      cagctgccttctggggaggtttcaactattccccctca------cacact
A0A663MPI8_BMF-01      cagctgccttctggggaggtttcaactattccccctca------cacact
A0A670XMZ5_BMF-01      caactgcctcctgggcaggttccagctcttcccactta------cgcact
H9GL49_BMF-01          caactgtcttctggggaggttccagctcttcccactta------cacact
A0A670JUU6_BMF-01      caactgccttctggggagattccagctcttcccactta------cacact
A0A670JUU6_BMF-05      caactgccttctggggagattccagctcttcccactta------cacact
A0A670JUU6_BMF-04      caactgccttctggggagattccagctcttcccactta------cacact
A0A670JUU6_BMF-02      caactgccttctggggagattccagctcttcccactta------cacact
A0A670JUU6_BMF-03      caactgccttctggggagattccagctcttcccactta------cacact
A0A4W3JXA1_BMF-01      gtggcgtgccacacgctcgcggctgcgctctccgataaactcggtccact
A0A3Q2CXC4_BMF-01      ------------------------------------tc------ccaaca
A0A3Q2CXC4_BMF-02      ------------------------------------tc------ccaaca
A0A3B5QK08_BMF-01      ------------------------------------tc------ccaact
A0A3B5QK08_BMF-02      ------------------------------------tc------ccaact
A0A096LRV0_BMF-01      ------------------------------------tc------ccaact
A0A3B3WU80_BMF-01      ------------------------------------tc------ccaact
A0A3P9Q8E2_BMF-01      ------------------------------------tc------ccaact
A0A3Q2PJX9_BMF-01      ------------------------------------tc------ccaact
A0A3Q2PJX9_BMF-03      ------------------------------------tc------ccaact
A0A3Q2PJX9_BMF-02      ------------------------------------tc------ccaact
A0A3Q2YCX7_BMF-01      ------------------------------------cc------cccact
A0A3Q2YCX7_BMF-02      ------------------------------------cc------cccact
A0A3B5KWG6_BMF-02      ------------------------------------cc------cttaca
A0A3B5KWG6_BMF-01      ------------------------------------cc------cttaca
A0A3B5KWG6_BMF-03      ------------------------------------cc------cttaca
A0A3B3CGR9_BMF-01      ------------------------------------cc------ccaaca
A0A3P9K487_BMF-01      ------------------------------------cc------ccaaca
A0A3P9K487_BMF-02      ------------------------------------cc------ccaaca
A0A3B3HAU1_BMF-01      ------------------------------------cc------ccaaca
A0A3B3HAU1_BMF-02      ------------------------------------cc------ccaaca
A0A3B3HAU1_BMF-03      ------------------------------------cc------ccaaca
A0A3B3HAU1_BMF-04      ------------------------------------cc------ccaaca
A0A3P9ICE1_BMF-04      ------------------------------------cc------ccaaca
A0A3P9ICE1_BMF-01      ------------------------------------cc------ccaaca
A0A3P9ICE1_BMF-02      ------------------------------------cc------ccaaca
A0A3P9ICE1_BMF-03      ------------------------------------cc------ccaaca
A0A3P9ICE1_BMF-05      ------------------------------------cc------ccaaca
A0A3P8NFE2_BMF-02      ------------------------------------ag------ccaact
A0A668TQU8_BMF-01      ------------------------------------ag------ccaact
I3K2D6_BMF-01          ------------------------------------ag------ccaact
A0A3Q4G1I4_BMF-01      ------------------------------------ag------ccaact
A0A3P8NFE2_BMF-01      ------------------------------------ag------ccaact
A0A3P9DPJ5_BMF-01      ------------------------------------ag------ccaact
A0A3P9DPJ5_BMF-02      ------------------------------------ag------ccaact
A0A3B4ETH0_BMF-01      ------------------------------------ag------ccaact
A0A3Q3C5V2_BMF-01      ------------------------------------ag------ccaact
A0A672HG10_BMF-01      ------------------------------------cc------cacgct
A0A3P8UA78_BMF-02      ------------------------------------cc------cgcaca
A0A3P8UA78_BMF-01      ------------------------------------cc------cgcaca
A0A3P8UA78_BMF-03      ------------------------------------cc------cgcaca
A0A3Q3GUU5_BMF-01      ------------------------------------cc------cacaca
A0A3Q3VLX6_BMF-01      ------------------------------------gg------cccact
A0A3Q2ZA20_BMF-01      ------------------------------------tc------ccagct
A0A667YNR9_BMF-01      ------------------------------------cc------tccact
A0A3Q3LME3_BMF-01      ------------------------------------cc------cccact
A0A3Q3LME3_BMF-02      ------------------------------------cc------cccact
A0A3Q3LME3_BMF-03      ------------------------------------cc------cccact
A0A3Q1IPR4_BMF-01      ------------------------------------cc------cccact
A0A3Q3QZ16_BMF-01      ------------------------------------cc------cccact
A0A3Q3QZ16_BMF-02      ------------------------------------cc------cccact
A0A665VG08_BMF-01      ------------------------------------cc------cccact
A0A673C8N3_BMF-01      ------------------------------------cc------ctcact
A0A3Q1FVH7_BMF-01      ------------------------------------ca------cccact
A0A3Q1FVH7_BMF-02      ------------------------------------ca------cccact
A0A3B5B8F6_BMF-01      ------------------------------------cc------cccact
A0A3Q1D1K3_BMF-01      ------------------------------------cc------cccact
A0A3P8RKY9_BMF-01      ------------------------------------cc------cccact
A0A671X848_BMF-01      ------------------------------------cc------cccact
A0A0F8AD62_BMF-01      ------------------------------------cc------cccact
A0A4W6DUL1_BMF-01      ------------------------------------cc------cccact
A0A2U9CJH3_BMF-01      ------------------------------------cc------cccact
A0A3B4U5H8_BMF-01      ------------------------------------cc------cccact
A0A3B4WM88_BMF-01      ------------------------------------cc------cccact
A0A3P8ZIE7_BMF-01      ------------------------------------ct------cctact
A0A4W5N3A7_BMF-01      ----------------------------------tcct------cccact
A0A6F9BGV6_BMF-01      ----------------------------------tcct------cccact
A0A1S3SNN2_BMF-01      ----------------------------------tcct------cccact
A0A674EF64_BMF-01      ----------------------------------tcct------cccact
A0A1S3P5K4_BMF-01      ------------------------------------ct------cccact
A0A6F9B4C5_BMF-01      ------------------------------------ct------tccact
A0A4W5N721_BMF-01      ------------------------------------ct------cccact
A0A1S3P5K4_BMF-02      ------------------------------------ct------cccact
A0A673YQV3_BMF-01      ------------------------------------ct------cccact
A0A4W4DZH9_BMF-01      ctccctcc------------------------------------------
A0A3B4CNJ8_BMF-01      -------------------------------------a------cacaat
A0A3B1K1X5_BMF-01      --------------------------------------------------
A0A3B4B6Y3_BMF-01      -----------------------------------------------act
A0A6I8NF73_BMF-01      cagctacctggtcgggcagctgcccctcttccctctcg------ctccct
A0A5F8GKJ8_BMF-01      ctatatgc---tggatgggctgcagcttttccctctta------ctcact
G3WDQ2_BMF-01          ctatatgc---tggatgggctgcagcttttccctctta------cccact
A0A4X2KLG2_BMF-01      ctatatgc---tagatgggctgcagcttttccctctca------cccact
Q8K589_BMF-01          ttgtcccc---tcagtcggcttcagctcttcccgctta------cccact
Q91ZE9_BMF-02          ctgtcccc---tcagtcgactccagctcttccctctca------cccatt
Q91ZE9_BMF-01          ctgtcccc---tcagtcgactccagctcttccctctca------cccatt
Q91ZE9_BMF-06          ctgtcccc---tcagtcgactccagctcttccctctca------cccatt
A0A287CXH0_BMF-01      ctgccccc---tcagcaggcttcagctcttccctctca------cccact
A0A287CXH0_BMF-02      ctgccccc---tcagcaggcttcagctcttccctctca------cccact
A0A671DWL6_BMF-01      ctgccccc---tcagccgtctgcagctcttccctctca------cccact
A0A671DWL6_BMF-02      ctgccccc---tcagccgtctgcagctcttccctctca------cccact
A0A2K6FFN3_BMF-01      ctgccccc---tcagccggcttcagctcttccctctca------cccact
A0A2K6FFN3_BMF-02      ctgccccc---tcagccggcttcagctcttccctctca------cccact
A0A673TA87_BMF-01      ctgtcctc---tcagccacctgcaactcttccctctca------cccact
L8IXF5_BMF-01          ctgccccc---tcagccgtctgcagctcttccctctca------cgcact
A0A4W2EII1_BMF-01      ctgccccc---tcagccgtctgcagctcttccctctca------cgcact
A0A4W2EII1_BMF-01      ctgccccc---tcagccgtctgcagctcttccctctca------cgcact
Q05KI3_BMF-01          ctgccccc---tcagccgtctgcagctcttccctctca------cgcact
Q05KI3_BMF-02          ctgccccc---tcagccgtctgcagctcttccctctca------cgcact
A0A4W2INA4_BMF-01      ctgccccc---tcagccgtctgcagctcttccctctca------cgcact
A0A4W2INA4_BMF-01      ctgccccc---tcagccgtctgcagctcttccctctca------cgcact
A0A452F2E0_BMF-01      ctgccccc---tcagccgcctgcagctcttccctctca------cgcact
A0A452F2E0_BMF-02      ctgccccc---tcagccgcctgcagctcttccctctca------cgcact
W5QFV1_BMF-01          ctgccccc---tcagccgtctgcagctcttccctctca------cgcact
H0WYH6_BMF-01          ctgtcccc---ttagccggcttcagctcttccctctca------cccact
A0A337ST43_BMF-02      ctgccccc---tcagccatctgcagctcttccctctca------cccact
A0A337ST43_BMF-03      ctgccccc---tcagccatctgcagctcttccctctca------cccact
A0A337ST43_BMF-05      ctgccccc---tcagccatctgcagctcttccctctca------cccact
A0A337ST43_BMF-01      ctgccccc---tcagccatctgcagctcttccctctca------cccact
A0A337ST43_BMF-04      ctgccccc---tcagccatctgcagctcttccctctca------cccact
A0A667H967_BMF-01      ctgccccc---tcagccatctgcagctcttccctctca------cccact
M3YAD5_BMF-01          ctgccctc---ttagccgtctgcatctcttccctctca------cccact
U6CSY8_BMF-01          ctgcccgc---ttagccgtctgcatctcttccctctca------cccact
A0A452SED0_BMF-01      ctgccccc---tcagccgtctgcatctcttccctctca------cccact
A0A384D070_BMF-01      ctgccccc---tcagccgtctgcatctcttccctctca------cccact
A0A5F4CJ04_BMF-04      ctgccccc---tcagccgtctgcatctcttccctctca------cccact
A0A5F4CJ04_BMF-03      ctgccccc---tcagccgtctgcatctcttccctctca------cccact
A0A5F4CJ04_BMF-01      ctgccccc---tcagccgtctgcatctcttccctctca------cccact
A0A5F4CJ04_BMF-02      ctgccccc---tcagccgtctgcatctcttccctctca------cccact
A0A4X1UQ42_BMF-01      ctgccccc---tcagccgtctgcagctcttccctctca------cgcact
A0A4X1UQ42_BMF-02      ctgccccc---tcagccgtctgcagctcttccctctca------cgcact
A0A287AIU8_BMF-01      ctgccccc---tcagccgtctgcagctcttccctctca------cgcact
A0A287AIU8_BMF-02      ctgccccc---tcagccgtctgcagctcttccctctca------cgcact
A0A3Q2HR24_BMF-01      ctgccccc---tcagccatctgcggctcttccctctca------cccact
A0A3Q2HR24_BMF-02      ctgccccc---tcagccatctgcggctcttccctctca------cccact
G1SR62_BMF-01          ctgccccc---tggggcggctgcacctcttccctctca------cccact
A0A286XXB0_BMF-03      ctgtcccc---ttggtcggctgcacctctttcctctca------cccact
A0A286XXB0_BMF-01      ctgtcccc---ttggtcggctgcacctctttcctctca------cccact
A0A286XXB0_BMF-02      ctgtcccc---ttggtcggctgcacctctttcctctca------cccact
A0A2K5KGP2_BMF-01      ctgccccc---tcagccgacttcagctcttccctctca------cccact
A0A0D9R4R5_BMF-01      ctgccccc---tcagccgacttcagctcttccctctca------cccact
A0A2K5VLE9_BMF-01      ctgccccc---tcagccgacttcagctcttccctctca------cccact
A0A2K5VLE9_BMF-02      ctgccccc---tcagccgacttcagctcttccctctca------cccact
A0A096NTE9_BMF-02      ctgccccc---tcagccgacttcagctcttccctctca------cccact
A0A096NTE9_BMF-01      ctgccccc---tcagccgacttcagctcttccctctca------cccact
A0A096NTE9_BMF-03      ctgccccc---tcagccgacttcagctcttccctctca------cccact
A0A5F7ZML1_BMF-01      ctgccccc---tcagccgacttcagctcttccctctca------cccact
A0A5F7ZML1_BMF-02      ctgccccc---tcagccgacttcagctcttccctctca------cccact
A0A5F7ZML1_BMF-03      ctgccccc---tcagccgacttcagctcttccctctca------cccact
A0A2K5MJW4_BMF-01      ctgccccc---tcagccgacttcagctcttccctctca------cccact
A0A2K6B5F6_BMF-03      ctgccccc---tcagccgacttcagctcttccctctca------cccact
A0A2K5Z4A9_BMF-02      ctgccccc---tcagccgacttcagctcttccctctca------cccact
A0A2K5MJW4_BMF-02      ctgccccc---tcagccgacttcagctcttccctctca------cccact
A0A2K6B5F6_BMF-01      ctgccccc---tcagccgacttcagctcttccctctca------cccact
A0A2K6B5F6_BMF-02      ctgccccc---tcagccgacttcagctcttccctctca------cccact
A0A2K6B5F6_BMF-04      ctgccccc---tcagccgacttcagctcttccctctca------cccact
A0A2K5Z4A9_BMF-01      ctgccccc---tcagccgacttcagctcttccctctca------cccact
A0A2K5KGP2_BMF-02      ctgccccc---tcagccgacttcagctcttccctctca------cccact
A0A2K6RAW1_BMF-02      ctgccccc---tcagccgacttcagctcttccctctca------cccact
A0A2K6RAW1_BMF-01      ctgccccc---tcagccgacttcagctcttccctctca------cccact
A0A2K6L919_BMF-01      ctgccccc---tcagccgacttcagctcttccctctca------cccact
A0A2K6L919_BMF-03      ctgccccc---tcagccgacttcagctcttccctctca------cccact
A0A2K6L919_BMF-02      ctgccccc---tcagccgacttcagctcttccctctca------cccact
A0A2U4BC98_BMF-01      ctgccccc---tcagccgtctgcagctcttccctctca------cgcact
G1PAU1_BMF-01          ctgccccc---tcagccgtctgcagctcttccctctca------cccact
A0A2I3HD83_BMF-01      ctgccccc---tcagccgacttcagctcttccctctca------cccact
A0A2K6TW78_BMF-03      ctgccccc---tcagccggcttcagctcttccctctca------cccact
A0A2K6TW78_BMF-02      ctgccccc---tcagccggcttcagctcttccctctca------cccact
A0A2K6TW78_BMF-01      ctgccccc---tcagccggcttcagctcttccctctca------cccact
A0A2J8T301_BMF-01      ctgccccc---tcagccgacttcagctcttccctctca------cccact
G3T7Z4_BMF-01          ctgccccc---tcagccggcttcagctcttccctctca------cccact
A0A2K5RN49_BMF-02      ctgtcccc---tcagccggcttcagctcttccctctca------cccact
A0A2K5RN49_BMF-01      ctgtcccc---tcagccggcttcagctcttccctctca------cccact
F7HZL0_BMF-01          ctgccccc---tcagtcggcttcagctcttccctctca------cccact
A0A2K5E1Q4_BMF-02      ctgccccc---tcagccggcttcagctcttccctctca------cccact
A0A2K5E1Q4_BMF-01      ctgccccc---tcagccggcttcagctcttccctctca------cccact
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          ctgccccc---tcagccgacttcagctcttccctctca------cccact
Q96LC9_BMF-07          ctgccccc---tcagccgacttcagctcttccctctca------cccact
Q96LC9_BMF-01          ctgccccc---tcagccgacttcagctcttccctctca------cccact
Q96LC9_BMF-02          ctgccccc---tcagccgacttcagctcttccctctca------cccact
Q96LC9_BMF-03          ctgccccc---tcagccgacttcagctcttccctctca------cccact
Q96LC9_BMF-04          ctgccccc---tcagccgacttcagctcttccctctca------cccact
A0A2J8QDD5_BMF-01      ctgccccc---tcagccgacttcagctcttccctctca------cccact
A0A2R9BS98_BMF-02      ctgccccc---tcagccgacttcagctcttccctctca------cccact
Q96LC9_BMF-06          ctgccccc---tcagccgacttcagctcttccctctca------cccact
A0A2I2Z168_BMF-02      ctgccccc---tcagccgacttcagctcttccctctca------cccact
A0A2I2Z168_BMF-01      ctgccccc---tcagccgacttcagctcttccctctca------cccact
Q96LC9_BMF-08          ctgccccc---tcagccgacttcagctcttccctctca------cccact
A0A2R9BS98_BMF-01      ctgccccc---tcagccgacttcagctcttccctctca------cccact
A0A2J8QDD5_BMF-02      ctgccccc---tcagccgacttcagctcttccctctca------cccact
                                                                         

A0A672RK14_BMF-01      gctgtgaaacaccgctaagaaacaagagctcagagaacagagacgggaga
A0A673JJ10_BMF-01      gctgtgaaacaccgctaagaaacaagagctcagagaacagagacggccca
A0A3B4UNJ0_BMF-01      tctggggaacgtcctttagggacgtcaaatacgaagaccgagcc------
W5N4P7_BMF-01          gctggggaacccaattcagggaaataaagtacgaggacaagggc------
A3KND0_BMF-01          gttgtggccctggatgcaggggcacagacaacgaggacaaggct------
Q0GKC7_BMF-01          actggcctcctccccacctgcagataaagcag------------------
A0A671M0H4_BMF-01      gctggccttcctcccgcgttcagataaagcag------------------
A0A671M0H4_BMF-02      gctggccttcctcccgcgttcagataaagcag------------------
A0A671MNR9_BMF-01      actggccttcctcccgcgttcagataaagcag------------------
A0A672JWL9_BMF-01      actggccttcctcccgcgttcagataaagcag------------------
A0A672JWL9_BMF-02      actggccttcctcccgcgttcagataaagcag------------------
A0A673HDR4_BMF-01      gctggccttcctcccgcgttcagataaagcag------------------
A0A3B3RH63_BMF-01      cctatcagcccccgttcagggatataaagtgtgagaatcggggc------
K7FRX2_BMF-01          gctgtggtccaggtatcaggcatgctgagcagcaggacaaggca------
A0A452H3N6_BMF-01      gctgtggtccaggtatcaggcatgctgagcagcaggacaaggca------
A0A674IPL3_BMF-01      gctgtggtccaggtatcaggcatgctgagcagcaagacaaggca------
A0A493T7X1_BMF-01      gctgtggtcccggtgtcaggcatcctgagcagcaggacaaggca------
A0A3Q2UCA0_BMF-01      gctgtggtcccggtgtcaggcatcctgagcagcaggacaaggca------
A0A3Q2UCA0_BMF-02      gctgtggtcccggtgtcaggcatcctgagcagcaggacaaggca------
A0A669PL85_BMF-02      gctgtggtcccggtgtcaggcaaccagagcagcaggacaaggca------
A0A493T7X1_BMF-02      gctgtggtcccggtgtcaggcatcctgagcagcaggacaaggca------
A0A3Q2UCA0_BMF-03      gctgtggtcccggtgtcaggcatcctgagcagcaggacaaggca------
A0A3Q2UCA0_BMF-04      gctgtggtcccggtgtcaggcatcctgagcagcaggacaaggca------
A9XRH0_BMF-01          --------------------------------------------------
G1NHG8_BMF-01          gctgtggtcccggtgtcaggcatcctgagcagcaggacaaggca------
A0A669PL85_BMF-01      gctgtggtcccggtgtcaggcaaccagagcagcaggacaaggca------
U3JS06_BMF-01          gctgtggtcccggtatcaggcatcctgagcagcaggacaaggca------
A0A674GIP8_BMF-03      gctgtggtcccggtatcaggcatcctgagcagcaggacaaggca------
A0A674GIP8_BMF-01      gctgtggtcccggtatcaggcatcctgagcagcaggacaaggca------
A0A674GIP8_BMF-02      gctgtggtcccggtatcaggcatcctgagcagcaggacaaggca------
A0A672V891_BMF-01      gctgtggtcccggtatcaggcatcctgagcagcaggacaaggca------
A0A663DZQ4_BMF-01      gctgtggtcccggtatcaggcatcctgagcagcaggacaaggca------
A0A663MPI8_BMF-01      gctgtggtcccggtatcaggcatcctgagcagcaggacaaggca------
A0A670XMZ5_BMF-01      gttgtggcccaggcagcaggcatgccaaacaacaggacaaggca------
H9GL49_BMF-01          gttgtggccctggcagtaggcaggccaggcagcaagacaaggca------
A0A670JUU6_BMF-01      gttgcggcccaggcaccaggcatgccaagcagcaagataaggca------
A0A670JUU6_BMF-05      gttgcggcccaggcaccaggcatgccaagcagcaagataaggca------
A0A670JUU6_BMF-04      gttgcggcccaggcaccaggcatgccaagcagcaagataaggca------
A0A670JUU6_BMF-02      gttgcggcccaggcaccaggcatgccaagcagcaagataaggca------
A0A670JUU6_BMF-03      gttgcggcccaggcaccaggcatgccaagcagcaagataaggca------
A0A4W3JXA1_BMF-01      tctgcggccccggatgcggtcggcaggtgcagtgtgacaaggcc------
A0A3Q2CXC4_BMF-01      gctggcacacaccattcagggagataaagtttgaagaccggggc------
A0A3Q2CXC4_BMF-02      gctggcacacaccattcagggagataaagtttgaagaccggggc------
A0A3B5QK08_BMF-01      gctggcgcacacccttcagggagataaagtgcgaagaccggggc------
A0A3B5QK08_BMF-02      gctggcgcacacccttcagggagataaagtgcgaagaccggggc------
A0A096LRV0_BMF-01      gctggcgcacgcccttcagggagataaagtgtgaagaccggggc------
A0A3B3WU80_BMF-01      gctggcgcacgcccttcagggagataaagtgtgaagaccggggc------
A0A3P9Q8E2_BMF-01      gctggcgcacgcccttcagggagataaagtgtgaagaccggggc------
A0A3Q2PJX9_BMF-01      gctggcgcacacccttcagggagataaagtgcgaagaccggggc------
A0A3Q2PJX9_BMF-03      gctggcgcacacccttcagggagataaagtgcgaagaccggggc------
A0A3Q2PJX9_BMF-02      gctggcgcacacccttcagggagataaagtgcgaagaccggggc------
A0A3Q2YCX7_BMF-01      gctggcgcaccacattcaaggagataaagtgtgaggagcgggca------
A0A3Q2YCX7_BMF-02      gctggcgcaccacattcaaggagataaagtgtgaggagcgggca------
A0A3B5KWG6_BMF-02      gctggcgcaccacattccaggagataaagtgcgaggaccggggc------
A0A3B5KWG6_BMF-01      gctggcgcaccacattccaggagataaagtgcgaggaccggggc------
A0A3B5KWG6_BMF-03      gctggcgcaccacattccaggagataaagtgcgaggaccggggc------
A0A3B3CGR9_BMF-01      actggcgcacggcggtcaggaagataaagtgtgaagaccggggc------
A0A3P9K487_BMF-01      agtggcgcacgacagccaggaagataaagtgtgaagaccggggc------
A0A3P9K487_BMF-02      agtggcgcacgacagccaggaagataaagtgtgaagaccggggc------
A0A3B3HAU1_BMF-01      agtggcgcacgacagccaggaagataaagtgtgaagaccggggc------
A0A3B3HAU1_BMF-02      agtggcgcacgacagccaggaagataaagtgtgaagaccggggc------
A0A3B3HAU1_BMF-03      agtggcgcacgacagccaggaagataaagtgtgaagaccggggc------
A0A3B3HAU1_BMF-04      agtggcgcacgacagccaggaagataaagtgtgaagaccggggc------
A0A3P9ICE1_BMF-04      agtggcgcacgacagccaggaagataaagtgtgaagaccggggc------
A0A3P9ICE1_BMF-01      agtggcgcacgacagccaggaagataaagtgtgaagaccggggc------
A0A3P9ICE1_BMF-02      agtggcgcacgacagccaggaagataaagtgtgaagaccggggc------
A0A3P9ICE1_BMF-03      agtggcgcacgacagccaggaagataaagtgtgaagaccggggc------
A0A3P9ICE1_BMF-05      agtggcgcacgacagccaggaagataaagtgtgaagaccggggc------
A0A3P8NFE2_BMF-02      gttggcgcaccacattcagggagataaagtgtgaacatcgaggc------
A0A668TQU8_BMF-01      gttggcgcaccacattcagggagataaagtgtgaacatcgaggc------
I3K2D6_BMF-01          gttggcgcaccacattcagggagataaagtgtgaacatcgaggc------
A0A3Q4G1I4_BMF-01      gttggcgcaccacattcagggagataaagtgtgaacatcgaggc------
A0A3P8NFE2_BMF-01      gttggcgcaccacattcagggagataaagtgtgaacatcgaggc------
A0A3P9DPJ5_BMF-01      gttggcgcaccacattcagggagataaagtgtgaacatcgaggc------
A0A3P9DPJ5_BMF-02      gttggcgcaccacattcagggagataaagtgtgaacatcgaggc------
A0A3B4ETH0_BMF-01      gttggcgcaccacattcagggagataaagtgtgaacatcgaggc------
A0A3Q3C5V2_BMF-01      gttggcgcaccacattcagggagataaagtgtgaacatcgaggc------
A0A672HG10_BMF-01      gctggcgcacagcattcagggagataaagtgcgaagaccggggc------
A0A3P8UA78_BMF-02      gctggcacacaacattcagggagataaggtgtgaagaccggggc------
A0A3P8UA78_BMF-01      gctggcacacaacattcagggagataaggtgtgaagaccggggc------
A0A3P8UA78_BMF-03      gctggcacacaacattcagggagataaggtgtgaagaccggggc------
A0A3Q3GUU5_BMF-01      gctggcgcacctattttcaggagataaagtgtgaagaccggggc------
A0A3Q3VLX6_BMF-01      gctggcgcaccacattccgggagataaagtgtgaagaccggggc------
A0A3Q2ZA20_BMF-01      gctggcgcacgactttcagggagataaagtgcgaagaccggggc------
A0A667YNR9_BMF-01      gctggcgcaccacattcagggagataaagtgcgaagacaggggc------
A0A3Q3LME3_BMF-01      tctggcgcaccacgttcagggagataaagtgtgaagaccggggc------
A0A3Q3LME3_BMF-02      tctggcgcaccacgttcagggagataaagtgtgaagaccggggc------
A0A3Q3LME3_BMF-03      tctggcgcaccacgttcagggagataaagtgtgaagaccggggc------
A0A3Q1IPR4_BMF-01      gctggcgtaccacattcagggagataaagtgtcaagaccggggc------
A0A3Q3QZ16_BMF-01      gctggcgtactgcattcagggagataaagtgtgaagaccggggc------
A0A3Q3QZ16_BMF-02      gctggcgtactgcattcagggagataaagtgtgaagaccggggc------
A0A665VG08_BMF-01      tctggcgcaccacattcagggagataaagtgtgaacaccggggc------
A0A673C8N3_BMF-01      gctggcgcaccacattcagggagataaagtgtgaagaccggggc------
A0A3Q1FVH7_BMF-01      gctggcgcacaacattcagggagataaagtgtgaagaccggggc------
A0A3Q1FVH7_BMF-02      gctggcgcacaacattcagggagataaagtgtgaagaccggggc------
A0A3B5B8F6_BMF-01      gctggcgcacaacattcagggagataaagtgtgaagaccggggc------
A0A3Q1D1K3_BMF-01      gctggcgcacaacattcagggagataaagtgtgaagaccggggc------
A0A3P8RKY9_BMF-01      gctggcgcacaacattcagggagataaagtgtgaagaccggggc------
A0A671X848_BMF-01      gctggcgcaccacattccgggagataaagtgtgaagaccggggc------
A0A0F8AD62_BMF-01      gctggcgcaccacattccgggagataaagtgtgaagaccagggc------
A0A4W6DUL1_BMF-01      gctggcgcaccacattcagggagataaagtgcgaggaccggggc------
A0A2U9CJH3_BMF-01      gctggcgcaccacattcagggagataaagtgtgaagaccggggc------
A0A3B4U5H8_BMF-01      gctggcgcaccacattcagggagataaagtgtgaagaccggggc------
A0A3B4WM88_BMF-01      gctggcgcaccacattcagggagataaagtgtgaagaccggggc------
A0A3P8ZIE7_BMF-01      gctggcacacagcctccagggagataaagtacgaggacaggggc------
A0A4W5N3A7_BMF-01      gctggcgcacagccttcagggaaataaagtacgaggacagaggc------
A0A6F9BGV6_BMF-01      gctggcgcacagccttcagggagataaagtacgaggacaggggc------
A0A1S3SNN2_BMF-01      gctggcgcacagccttcagggaaataaagtacgaggacagaggc------
A0A674EF64_BMF-01      gctggcgcacagccttcagggaaataaagtacgaggacagaggc------
A0A1S3P5K4_BMF-01      gctggcgcacagccttcagggagataaagtacgaggacagggga------
A0A6F9B4C5_BMF-01      gctggcgcacagccttcagggagataaagtacgaggacagggga------
A0A4W5N721_BMF-01      gctggcgcacagccttcagggagataaagtacgaggacagggga------
A0A1S3P5K4_BMF-02      gctggcgcacagccttcagggagataaagtacgaggacagggga------
A0A673YQV3_BMF-01      gctggcgcacagccttcagggagataaagtacgaggacagggga------
A0A4W4DZH9_BMF-01      ------------------gtgagataaagcaagaagagcgtggc------
A0A3B4CNJ8_BMF-01      attggcgttcctcaatcagggagataaagcaggaggagcgtggc------
A0A3B1K1X5_BMF-01      -----------------------ataaagcaggaggagcgtggc------
A0A3B4B6Y3_BMF-01      gctggcacaccacattcaggcagataaagtgtgaagaccgggcc------
A0A6I8NF73_BMF-01      gctgtgggccgggactgcggaccctgagccaagaagacaagacc------
A0A5F8GKJ8_BMF-01      gctgtggcccagggcttcggtcagttggccaggaagataaggcc------
G3WDQ2_BMF-01          gctgtggcccagggcttcgctcagttggccaggaagacaaggcc------
A0A4X2KLG2_BMF-01      gctgcggcccagggcttcggtcagttggccaggaagacaaggcc------
Q8K589_BMF-01          gctgtggtcctgggctccggcctgtaagccaggaagacaaggcc------
Q91ZE9_BMF-02          gctgtggtcccggactccggcccataagccaggaagacaaggcc------
Q91ZE9_BMF-01          gctgtggtcccggactccggcccataagccaggaagacaaggcc------
Q91ZE9_BMF-06          gctgtggtcccggactccggcccataagccaggaagacaaggcc------
A0A287CXH0_BMF-01      gctgtggtcctgggcttcgacctaccagccaggaagacaaggcc------
A0A287CXH0_BMF-02      gctgtggtcctgggcttcgacctaccagccaggaagacaaggcc------
A0A671DWL6_BMF-01      gctgtggccctgggctgcgacccaccagccaggaagacaaggcc------
A0A671DWL6_BMF-02      gctgtggccctgggctgcgacccaccagccaggaagacaaggcc------
A0A2K6FFN3_BMF-01      gctgtggccctgggcttcgacccaccagccaggaagacaaggcc------
A0A2K6FFN3_BMF-02      gctgtggccctgggcttcgacccaccagccaggaagacaaggcc------
A0A673TA87_BMF-01      gctgtggccctgggcttcgacccaccagccaggaggacaaggcc------
L8IXF5_BMF-01          gctgtggccctgggcttcgacccaccagccaggaagacaaggct------
A0A4W2EII1_BMF-01      gctgtggccctgggcttcgacccaccagccaggaagacaaggct------
A0A4W2EII1_BMF-01      gctgtggccctgggcttcgacccaccagccaggaagacaaggct------
Q05KI3_BMF-01          gctgtggccctgggcttcgacccaccagccaggaagacaaggct------
Q05KI3_BMF-02          gctgtggccctgggcttcgacccaccagccaggaagacaaggct------
A0A4W2INA4_BMF-01      gctgtggccctgggcttcgacccaccagccaggaagacaaggct------
A0A4W2INA4_BMF-01      gctgtggccctgggcttcgacccaccagccaggaagacaaggct------
A0A452F2E0_BMF-01      gctgtggccctgggcttcgacccaccagccaggaagacaaggct------
A0A452F2E0_BMF-02      gctgtggccctgggcttcgacccaccagccaggaagacaaggct------
W5QFV1_BMF-01          gctgtggccctgggcttcgacccaccagccaggaagacaaggct------
H0WYH6_BMF-01          gctgtggccctgggctccgaccaaccagccaggaagacaaagcc------
A0A337ST43_BMF-02      gctgtggtcctgggcttcgacccaccagccaggaagacaaggcc------
A0A337ST43_BMF-03      gctgtggtcctgggcttcgacccaccagccaggaagacaaggcc------
A0A337ST43_BMF-05      gctgtggtcctgggcttcgacccaccagccaggaagacaaggcc------
A0A337ST43_BMF-01      gctgtggtcctgggcttcgacccaccagccaggaagacaaggcc------
A0A337ST43_BMF-04      gctgtggtcctgggcttcgacccaccagccaggaagacaaggcc------
A0A667H967_BMF-01      gctgtggtcctgggcttcgacccaccagccaggaagacaaggcc------
M3YAD5_BMF-01          gctgtggccctgggcttcgacccaccagccaggaggacaaggcc------
U6CSY8_BMF-01          gctgtggccctgggcttcgacccaccagccaggaggacaaggcc------
A0A452SED0_BMF-01      gctgtggccctgggcttcgacccaccagccaggaagacaaggcc------
A0A384D070_BMF-01      gctgtggccctgggcttcgacccaccagccaggaagacaaggcc------
A0A5F4CJ04_BMF-04      gctgtggccctgggcttcgacccaccagccaggaagacaaggcc------
A0A5F4CJ04_BMF-03      gctgtggccctgggcttcgacccaccagccaggaagacaaggcc------
A0A5F4CJ04_BMF-01      gctgtggccctgggcttcgacccaccagccaggaagacaaggcc------
A0A5F4CJ04_BMF-02      gctgtggccctgggcttcgacccaccagccaggaagacaaggcc------
A0A4X1UQ42_BMF-01      gctgtggccctgggcttcgacccaccagccaggaagacaaggcc------
A0A4X1UQ42_BMF-02      gctgtggccctgggcttcgacccaccagccaggaagacaaggcc------
A0A287AIU8_BMF-01      gctgtggccctgggcttcgacccaccagccaggaagacaaggcc------
A0A287AIU8_BMF-02      gctgtggccctgggcttcgacccaccagccaggaagacaaggcc------
A0A3Q2HR24_BMF-01      gctgtggccctggccttcgacccaccagccaggaagacaaggcc------
A0A3Q2HR24_BMF-02      gctgtggccctggccttcgacccaccagccaggaagacaaggcc------
G1SR62_BMF-01          gctgtggtcctgggctgcgacccaccagccaggaagacaaggcc------
A0A286XXB0_BMF-03      gctgtggccctgggcttcgccccaccagccaggaagacaaggcc------
A0A286XXB0_BMF-01      gctgtggccctgggcttcgccccaccagccaggaagacaaggcc------
A0A286XXB0_BMF-02      gctgtggccctgggcttcgccccaccagccaggaagacaaggcc------
A0A2K5KGP2_BMF-01      gctgtggccctggccttcgacccaccagccaggaagacaaggct------
A0A0D9R4R5_BMF-01      gctgtggccctggccttcgacccaccagccaggaagacaaggct------
A0A2K5VLE9_BMF-01      gctgtggccctggccttcgacccaccagccaggaagacaaggcc------
A0A2K5VLE9_BMF-02      gctgtggccctggccttcgacccaccagccaggaagacaaggcc------
A0A096NTE9_BMF-02      gctgtggccctggccttcgacccaccagccaggaagacaaggcc------
A0A096NTE9_BMF-01      gctgtggccctggccttcgacccaccagccaggaagacaaggcc------
A0A096NTE9_BMF-03      gctgtggccctggccttcgacccaccagccaggaagacaaggcc------
A0A5F7ZML1_BMF-01      gctgtggccctggccttcgacccaccagccaggaagacaaggcc------
A0A5F7ZML1_BMF-02      gctgtggccctggccttcgacccaccagccaggaagacaaggcc------
A0A5F7ZML1_BMF-03      gctgtggccctggccttcgacccaccagccaggaagacaaggcc------
A0A2K5MJW4_BMF-01      gctgtggccctggccttcgacccaccagccaggaagacaaggcc------
A0A2K6B5F6_BMF-03      gctgtggccctggccttcgacccaccagccaggaagacaaggcc------
A0A2K5Z4A9_BMF-02      gctgtggccctggccttcgacccaccagccaggaagacaaggcc------
A0A2K5MJW4_BMF-02      gctgtggccctggccttcgacccaccagccaggaagacaaggcc------
A0A2K6B5F6_BMF-01      gctgtggccctggccttcgacccaccagccaggaagacaaggcc------
A0A2K6B5F6_BMF-02      gctgtggccctggccttcgacccaccagccaggaagacaaggcc------
A0A2K6B5F6_BMF-04      gctgtggccctggccttcgacccaccagccaggaagacaaggcc------
A0A2K5Z4A9_BMF-01      gctgtggccctggccttcgacccaccagccaggaagacaaggcc------
A0A2K5KGP2_BMF-02      gctgtggccctggccttcgacccaccagccaggaagacaaggct------
A0A2K6RAW1_BMF-02      gctgtggccctggccttcgacccaccagccaggaagacaaggct------
A0A2K6RAW1_BMF-01      gctgtggccctggccttcgacccaccagccaggaagacaaggct------
A0A2K6L919_BMF-01      gctgtggccctggccttcgacccaccagccaggaagacaaggct------
A0A2K6L919_BMF-03      gctgtggccctggccttcgacccaccagccaggaagacaaggct------
A0A2K6L919_BMF-02      gctgtggccctggccttcgacccaccagccaggaagacaaggct------
A0A2U4BC98_BMF-01      gctgtggccctgggcttcgacccaccagccaggaagacaaggct------
G1PAU1_BMF-01          gctgtggccctgggcttcgacccatcagccaggaagacaaggcc------
A0A2I3HD83_BMF-01      gctgtggccctggccttcgacccaccagccaggaagacaaagct------
A0A2K6TW78_BMF-03      gctgtggccctggccttcgacccaccagccaggaagacaaggct------
A0A2K6TW78_BMF-02      gctgtggccctggccttcgacccaccagccaggaagacaaggct------
A0A2K6TW78_BMF-01      gctgtggccctggccttcgacccaccagccaggaagacaaggct------
A0A2J8T301_BMF-01      gctgtggccctggccttcgacccaccagccaggaagacaaagct------
G3T7Z4_BMF-01          gctgtggccctgggcttcgacacaccagccaggaggacaaggca------
A0A2K5RN49_BMF-02      gctgtggccctggccttcgacccaccagccaggaagacaaggct------
A0A2K5RN49_BMF-01      gctgtggccctggccttcgacccaccagccaggaagacaaggct------
F7HZL0_BMF-01          gctgtggccctggccttcgacccaccagccaggaagacaaggct------
A0A2K5E1Q4_BMF-02      gctgtggccctggccttcgacccaccagccaggaagacaaggct------
A0A2K5E1Q4_BMF-01      gctgtggccctggccttcgacccaccagccaggaagacaaggct------
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          gctgtggccctggccttcgacccaccagccaggaagacaaagct------
Q96LC9_BMF-07          gctgtggccctggccttcgacccaccagccaggaagacaaagct------
Q96LC9_BMF-01          gctgtggccctggccttcgacccaccagccaggaagacaaagct------
Q96LC9_BMF-02          gctgtggccctggccttcgacccaccagccaggaagacaaagct------
Q96LC9_BMF-03          gctgtggccctggccttcgacccaccagccaggaagacaaagct------
Q96LC9_BMF-04          gctgtggccctggccttcgacccaccagccaggaagacaaagct------
A0A2J8QDD5_BMF-01      gctgtggccctggccttcgacccaccagccaggaagacaaagct------
A0A2R9BS98_BMF-02      gctgtggccctggccttcgacccaccagccaggaagacaaagct------
Q96LC9_BMF-06          gctgtggccctggccttcgacccaccagccaggaagacaaagct------
A0A2I2Z168_BMF-02      gctgtggccctggccttcgacccaccagccaggaagacaaagct------
A0A2I2Z168_BMF-01      gctgtggccctggccttcgacccaccagccaggaagacaaagct------
Q96LC9_BMF-08          gctgtggccctggccttcgac-----------------------------
A0A2R9BS98_BMF-01      gctgtggccctggccttcgacccaccagccaggaagacaaagct------
A0A2J8QDD5_BMF-02      gctgtggccctggccttcgacccaccagccaggaagacaaagct------
                                                                         

A0A672RK14_BMF-01      ggtggagaggtgggacaaacagctaacagacacggacgctttgaagacag
A0A673JJ10_BMF-01      cgaggagaggtgggacaaacggctaacagacacggacgctttgaagacag
A0A3B4UNJ0_BMF-01      --------------------------------------------------
W5N4P7_BMF-01          --------------------------------------------------
A3KND0_BMF-01          --------------------------------------------------
Q0GKC7_BMF-01          --------------------------------------------------
A0A671M0H4_BMF-01      --------------------------------------------------
A0A671M0H4_BMF-02      --------------------------------------------------
A0A671MNR9_BMF-01      --------------------------------------------------
A0A672JWL9_BMF-01      --------------------------------------------------
A0A672JWL9_BMF-02      --------------------------------------------------
A0A673HDR4_BMF-01      --------------------------------------------------
A0A3B3RH63_BMF-01      --------------------------------------------------
K7FRX2_BMF-01          --------------------------------------------------
A0A452H3N6_BMF-01      --------------------------------------------------
A0A674IPL3_BMF-01      --------------------------------------------------
A0A493T7X1_BMF-01      --------------------------------------------------
A0A3Q2UCA0_BMF-01      --------------------------------------------------
A0A3Q2UCA0_BMF-02      --------------------------------------------------
A0A669PL85_BMF-02      --------------------------------------------------
A0A493T7X1_BMF-02      --------------------------------------------------
A0A3Q2UCA0_BMF-03      --------------------------------------------------
A0A3Q2UCA0_BMF-04      --------------------------------------------------
A9XRH0_BMF-01          --------------------------------------------------
G1NHG8_BMF-01          --------------------------------------------------
A0A669PL85_BMF-01      --------------------------------------------------
U3JS06_BMF-01          --------------------------------------------------
A0A674GIP8_BMF-03      --------------------------------------------------
A0A674GIP8_BMF-01      --------------------------------------------------
A0A674GIP8_BMF-02      --------------------------------------------------
A0A672V891_BMF-01      --------------------------------------------------
A0A663DZQ4_BMF-01      --------------------------------------------------
A0A663MPI8_BMF-01      --------------------------------------------------
A0A670XMZ5_BMF-01      --------------------------------------------------
H9GL49_BMF-01          --------------------------------------------------
A0A670JUU6_BMF-01      --------------------------------------------------
A0A670JUU6_BMF-05      --------------------------------------------------
A0A670JUU6_BMF-04      --------------------------------------------------
A0A670JUU6_BMF-02      --------------------------------------------------
A0A670JUU6_BMF-03      --------------------------------------------------
A0A4W3JXA1_BMF-01      --------------------------------------------------
A0A3Q2CXC4_BMF-01      --------------------------------------------------
A0A3Q2CXC4_BMF-02      --------------------------------------------------
A0A3B5QK08_BMF-01      --------------------------------------------------
A0A3B5QK08_BMF-02      --------------------------------------------------
A0A096LRV0_BMF-01      --------------------------------------------------
A0A3B3WU80_BMF-01      --------------------------------------------------
A0A3P9Q8E2_BMF-01      --------------------------------------------------
A0A3Q2PJX9_BMF-01      --------------------------------------------------
A0A3Q2PJX9_BMF-03      --------------------------------------------------
A0A3Q2PJX9_BMF-02      --------------------------------------------------
A0A3Q2YCX7_BMF-01      --------------------------------------------------
A0A3Q2YCX7_BMF-02      --------------------------------------------------
A0A3B5KWG6_BMF-02      --------------------------------------------------
A0A3B5KWG6_BMF-01      --------------------------------------------------
A0A3B5KWG6_BMF-03      --------------------------------------------------
A0A3B3CGR9_BMF-01      --------------------------------------------------
A0A3P9K487_BMF-01      --------------------------------------------------
A0A3P9K487_BMF-02      --------------------------------------------------
A0A3B3HAU1_BMF-01      --------------------------------------------------
A0A3B3HAU1_BMF-02      --------------------------------------------------
A0A3B3HAU1_BMF-03      --------------------------------------------------
A0A3B3HAU1_BMF-04      --------------------------------------------------
A0A3P9ICE1_BMF-04      --------------------------------------------------
A0A3P9ICE1_BMF-01      --------------------------------------------------
A0A3P9ICE1_BMF-02      --------------------------------------------------
A0A3P9ICE1_BMF-03      --------------------------------------------------
A0A3P9ICE1_BMF-05      --------------------------------------------------
A0A3P8NFE2_BMF-02      --------------------------------------------------
A0A668TQU8_BMF-01      --------------------------------------------------
I3K2D6_BMF-01          --------------------------------------------------
A0A3Q4G1I4_BMF-01      --------------------------------------------------
A0A3P8NFE2_BMF-01      --------------------------------------------------
A0A3P9DPJ5_BMF-01      --------------------------------------------------
A0A3P9DPJ5_BMF-02      --------------------------------------------------
A0A3B4ETH0_BMF-01      --------------------------------------------------
A0A3Q3C5V2_BMF-01      --------------------------------------------------
A0A672HG10_BMF-01      --------------------------------------------------
A0A3P8UA78_BMF-02      --------------------------------------------------
A0A3P8UA78_BMF-01      --------------------------------------------------
A0A3P8UA78_BMF-03      --------------------------------------------------
A0A3Q3GUU5_BMF-01      --------------------------------------------------
A0A3Q3VLX6_BMF-01      --------------------------------------------------
A0A3Q2ZA20_BMF-01      --------------------------------------------------
A0A667YNR9_BMF-01      --------------------------------------------------
A0A3Q3LME3_BMF-01      --------------------------------------------------
A0A3Q3LME3_BMF-02      --------------------------------------------------
A0A3Q3LME3_BMF-03      --------------------------------------------------
A0A3Q1IPR4_BMF-01      --------------------------------------------------
A0A3Q3QZ16_BMF-01      --------------------------------------------------
A0A3Q3QZ16_BMF-02      --------------------------------------------------
A0A665VG08_BMF-01      --------------------------------------------------
A0A673C8N3_BMF-01      --------------------------------------------------
A0A3Q1FVH7_BMF-01      --------------------------------------------------
A0A3Q1FVH7_BMF-02      --------------------------------------------------
A0A3B5B8F6_BMF-01      --------------------------------------------------
A0A3Q1D1K3_BMF-01      --------------------------------------------------
A0A3P8RKY9_BMF-01      --------------------------------------------------
A0A671X848_BMF-01      --------------------------------------------------
A0A0F8AD62_BMF-01      --------------------------------------------------
A0A4W6DUL1_BMF-01      --------------------------------------------------
A0A2U9CJH3_BMF-01      --------------------------------------------------
A0A3B4U5H8_BMF-01      --------------------------------------------------
A0A3B4WM88_BMF-01      --------------------------------------------------
A0A3P8ZIE7_BMF-01      --------------------------------------------------
A0A4W5N3A7_BMF-01      --------------------------------------------------
A0A6F9BGV6_BMF-01      --------------------------------------------------
A0A1S3SNN2_BMF-01      --------------------------------------------------
A0A674EF64_BMF-01      --------------------------------------------------
A0A1S3P5K4_BMF-01      --------------------------------------------------
A0A6F9B4C5_BMF-01      --------------------------------------------------
A0A4W5N721_BMF-01      --------------------------------------------------
A0A1S3P5K4_BMF-02      --------------------------------------------------
A0A673YQV3_BMF-01      --------------------------------------------------
A0A4W4DZH9_BMF-01      --------------------------------------------------
A0A3B4CNJ8_BMF-01      --------------------------------------------------
A0A3B1K1X5_BMF-01      --------------------------------------------------
A0A3B4B6Y3_BMF-01      --------------------------------------------------
A0A6I8NF73_BMF-01      --------------------------------------------------
A0A5F8GKJ8_BMF-01      --------------------------------------------------
G3WDQ2_BMF-01          --------------------------------------------------
A0A4X2KLG2_BMF-01      --------------------------------------------------
Q8K589_BMF-01          --------------------------------------------------
Q91ZE9_BMF-02          --------------------------------------------------
Q91ZE9_BMF-01          --------------------------------------------------
Q91ZE9_BMF-06          --------------------------------------------------
A0A287CXH0_BMF-01      --------------------------------------------------
A0A287CXH0_BMF-02      --------------------------------------------------
A0A671DWL6_BMF-01      --------------------------------------------------
A0A671DWL6_BMF-02      --------------------------------------------------
A0A2K6FFN3_BMF-01      --------------------------------------------------
A0A2K6FFN3_BMF-02      --------------------------------------------------
A0A673TA87_BMF-01      --------------------------------------------------
L8IXF5_BMF-01          --------------------------------------------------
A0A4W2EII1_BMF-01      --------------------------------------------------
A0A4W2EII1_BMF-01      --------------------------------------------------
Q05KI3_BMF-01          --------------------------------------------------
Q05KI3_BMF-02          --------------------------------------------------
A0A4W2INA4_BMF-01      --------------------------------------------------
A0A4W2INA4_BMF-01      --------------------------------------------------
A0A452F2E0_BMF-01      --------------------------------------------------
A0A452F2E0_BMF-02      --------------------------------------------------
W5QFV1_BMF-01          --------------------------------------------------
H0WYH6_BMF-01          --------------------------------------------------
A0A337ST43_BMF-02      --------------------------------------------------
A0A337ST43_BMF-03      --------------------------------------------------
A0A337ST43_BMF-05      --------------------------------------------------
A0A337ST43_BMF-01      --------------------------------------------------
A0A337ST43_BMF-04      --------------------------------------------------
A0A667H967_BMF-01      --------------------------------------------------
M3YAD5_BMF-01          --------------------------------------------------
U6CSY8_BMF-01          --------------------------------------------------
A0A452SED0_BMF-01      --------------------------------------------------
A0A384D070_BMF-01      --------------------------------------------------
A0A5F4CJ04_BMF-04      --------------------------------------------------
A0A5F4CJ04_BMF-03      --------------------------------------------------
A0A5F4CJ04_BMF-01      --------------------------------------------------
A0A5F4CJ04_BMF-02      --------------------------------------------------
A0A4X1UQ42_BMF-01      --------------------------------------------------
A0A4X1UQ42_BMF-02      --------------------------------------------------
A0A287AIU8_BMF-01      --------------------------------------------------
A0A287AIU8_BMF-02      --------------------------------------------------
A0A3Q2HR24_BMF-01      --------------------------------------------------
A0A3Q2HR24_BMF-02      --------------------------------------------------
G1SR62_BMF-01          --------------------------------------------------
A0A286XXB0_BMF-03      --------------------------------------------------
A0A286XXB0_BMF-01      --------------------------------------------------
A0A286XXB0_BMF-02      --------------------------------------------------
A0A2K5KGP2_BMF-01      --------------------------------------------------
A0A0D9R4R5_BMF-01      --------------------------------------------------
A0A2K5VLE9_BMF-01      --------------------------------------------------
A0A2K5VLE9_BMF-02      --------------------------------------------------
A0A096NTE9_BMF-02      --------------------------------------------------
A0A096NTE9_BMF-01      --------------------------------------------------
A0A096NTE9_BMF-03      --------------------------------------------------
A0A5F7ZML1_BMF-01      --------------------------------------------------
A0A5F7ZML1_BMF-02      --------------------------------------------------
A0A5F7ZML1_BMF-03      --------------------------------------------------
A0A2K5MJW4_BMF-01      --------------------------------------------------
A0A2K6B5F6_BMF-03      --------------------------------------------------
A0A2K5Z4A9_BMF-02      --------------------------------------------------
A0A2K5MJW4_BMF-02      --------------------------------------------------
A0A2K6B5F6_BMF-01      --------------------------------------------------
A0A2K6B5F6_BMF-02      --------------------------------------------------
A0A2K6B5F6_BMF-04      --------------------------------------------------
A0A2K5Z4A9_BMF-01      --------------------------------------------------
A0A2K5KGP2_BMF-02      --------------------------------------------------
A0A2K6RAW1_BMF-02      --------------------------------------------------
A0A2K6RAW1_BMF-01      --------------------------------------------------
A0A2K6L919_BMF-01      --------------------------------------------------
A0A2K6L919_BMF-03      --------------------------------------------------
A0A2K6L919_BMF-02      --------------------------------------------------
A0A2U4BC98_BMF-01      --------------------------------------------------
G1PAU1_BMF-01          --------------------------------------------------
A0A2I3HD83_BMF-01      --------------------------------------------------
A0A2K6TW78_BMF-03      --------------------------------------------------
A0A2K6TW78_BMF-02      --------------------------------------------------
A0A2K6TW78_BMF-01      --------------------------------------------------
A0A2J8T301_BMF-01      --------------------------------------------------
G3T7Z4_BMF-01          --------------------------------------------------
A0A2K5RN49_BMF-02      --------------------------------------------------
A0A2K5RN49_BMF-01      --------------------------------------------------
F7HZL0_BMF-01          --------------------------------------------------
A0A2K5E1Q4_BMF-02      --------------------------------------------------
A0A2K5E1Q4_BMF-01      --------------------------------------------------
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          --------------------------------------------------
Q96LC9_BMF-02          --------------------------------------------------
Q96LC9_BMF-03          --------------------------------------------------
Q96LC9_BMF-04          --------------------------------------------------
A0A2J8QDD5_BMF-01      --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
Q96LC9_BMF-06          --------------------------------------------------
A0A2I2Z168_BMF-02      --------------------------------------------------
A0A2I2Z168_BMF-01      --------------------------------------------------
Q96LC9_BMF-08          --------------------------------------------------
A0A2R9BS98_BMF-01      --------------------------------------------------
A0A2J8QDD5_BMF-02      --------------------------------------------------
                                                                         

A0A672RK14_BMF-01      atcaacgcaga---ctgccagctctgtgctgaattcagtgagaaacggag
A0A673JJ10_BMF-01      atcgacgcaga---ctgccagaactgtgctgaattcagcgagagatggag
A0A3B4UNJ0_BMF-01      ----acaccgattgcagccggacaggcc----------------------
W5N4P7_BMF-01          ----acgcaga---cgccaagtccagccttggtacatggtga---caa--
A3KND0_BMF-01          ----acacaga---ctctggggtcacctt---------ctcaggacat--
Q0GKC7_BMF-01          ----actgagt---tggcaggacgtcccgctgggtcacgcaa---cgg--
A0A671M0H4_BMF-01      ----accgaga---cagcagggacaccccctgtatcccccag---cgg--
A0A671M0H4_BMF-02      ----accgaga---cagcagggacaccccctgtatcccccag---cgg--
A0A671MNR9_BMF-01      ----accgaga---cagcagggagaccccctctatcccccag---cgg--
A0A672JWL9_BMF-01      ----accgaga---ccgcagggataccccctctatgccccag---cgg--
A0A672JWL9_BMF-02      ----accgaga---ccgcagggataccccctctatgccccag---cgg--
A0A673HDR4_BMF-01      ----accgaga---cagcagggagaccccctctatcccccag---cgg--
A0A3B3RH63_BMF-01      ----acgcaga---cgcccggcccagccctggtgcagggcct---caa--
K7FRX2_BMF-01          ----acccaaa---cactcagcccatcct---cttccactcaggatgt--
A0A452H3N6_BMF-01      ----acccaaa---cactcagtccatcct---cttctactcaggatgt--
A0A674IPL3_BMF-01      ----acccaaa---cactcagtccatcct---cttccactcaggatgt--
A0A493T7X1_BMF-01      ----actcaaa---cactcagcccgtcct---cttccagtcaggatgt--
A0A3Q2UCA0_BMF-01      ----actcaaa---cactcagcccgtcct---cttccagtcaggatgt--
A0A3Q2UCA0_BMF-02      ----actcaaa---cactcagcccgtcct---cttccagtcaggatgt--
A0A669PL85_BMF-02      ----actcaaa---cactcagcccgtcct---cttccagtcaggatgt--
A0A493T7X1_BMF-02      ----actcaaa---cactcagcccgtcct---cttccagtcaggatgt--
A0A3Q2UCA0_BMF-03      ----actcaaa---cactcagcccgtcct---cttccagtcaggatgt--
A0A3Q2UCA0_BMF-04      ----actcaaa---cactcagcccgtcct---cttccagtcaggatgt--
A9XRH0_BMF-01          --------------------------------------------------
G1NHG8_BMF-01          ----actcaaa---cactcagcccgtcct---cttccagtcaggatgt--
A0A669PL85_BMF-01      ----actcaaa---cactcagcccgtcct---cttccagtcaggatgt--
U3JS06_BMF-01          ----actcaaa---cactcagcccatcct---cttccagtcaggatgt--
A0A674GIP8_BMF-03      ----actcaaa---cactcagcccatcct---cttccagtcaggatgt--
A0A674GIP8_BMF-01      ----actcaaa---cactcagcccatcct---cttccagtcaggatgt--
A0A674GIP8_BMF-02      ----actcaaa---cactcagcccatcct---cttccagtcaggatgt--
A0A672V891_BMF-01      ----actcaaa---cactcagcccatcct---cttccagtcaggatgt--
A0A663DZQ4_BMF-01      ----actcaaa---cactcagcccgtcct---cttccagtcaggatgt--
A0A663MPI8_BMF-01      ----actcaaa---cactcagcccgtcct---cttccagtcaggatgt--
A0A670XMZ5_BMF-01      ----acacaga---cccttaatgcatcct---cttccagccaggatat--
H9GL49_BMF-01          ----acacaaa---cactcaacccatcct---cttccagccaggatgt--
A0A670JUU6_BMF-01      ----actcaaa---ccctcaacccatcct---cttctagccaggatgt--
A0A670JUU6_BMF-05      ----actcaaa---ccctcaacccatcct---cttctagccaggatgt--
A0A670JUU6_BMF-04      ----actcaaa---ccctcaacccatcct---cttctagccaggatgt--
A0A670JUU6_BMF-02      ----actcaaa---ccctcaacccatcct---cttctagccaggatgt--
A0A670JUU6_BMF-03      ----actcaaa---ccctcaacccatcct---cttctagccaggatgt--
A0A4W3JXA1_BMF-01      ----acccaga---cccccacctctatccccgggtcagacctcgcagagc
A0A3Q2CXC4_BMF-01      ----acacaaa---cgcccggtcctggcgtggcaccacataa---cgt--
A0A3Q2CXC4_BMF-02      ----acacaaa---cgcccggtcctggcgtggcaccacataa---cgt--
A0A3B5QK08_BMF-01      ----acgcaga---cgcccggtcctggccaggcactacacaa---cgg--
A0A3B5QK08_BMF-02      ----acgcaga---cgcccggtcctggccaggcactacacaa---cgg--
A0A096LRV0_BMF-01      ----acgcaga---cgcccggtccgggccaggcgctacacaa---cgg--
A0A3B3WU80_BMF-01      ----acgcaga---cgcccggtccgggccaggcgctacacaa---cgg--
A0A3P9Q8E2_BMF-01      ----acgcaga---cgcccggtcctggccaggcgctacacaa---cgg--
A0A3Q2PJX9_BMF-01      ----acgcaga---cgcccggtcctgccctggcaccgaacaa---cgg--
A0A3Q2PJX9_BMF-03      ----acgcaga---cgcccggtcctgccctggcaccgaacaa---cgg--
A0A3Q2PJX9_BMF-02      ----acgcaga---cgcccggtcctgccctggcaccgaacaa---cgg--
A0A3Q2YCX7_BMF-01      ----acacaga---cacctggccccgtcccggcatcaaacaa---cgg--
A0A3Q2YCX7_BMF-02      ----acacaga---cacctggccccgtcccggcatcaaacaa---cgg--
A0A3B5KWG6_BMF-02      ----acgcaga---cacctggcccgaccctggcaccgcacag---cgg--
A0A3B5KWG6_BMF-01      ----acgcaga---cacctggcccgaccctggcaccgcacag---cgg--
A0A3B5KWG6_BMF-03      ----acgcaga---cacctggcccgaccctggcaccgcacag---cgg--
A0A3B3CGR9_BMF-01      ----acgcaga---cgcccggtcctgccctggtaccaaacaa---cgg--
A0A3P9K487_BMF-01      ----acgcaga---cacccggtcctgccctggtaccaaacaa---cgg--
A0A3P9K487_BMF-02      ----acgcaga---cacccggtcctgccctggtaccaaacaa---cgg--
A0A3B3HAU1_BMF-01      ----acgcaga---cacccggtcctgccctggtaccaaacaa---cgg--
A0A3B3HAU1_BMF-02      ----acgcaga---cacccggtcctgccctggtaccaaacaa---cgg--
A0A3B3HAU1_BMF-03      ----acgcaga---cacccggtcctgccctggtaccaaacaa---cgg--
A0A3B3HAU1_BMF-04      ----acgcaga---cacccggtcctgccctggtaccaaacaa---cgg--
A0A3P9ICE1_BMF-04      ----acgcaga---cacccggtcctgccctggtaccaaacaa---cgg--
A0A3P9ICE1_BMF-01      ----acgcaga---cacccggtcctgccctggtaccaaacaa---cgg--
A0A3P9ICE1_BMF-02      ----acgcaga---cacccggtcctgccctggtaccaaacaa---cgg--
A0A3P9ICE1_BMF-03      ----acgcaga---cacccggtcctgccctggtaccaaacaa---cgg--
A0A3P9ICE1_BMF-05      ----acgcaga---cacccggtcctgccctggtaccaaacaa---cgg--
A0A3P8NFE2_BMF-02      ----acacaga---cacccggtcctgccctggtaccaaacaa---cgg--
A0A668TQU8_BMF-01      ----acacaga---cacccggtcctgccctggtaccaaacaa---cgg--
I3K2D6_BMF-01          ----acacaga---cacccggtcctgccctggtaccaaacaa---cgg--
A0A3Q4G1I4_BMF-01      ----acacaga---cacccggtcctgccctggtaccaaacaa---cgg--
A0A3P8NFE2_BMF-01      ----acacaga---cacccggtcctgccctggtaccaaacaa---cgg--
A0A3P9DPJ5_BMF-01      ----acacaga---cacccggtcctgccctggtaccaaacaa---cgg--
A0A3P9DPJ5_BMF-02      ----acacaga---cacccggtcctgccctggtaccaaacaa---cgg--
A0A3B4ETH0_BMF-01      ----acacaga---cacccggtcctgccctggtaccaaacaa---cgg--
A0A3Q3C5V2_BMF-01      ----acacaga---cacccggtcctgccctggtaccaaacaa---cgg--
A0A672HG10_BMF-01      ----acgcaga---cgcctggccctgtcctggtgcccaacaa---cgg--
A0A3P8UA78_BMF-02      ----acacaga---cacctggtccagacctggcactgaacaa---cgg--
A0A3P8UA78_BMF-01      ----acacaga---cacctggtccagacctggcactgaacaa---cgg--
A0A3P8UA78_BMF-03      ----acacaga---cacctggtccagacctggcactgaacaa---cgg--
A0A3Q3GUU5_BMF-01      ----acgcaga---cacctggcccggccctggcacccaacaa---cgg--
A0A3Q3VLX6_BMF-01      ----acgcaga---cacctggccctgccctggcaccatacag---cgg--
A0A3Q2ZA20_BMF-01      ----acacaga---cacccggtcctgccctggtaccacacag---cgg--
A0A667YNR9_BMF-01      ----acacaga---cacccggccctgccctcacattggccaa---cgg--
A0A3Q3LME3_BMF-01      ----acacaga---cacctggccctgccttggcgctgaacaa---cgg--
A0A3Q3LME3_BMF-02      ----acacaga---cacctggccctgccttggcgctgaacaa---cgg--
A0A3Q3LME3_BMF-03      ----acacaga---cacctggccctgccttggcgctgaacaa---cgg--
A0A3Q1IPR4_BMF-01      ----acacaga---cacctggccctgcgctgccacagaacaa---cgg--
A0A3Q3QZ16_BMF-01      ----acacaga---cagctggccctaccctggcaccgaacaa---cag--
A0A3Q3QZ16_BMF-02      ----acacaga---cagctggccctaccctggcaccgaacaa---cag--
A0A665VG08_BMF-01      ----acgcaga---cacctggccctgccctgggaccgaacaa---cgg--
A0A673C8N3_BMF-01      ----acacaga---cacctggccttgccctggcacccaacaa---cgg--
A0A3Q1FVH7_BMF-01      ----acacaga---ctcctggtcctgccctacaaccaaacaa---cgg--
A0A3Q1FVH7_BMF-02      ----acacaga---ctcctggtcctgccctacaaccaaacaa---cgg--
A0A3B5B8F6_BMF-01      ----acacaga---ctcctggtcctgccctgcaaccaaacaa---cgg--
A0A3Q1D1K3_BMF-01      ----acacaga---ctcctggtcctgccctgcaaccaaacaa---cgg--
A0A3P8RKY9_BMF-01      ----acacaga---ctcctggtcctgccctgcaaccaaacaa---cgg--
A0A671X848_BMF-01      ----acacaga---cacctggccctgccctggcactgtacaa---cgg--
A0A0F8AD62_BMF-01      ----acacaga---cacctggtcctgccctggcaccgtacaa---cgg--
A0A4W6DUL1_BMF-01      ----acgcaga---cacctggccctgccctggcactgaacaa---cgg--
A0A2U9CJH3_BMF-01      ----acacaga---cacctggccctgccctggcactgaacaa---cgg--
A0A3B4U5H8_BMF-01      ----acacaaa---cacctggcccagccctggcactgaacaa---cgg--
A0A3B4WM88_BMF-01      ----acacaaa---cacctggcccagccctggcactgaacaa---cgg--
A0A3P8ZIE7_BMF-01      ----acccaga---ctcccacaactgctctggcactgctcaa---tga--
A0A4W5N3A7_BMF-01      ----acccaga---cacccagccctgccctggcactgcgcaa---caa--
A0A6F9BGV6_BMF-01      ----acccaga---cgcccagccctgccctggcactgcccaa---cga--
A0A1S3SNN2_BMF-01      ----acccaga---cacccagccctgccctggcactgcccaa---cga--
A0A674EF64_BMF-01      ----acccaga---cacccagccctgccctggcactgcccaa---cga--
A0A1S3P5K4_BMF-01      ----acccaga---cacccagccctgtcctgccactgcccaa---taa--
A0A6F9B4C5_BMF-01      ----acccaga---cacccagccctgtcctggcactgcccaa---tag--
A0A4W5N721_BMF-01      ----acacaga---cacccagccctgtcctgccactgcccaa---taa--
A0A1S3P5K4_BMF-02      ----acccaga---cacccagccctgtcctgccactgcccaa---taa--
A0A673YQV3_BMF-01      ----acccaga---cacccagccctgtcctgccactgcccaa---taa--
A0A4W4DZH9_BMF-01      ----acacaga---ctg-cagggcggccactggcgaggcccaa--cgg--
A0A3B4CNJ8_BMF-01      ----actcaga---ctc-cggggcggccgccagctcggcccaa--cgg--
A0A3B1K1X5_BMF-01      ----acacaga---ctc-cagggcggccgccggctcggaccaa--tgg--
A0A3B4B6Y3_BMF-01      ----acgcaga---cccctggccctgccctggcccccaacaaagg-----
A0A6I8NF73_BMF-01      ----actcaga---ccctgagcccggccg---ccccgagccaaggcgt--
A0A5F8GKJ8_BMF-01      ----actcaga---ctctcagtccagcat---cccccagccaaggtgt--
G3WDQ2_BMF-01          ----actcaga---ccctcagtccagcct---ccccaagccagggtgt--
A0A4X2KLG2_BMF-01      ----actcaga---ccctcagtccggcat---ccccaagccagggtgt--
Q8K589_BMF-01          ----acccaga---ccctcagcccagcct---ccccaagccagggtgt--
Q91ZE9_BMF-02          ----actcaga---ccctcagtccagctt---ccccaagccagggtgt--
Q91ZE9_BMF-01          ----actcaga---ccctcagtccagctt---ccccaagccagggtgt--
Q91ZE9_BMF-06          ----actcaga---ccctcagtccagctt---ccccaagccagggtgt--
A0A287CXH0_BMF-01      ----actcaga---ccctcagcccagcct---ccccaagccagggtgt--
A0A287CXH0_BMF-02      ----actcaga---ccctcagcccagcct---ccccaagccagggtgt--
A0A671DWL6_BMF-01      ----acccaga---cgctcagtccagcct---ccccaagccagggtgt--
A0A671DWL6_BMF-02      ----acccaga---cgctcagtccagcct---ccccaagccagggtgt--
A0A2K6FFN3_BMF-01      ----acccaga---ccctcagcccagcct---ccccaagccagggtgt--
A0A2K6FFN3_BMF-02      ----acccaga---ccctcagcccagcct---ccccaagccagggtgt--
A0A673TA87_BMF-01      ----acccaga---cccttagtccggctt---ccccgagtcagggtgt--
L8IXF5_BMF-01          ----acccaga---ctctcagcccagctt---ccccgagccagggtgt--
A0A4W2EII1_BMF-01      ----acccaga---ctctcagcccagctt---ccccgagccagggtgt--
A0A4W2EII1_BMF-01      ----acccaga---ctctcagcccagctt---ccccgagccagggtgt--
Q05KI3_BMF-01          ----acccaga---ctctcagcccagctt---ccccgagccagggtgt--
Q05KI3_BMF-02          ----acccaga---ctctcagcccagctt---ccccgagccagggtgt--
A0A4W2INA4_BMF-01      ----acccaga---ctctcagcccagctt---ccccgagccagggtgt--
A0A4W2INA4_BMF-01      ----acccaga---ctctcagcccagctt---ccccgagccagggtgt--
A0A452F2E0_BMF-01      ----acccaga---ctctcagcccagctt---ccccgagccagggtgt--
A0A452F2E0_BMF-02      ----acccaga---ctctcagcccagctt---ccccgagccagggtgt--
W5QFV1_BMF-01          ----acccaga---ctctcagcccagctt---ccccgagccagggtgt--
H0WYH6_BMF-01          ----actcaga---ccctcagcccagcct---ccccaagccagggtgt--
A0A337ST43_BMF-02      ----acccaga---ccctcagtccggcct---ccccgagtcagggtgt--
A0A337ST43_BMF-03      ----acccaga---ccctcagtccggcct---ccccgagtcagggtgt--
A0A337ST43_BMF-05      ----acccaga---ccctcagtccggcct---ccccgagtcagggtgt--
A0A337ST43_BMF-01      ----acccaga---ccctcagtccggcct---ccccgagtcagggtgt--
A0A337ST43_BMF-04      ----acccaga---ccctcagtccggcct---ccccgagtcagggtgt--
A0A667H967_BMF-01      ----acccaga---ccctcagtccggcct---ccccgagtcagggtgt--
M3YAD5_BMF-01          ----acccaga---ccctcagtccagcct---ccccgagtcagggtgt--
U6CSY8_BMF-01          ----acccaga---ccctcagtccggcct---ccccgagtcagggtgt--
A0A452SED0_BMF-01      ----acccaga---ccctgagcccggcct---ccccgagtcagggtgt--
A0A384D070_BMF-01      ----acccaga---ccctgagcccggcct---ccccgagtcagggtgt--
A0A5F4CJ04_BMF-04      ----acccaga---ccctcagtccggcct---ccccaagtcagggtgt--
A0A5F4CJ04_BMF-03      ----acccaga---ccctcagtccggcct---ccccaagtcagggtgt--
A0A5F4CJ04_BMF-01      ----acccaga---ccctcagtccggcct---ccccaagtcagggtgt--
A0A5F4CJ04_BMF-02      ----acccaga---ccctcagtccggcct---ccccaagtcagggtgt--
A0A4X1UQ42_BMF-01      ----acccaga---ctctcagtccagcct---ccccgagccagggtgt--
A0A4X1UQ42_BMF-02      ----acccaga---ctctcagtccagcct---ccccgagccagggtgt--
A0A287AIU8_BMF-01      ----acccaga---ctctcagtccagcct---ccccgagccagggtgt--
A0A287AIU8_BMF-02      ----acccaga---ctctcagtccagcct---ccccgagccagggtgt--
A0A3Q2HR24_BMF-01      ----acccaga---ccctcagtccagcct---ccccaagccagggtgt--
A0A3Q2HR24_BMF-02      ----acccaga---ccctcagtccagcct---ccccaagccagggtgt--
G1SR62_BMF-01          ----acccaga---ccctcagccccgcct---ccccgagccaaggggt--
A0A286XXB0_BMF-03      ----actcaga---ccctcagcccatcct---ctccaagccagggtgt--
A0A286XXB0_BMF-01      ----actcaga---ccctcagcccatcct---ctccaagccagggtgt--
A0A286XXB0_BMF-02      ----actcaga---ccctcagcccatcct---ctccaagccagggtgt--
A0A2K5KGP2_BMF-01      ----acccaga---ccctcggcccagcct---cccccagccaaggtgt--
A0A0D9R4R5_BMF-01      ----acccaga---cccttggcccagcct---cccccagccaaggtgt--
A0A2K5VLE9_BMF-01      ----acccaga---ccctcggcccagcct---cccccagccaaggtgt--
A0A2K5VLE9_BMF-02      ----acccaga---ccctcggcccagcct---cccccagccaaggtgt--
A0A096NTE9_BMF-02      ----acccaga---ccctcggcccagcct---cccccagccaaggtgt--
A0A096NTE9_BMF-01      ----acccaga---ccctcggcccagcct---cccccagccaaggtgt--
A0A096NTE9_BMF-03      ----acccaga---ccctcggcccagcct---cccccagccaaggtgt--
A0A5F7ZML1_BMF-01      ----acccaga---ccctcggcccagcct---cccccagccaaggtgt--
A0A5F7ZML1_BMF-02      ----acccaga---ccctcggcccagcct---cccccagccaaggtgt--
A0A5F7ZML1_BMF-03      ----acccaga---ccctcggcccagcct---cccccagccaaggtgt--
A0A2K5MJW4_BMF-01      ----acccaga---ccctcggcccagcct---cccccagccaaggtgt--
A0A2K6B5F6_BMF-03      ----acccaga---ccctcggcccagcct---cccccagccaaggtgt--
A0A2K5Z4A9_BMF-02      ----acccaga---ccctcggcccagcct---cccccagccaaggtgt--
A0A2K5MJW4_BMF-02      ----acccaga---ccctcggcccagcct---cccccagccaaggtgt--
A0A2K6B5F6_BMF-01      ----acccaga---ccctcggcccagcct---cccccagccaaggtgt--
A0A2K6B5F6_BMF-02      ----acccaga---ccctcggcccagcct---cccccagccaaggtgt--
A0A2K6B5F6_BMF-04      ----acccaga---ccctcggcccagcct---cccccagccaaggtgt--
A0A2K5Z4A9_BMF-01      ----acccaga---ccctcggcccagcct---cccccagccaaggtgt--
A0A2K5KGP2_BMF-02      ----acccaga---ccctcggcccagcct---cccccagccaaggtgt--
A0A2K6RAW1_BMF-02      ----acccaga---ccctcggcccagcct---cccccagccaaggtgt--
A0A2K6RAW1_BMF-01      ----acccaga---ccctcggcccagcct---cccccagccaaggtgt--
A0A2K6L919_BMF-01      ----acccaga---ccctcggcccagcct---cccccagccaaggtgt--
A0A2K6L919_BMF-03      ----acccaga---ccctcggcccagcct---cccccagccaaggtgt--
A0A2K6L919_BMF-02      ----acccaga---ccctcggcccagcct---cccccagccaaggtgt--
A0A2U4BC98_BMF-01      ----acccaga---ctctcagtccagcct---ccccaagccagggtgt--
G1PAU1_BMF-01          ----acccaga---ccctcagtccagcct---ccccgagccagggtgt--
A0A2I3HD83_BMF-01      ----acccaga---ccctcagcccagcct---cccccagccaaggtgt--
A0A2K6TW78_BMF-03      ----acccaga---ccctcagcccagcct---cccccagccaaggtgt--
A0A2K6TW78_BMF-02      ----acccaga---ccctcagcccagcct---cccccagccaaggtgt--
A0A2K6TW78_BMF-01      ----acccaga---ccctcagcccagcct---cccccagccaaggtgt--
A0A2J8T301_BMF-01      ----acccaga---ccctcagcccagcct---cccccagccaaggtgt--
G3T7Z4_BMF-01          ----actcaga---ctctcagcccagcct---ccccaagccagggtgt--
A0A2K5RN49_BMF-02      ----acccaga---ccctcagcccagcct---cccccagccaaggtgt--
A0A2K5RN49_BMF-01      ----acccaga---ccctcagcccagcct---cccccagccaaggtgt--
F7HZL0_BMF-01          ----acccaga---ccctcagcccagcct---cccccagccaaggtgt--
A0A2K5E1Q4_BMF-02      ----acccaga---ccctcagcccagcct---cccccagccaaggtgt--
A0A2K5E1Q4_BMF-01      ----acccaga---ccctcagcccagcct---cccccagccaaggtgt--
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          ----acccaga---ctctcagcccagcct---cccccagccaaggtgt--
Q96LC9_BMF-07          ----acccaga---ctctcagcccagcct---cccccagccaaggtgt--
Q96LC9_BMF-01          ----acccaga---ctctcagcccagcct---cccccagccaaggtgt--
Q96LC9_BMF-02          ----acccaga---ctctcagcccagcct---cccccagccaaggtgt--
Q96LC9_BMF-03          ----acccaga---ctctcagcccagcct---cccccagccaaggtgt--
Q96LC9_BMF-04          ----acccaga---ctctcagcccagcct---cccccagccaaggtgt--
A0A2J8QDD5_BMF-01      ----acccaga---ccctcagcccagcct---cccccagccaaggtgt--
A0A2R9BS98_BMF-02      ----acccaga---ccctcagcccagcct---cccccagccaaggtgt--
Q96LC9_BMF-06          ----acccaga---ctctcagcccagcct---cccccagccaaggtgt--
A0A2I2Z168_BMF-02      ----acccaga---ccctcagcccagcct---cccccagccaaggtgt--
A0A2I2Z168_BMF-01      ----acccaga---ccctcagcccagcct---cccccagccaaggtgt--
Q96LC9_BMF-08          --------------------------------------------------
A0A2R9BS98_BMF-01      ----acccaga---ccctcagcccagcct---cccccagccaaggtgt--
A0A2J8QDD5_BMF-02      ----acccaga---ccctcagcccagcct---cccccagccaaggtgt--
                                                                         

A0A672RK14_BMF-01      atatggcaccattccagggtttagagggagatgcatcatctccctgcaga
A0A673JJ10_BMF-01      atatggcaccattccag---------------------------------
A0A3B4UNJ0_BMF-01      -cttactgcc----------------------------------------
W5N4P7_BMF-01          -catgttgccgt--------------------------------------
A3KND0_BMF-01          -catgctaccat--------------------------------------
Q0GKC7_BMF-01          -tatgctgctct--------------------------------------
A0A671M0H4_BMF-01      -catgctgccct--------------------------------------
A0A671M0H4_BMF-02      -catgctgccct--------------------------------------
A0A671MNR9_BMF-01      -catgctgccct--------------------------------------
A0A672JWL9_BMF-01      -catgctgccct--------------------------------------
A0A672JWL9_BMF-02      -catgctgccct--------------------------------------
A0A673HDR4_BMF-01      -catgctgccct--------------------------------------
A0A3B3RH63_BMF-01      -catgctgccct--------------------------------------
K7FRX2_BMF-01          -catgttgccat--------------------------------------
A0A452H3N6_BMF-01      -catgttgccat--------------------------------------
A0A674IPL3_BMF-01      -catgttgccat--------------------------------------
A0A493T7X1_BMF-01      -tatgttgcctt--------------------------------------
A0A3Q2UCA0_BMF-01      -tatgttgcctt--------------------------------------
A0A3Q2UCA0_BMF-02      -tatgttgcctt--------------------------------------
A0A669PL85_BMF-02      -tatgttgcctt--------------------------------------
A0A493T7X1_BMF-02      -tatgttgcctt--------------------------------------
A0A3Q2UCA0_BMF-03      -tatgttgcctt--------------------------------------
A0A3Q2UCA0_BMF-04      -tatgttgcctt--------------------------------------
A9XRH0_BMF-01          --------------------------------------------------
G1NHG8_BMF-01          -tatgttgcctt--------------------------------------
A0A669PL85_BMF-01      -tatgttgcctt--------------------------------------
U3JS06_BMF-01          -tatgttgcctt--------------------------------------
A0A674GIP8_BMF-03      -tatgttgcctt--------------------------------------
A0A674GIP8_BMF-01      -tatgttgcctt--------------------------------------
A0A674GIP8_BMF-02      -tatgttgcctt--------------------------------------
A0A672V891_BMF-01      -tatgttgcctt--------------------------------------
A0A663DZQ4_BMF-01      -tatgttgcctt--------------------------------------
A0A663MPI8_BMF-01      -tatgttgcctt--------------------------------------
A0A670XMZ5_BMF-01      -catgttacctt--------------------------------------
H9GL49_BMF-01          -gatgttacctt--------------------------------------
A0A670JUU6_BMF-01      -catgttacctt--------------------------------------
A0A670JUU6_BMF-05      -catgttacctt--------------------------------------
A0A670JUU6_BMF-04      -catgttacctt--------------------------------------
A0A670JUU6_BMF-02      -catgttacctt--------------------------------------
A0A670JUU6_BMF-03      -catgttacctt--------------------------------------
A0A4W3JXA1_BMF-01      ccagcttaccag--------------------------------------
A0A3Q2CXC4_BMF-01      -tatgctgccct--------------------------------------
A0A3Q2CXC4_BMF-02      -tatgctgccct--------------------------------------
A0A3B5QK08_BMF-01      -catgctgccct--------------------------------------
A0A3B5QK08_BMF-02      -catgctgccct--------------------------------------
A0A096LRV0_BMF-01      -catgctgccct--------------------------------------
A0A3B3WU80_BMF-01      -catgctgccct--------------------------------------
A0A3P9Q8E2_BMF-01      -catgctgccct--------------------------------------
A0A3Q2PJX9_BMF-01      -catgctgccct--------------------------------------
A0A3Q2PJX9_BMF-03      -catgctgccct--------------------------------------
A0A3Q2PJX9_BMF-02      -catgctgccct--------------------------------------
A0A3Q2YCX7_BMF-01      -catgctgccct--------------------------------------
A0A3Q2YCX7_BMF-02      -catgctgccct--------------------------------------
A0A3B5KWG6_BMF-02      -catgcttccct--------------------------------------
A0A3B5KWG6_BMF-01      -catgcttccct--------------------------------------
A0A3B5KWG6_BMF-03      -catgcttccct--------------------------------------
A0A3B3CGR9_BMF-01      -catgcttctct--------------------------------------
A0A3P9K487_BMF-01      -catgcttctct--------------------------------------
A0A3P9K487_BMF-02      -catgcttctct--------------------------------------
A0A3B3HAU1_BMF-01      -catgcttctct--------------------------------------
A0A3B3HAU1_BMF-02      -catgcttctct--------------------------------------
A0A3B3HAU1_BMF-03      -catgcttctct--------------------------------------
A0A3B3HAU1_BMF-04      -catgcttctct--------------------------------------
A0A3P9ICE1_BMF-04      -catgcttctct--------------------------------------
A0A3P9ICE1_BMF-01      -catgcttctct--------------------------------------
A0A3P9ICE1_BMF-02      -catgcttctct--------------------------------------
A0A3P9ICE1_BMF-03      -catgcttctct--------------------------------------
A0A3P9ICE1_BMF-05      -catgcttctct--------------------------------------
A0A3P8NFE2_BMF-02      -catgctgccct--------------------------------------
A0A668TQU8_BMF-01      -catgctgccct--------------------------------------
I3K2D6_BMF-01          -catgctgccct--------------------------------------
A0A3Q4G1I4_BMF-01      -catgctgccct--------------------------------------
A0A3P8NFE2_BMF-01      -catgctgccct--------------------------------------
A0A3P9DPJ5_BMF-01      -catgctgccct--------------------------------------
A0A3P9DPJ5_BMF-02      -catgctgccct--------------------------------------
A0A3B4ETH0_BMF-01      -catgctgccct--------------------------------------
A0A3Q3C5V2_BMF-01      -catgctgccct--------------------------------------
A0A672HG10_BMF-01      -catgctgccct--------------------------------------
A0A3P8UA78_BMF-02      -catgctgccct--------------------------------------
A0A3P8UA78_BMF-01      -catgctgccct--------------------------------------
A0A3P8UA78_BMF-03      -catgctgccct--------------------------------------
A0A3Q3GUU5_BMF-01      -catgctgccct--------------------------------------
A0A3Q3VLX6_BMF-01      -catgcttcctt--------------------------------------
A0A3Q2ZA20_BMF-01      -catgctgccct--------------------------------------
A0A667YNR9_BMF-01      -catgctgccct--------------------------------------
A0A3Q3LME3_BMF-01      -catgctgccct--------------------------------------
A0A3Q3LME3_BMF-02      -catgctgccct--------------------------------------
A0A3Q3LME3_BMF-03      -catgctgccct--------------------------------------
A0A3Q1IPR4_BMF-01      -catgctgccct--------------------------------------
A0A3Q3QZ16_BMF-01      -tatgctgccct--------------------------------------
A0A3Q3QZ16_BMF-02      -tatgctgccct--------------------------------------
A0A665VG08_BMF-01      -catgctgccct--------------------------------------
A0A673C8N3_BMF-01      -catgcttccct--------------------------------------
A0A3Q1FVH7_BMF-01      -catgctgccct--------------------------------------
A0A3Q1FVH7_BMF-02      -catgctgccct--------------------------------------
A0A3B5B8F6_BMF-01      -catgctgccct--------------------------------------
A0A3Q1D1K3_BMF-01      -catgctgccct--------------------------------------
A0A3P8RKY9_BMF-01      -catgctgccct--------------------------------------
A0A671X848_BMF-01      -catgctgcctt--------------------------------------
A0A0F8AD62_BMF-01      -catgcttccct--------------------------------------
A0A4W6DUL1_BMF-01      -catgctgccct--------------------------------------
A0A2U9CJH3_BMF-01      -catgctgccct--------------------------------------
A0A3B4U5H8_BMF-01      -catgctgccct--------------------------------------
A0A3B4WM88_BMF-01      -catgctgccct--------------------------------------
A0A3P8ZIE7_BMF-01      -catgctaccct--------------------------------------
A0A4W5N3A7_BMF-01      -catgctgccct--------------------------------------
A0A6F9BGV6_BMF-01      -catgctgccct--------------------------------------
A0A1S3SNN2_BMF-01      -catgctgccct--------------------------------------
A0A674EF64_BMF-01      -catgctgccct--------------------------------------
A0A1S3P5K4_BMF-01      -tatgctgccct--------------------------------------
A0A6F9B4C5_BMF-01      -tatggtgccct--------------------------------------
A0A4W5N721_BMF-01      -tatgctgccct--------------------------------------
A0A1S3P5K4_BMF-02      -tatgctgccct--------------------------------------
A0A673YQV3_BMF-01      -tatgctgccct--------------------------------------
A0A4W4DZH9_BMF-01      -catgctgccgt--------------------------------------
A0A3B4CNJ8_BMF-01      -catgctgccct--------------------------------------
A0A3B1K1X5_BMF-01      -catgctgccct--------------------------------------
A0A3B4B6Y3_BMF-01      -catgcttccct--------------------------------------
A0A6I8NF73_BMF-01      -catgctgccct--------------------------------------
A0A5F8GKJ8_BMF-01      -catgctgcctt--------------------------------------
G3WDQ2_BMF-01          -catgctgcctt--------------------------------------
A0A4X2KLG2_BMF-01      -catgctgcctt--------------------------------------
Q8K589_BMF-01          -catgctgcctt--------------------------------------
Q91ZE9_BMF-02          -catgctgcctt--------------------------------------
Q91ZE9_BMF-01          -catgctgcctt--------------------------------------
Q91ZE9_BMF-06          -catgctgcctt--------------------------------------
A0A287CXH0_BMF-01      -catgctgcctt--------------------------------------
A0A287CXH0_BMF-02      -catgctgcctt--------------------------------------
A0A671DWL6_BMF-01      -catgctgcctt--------------------------------------
A0A671DWL6_BMF-02      -catgctgcctt--------------------------------------
A0A2K6FFN3_BMF-01      -catgctgcctt--------------------------------------
A0A2K6FFN3_BMF-02      -catgctgcctt--------------------------------------
A0A673TA87_BMF-01      -catgctgcctt--------------------------------------
L8IXF5_BMF-01          -catgctgcctt--------------------------------------
A0A4W2EII1_BMF-01      -catgctgcctt--------------------------------------
A0A4W2EII1_BMF-01      -catgctgcctt--------------------------------------
Q05KI3_BMF-01          -catgctgcctt--------------------------------------
Q05KI3_BMF-02          -catgctgcctt--------------------------------------
A0A4W2INA4_BMF-01      -catgctgcctt--------------------------------------
A0A4W2INA4_BMF-01      -catgctgcctt--------------------------------------
A0A452F2E0_BMF-01      -catgctgcctt--------------------------------------
A0A452F2E0_BMF-02      -catgctgcctt--------------------------------------
W5QFV1_BMF-01          -catgctgcctt--------------------------------------
H0WYH6_BMF-01          -catgctgcctt--------------------------------------
A0A337ST43_BMF-02      -catgctgcctt--------------------------------------
A0A337ST43_BMF-03      -catgctgcctt--------------------------------------
A0A337ST43_BMF-05      -catgctgcctt--------------------------------------
A0A337ST43_BMF-01      -catgctgcctt--------------------------------------
A0A337ST43_BMF-04      -catgctgcctt--------------------------------------
A0A667H967_BMF-01      -catgctgcctt--------------------------------------
M3YAD5_BMF-01          -catgctgcctt--------------------------------------
U6CSY8_BMF-01          -catgctgcctt--------------------------------------
A0A452SED0_BMF-01      -catgctgcctt--------------------------------------
A0A384D070_BMF-01      -catgctgcctt--------------------------------------
A0A5F4CJ04_BMF-04      -catgctgcctt--------------------------------------
A0A5F4CJ04_BMF-03      -catgctgcctt--------------------------------------
A0A5F4CJ04_BMF-01      -catgctgcctt--------------------------------------
A0A5F4CJ04_BMF-02      -catgctgcctt--------------------------------------
A0A4X1UQ42_BMF-01      -catgctgcctt--------------------------------------
A0A4X1UQ42_BMF-02      -catgctgcctt--------------------------------------
A0A287AIU8_BMF-01      -catgctgcctt--------------------------------------
A0A287AIU8_BMF-02      -catgctgcctt--------------------------------------
A0A3Q2HR24_BMF-01      -catgctgcctt--------------------------------------
A0A3Q2HR24_BMF-02      -catgctgcctt--------------------------------------
G1SR62_BMF-01          -catgctgcctt--------------------------------------
A0A286XXB0_BMF-03      -catgctgcctt--------------------------------------
A0A286XXB0_BMF-01      -catgctgcctt--------------------------------------
A0A286XXB0_BMF-02      -catgctgcctt--------------------------------------
A0A2K5KGP2_BMF-01      -catgctgcctt--------------------------------------
A0A0D9R4R5_BMF-01      -catgctgcctt--------------------------------------
A0A2K5VLE9_BMF-01      -catgctgccct--------------------------------------
A0A2K5VLE9_BMF-02      -catgctgccct--------------------------------------
A0A096NTE9_BMF-02      -catgctgcctt--------------------------------------
A0A096NTE9_BMF-01      -catgctgcctt--------------------------------------
A0A096NTE9_BMF-03      -catgctgcctt--------------------------------------
A0A5F7ZML1_BMF-01      -catgctgccct--------------------------------------
A0A5F7ZML1_BMF-02      -catgctgccct--------------------------------------
A0A5F7ZML1_BMF-03      -catgctgccct--------------------------------------
A0A2K5MJW4_BMF-01      -catgctgcctt--------------------------------------
A0A2K6B5F6_BMF-03      -catgctgcctt--------------------------------------
A0A2K5Z4A9_BMF-02      -catgctgcctt--------------------------------------
A0A2K5MJW4_BMF-02      -catgctgcctt--------------------------------------
A0A2K6B5F6_BMF-01      -catgctgcctt--------------------------------------
A0A2K6B5F6_BMF-02      -catgctgcctt--------------------------------------
A0A2K6B5F6_BMF-04      -catgctgcctt--------------------------------------
A0A2K5Z4A9_BMF-01      -catgctgcctt--------------------------------------
A0A2K5KGP2_BMF-02      -catgctgcctt--------------------------------------
A0A2K6RAW1_BMF-02      -tatgctgcctt--------------------------------------
A0A2K6RAW1_BMF-01      -tatgctgcctt--------------------------------------
A0A2K6L919_BMF-01      -tatgctgcctt--------------------------------------
A0A2K6L919_BMF-03      -tatgctgcctt--------------------------------------
A0A2K6L919_BMF-02      -tatgctgcctt--------------------------------------
A0A2U4BC98_BMF-01      -catgctgcctt--------------------------------------
G1PAU1_BMF-01          -catgctgcctt--------------------------------------
A0A2I3HD83_BMF-01      -catgctgcctt--------------------------------------
A0A2K6TW78_BMF-03      -catgctgcctt--------------------------------------
A0A2K6TW78_BMF-02      -catgctgcctt--------------------------------------
A0A2K6TW78_BMF-01      -catgctgcctt--------------------------------------
A0A2J8T301_BMF-01      -catgctgcctt--------------------------------------
G3T7Z4_BMF-01          -catgctgcctt--------------------------------------
A0A2K5RN49_BMF-02      -catgctgcctt--------------------------------------
A0A2K5RN49_BMF-01      -catgctgcctt--------------------------------------
F7HZL0_BMF-01          -catgctgcctt--------------------------------------
A0A2K5E1Q4_BMF-02      -catgctgcctt--------------------------------------
A0A2K5E1Q4_BMF-01      -catgctgcctt--------------------------------------
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          -catgctgcctt--------------------------------------
Q96LC9_BMF-07          -catgctgcctt--------------------------------------
Q96LC9_BMF-01          -catgctgcctt--------------------------------------
Q96LC9_BMF-02          -catgctgcctt--------------------------------------
Q96LC9_BMF-03          -catgctgcctt--------------------------------------
Q96LC9_BMF-04          -catgctgcctt--------------------------------------
A0A2J8QDD5_BMF-01      -catgctgcctt--------------------------------------
A0A2R9BS98_BMF-02      -catgctgcctt--------------------------------------
Q96LC9_BMF-06          -catgctgcctt--------------------------------------
A0A2I2Z168_BMF-02      -catgctgcctt--------------------------------------
A0A2I2Z168_BMF-01      -catgctgcctt--------------------------------------
Q96LC9_BMF-08          --------------------------------------------------
A0A2R9BS98_BMF-01      -catgctgcctt--------------------------------------
A0A2J8QDD5_BMF-02      -catgctgcctt--------------------------------------
                                                                         

A0A672RK14_BMF-01      gctgtggatgccaggactgcatttggggttaactgtggaaccgggggcct
A0A673JJ10_BMF-01      --------------------------------------------------
A0A3B4UNJ0_BMF-01      --------------------------------------------------
W5N4P7_BMF-01          --------------------------------------------------
A3KND0_BMF-01          --------------------------------------------------
Q0GKC7_BMF-01          --------------------------------------------------
A0A671M0H4_BMF-01      --------------------------------------------------
A0A671M0H4_BMF-02      --------------------------------------------------
A0A671MNR9_BMF-01      --------------------------------------------------
A0A672JWL9_BMF-01      --------------------------------------------------
A0A672JWL9_BMF-02      --------------------------------------------------
A0A673HDR4_BMF-01      --------------------------------------------------
A0A3B3RH63_BMF-01      --------------------------------------------------
K7FRX2_BMF-01          --------------------------------------------------
A0A452H3N6_BMF-01      --------------------------------------------------
A0A674IPL3_BMF-01      --------------------------------------------------
A0A493T7X1_BMF-01      --------------------------------------------------
A0A3Q2UCA0_BMF-01      --------------------------------------------------
A0A3Q2UCA0_BMF-02      --------------------------------------------------
A0A669PL85_BMF-02      --------------------------------------------------
A0A493T7X1_BMF-02      --------------------------------------------------
A0A3Q2UCA0_BMF-03      --------------------------------------------------
A0A3Q2UCA0_BMF-04      --------------------------------------------------
A9XRH0_BMF-01          --------------------------------------------------
G1NHG8_BMF-01          --------------------------------------------------
A0A669PL85_BMF-01      --------------------------------------------------
U3JS06_BMF-01          --------------------------------------------------
A0A674GIP8_BMF-03      --------------------------------------------------
A0A674GIP8_BMF-01      --------------------------------------------------
A0A674GIP8_BMF-02      --------------------------------------------------
A0A672V891_BMF-01      --------------------------------------------------
A0A663DZQ4_BMF-01      --------------------------------------------------
A0A663MPI8_BMF-01      --------------------------------------------------
A0A670XMZ5_BMF-01      --------------------------------------------------
H9GL49_BMF-01          --------------------------------------------------
A0A670JUU6_BMF-01      --------------------------------------------------
A0A670JUU6_BMF-05      --------------------------------------------------
A0A670JUU6_BMF-04      --------------------------------------------------
A0A670JUU6_BMF-02      --------------------------------------------------
A0A670JUU6_BMF-03      --------------------------------------------------
A0A4W3JXA1_BMF-01      --------------------------------------------------
A0A3Q2CXC4_BMF-01      --------------------------------------------------
A0A3Q2CXC4_BMF-02      --------------------------------------------------
A0A3B5QK08_BMF-01      --------------------------------------------------
A0A3B5QK08_BMF-02      --------------------------------------------------
A0A096LRV0_BMF-01      --------------------------------------------------
A0A3B3WU80_BMF-01      --------------------------------------------------
A0A3P9Q8E2_BMF-01      --------------------------------------------------
A0A3Q2PJX9_BMF-01      --------------------------------------------------
A0A3Q2PJX9_BMF-03      --------------------------------------------------
A0A3Q2PJX9_BMF-02      --------------------------------------------------
A0A3Q2YCX7_BMF-01      --------------------------------------------------
A0A3Q2YCX7_BMF-02      --------------------------------------------------
A0A3B5KWG6_BMF-02      --------------------------------------------------
A0A3B5KWG6_BMF-01      --------------------------------------------------
A0A3B5KWG6_BMF-03      --------------------------------------------------
A0A3B3CGR9_BMF-01      --------------------------------------------------
A0A3P9K487_BMF-01      --------------------------------------------------
A0A3P9K487_BMF-02      --------------------------------------------------
A0A3B3HAU1_BMF-01      --------------------------------------------------
A0A3B3HAU1_BMF-02      --------------------------------------------------
A0A3B3HAU1_BMF-03      --------------------------------------------------
A0A3B3HAU1_BMF-04      --------------------------------------------------
A0A3P9ICE1_BMF-04      --------------------------------------------------
A0A3P9ICE1_BMF-01      --------------------------------------------------
A0A3P9ICE1_BMF-02      --------------------------------------------------
A0A3P9ICE1_BMF-03      --------------------------------------------------
A0A3P9ICE1_BMF-05      --------------------------------------------------
A0A3P8NFE2_BMF-02      --------------------------------------------------
A0A668TQU8_BMF-01      --------------------------------------------------
I3K2D6_BMF-01          --------------------------------------------------
A0A3Q4G1I4_BMF-01      --------------------------------------------------
A0A3P8NFE2_BMF-01      --------------------------------------------------
A0A3P9DPJ5_BMF-01      --------------------------------------------------
A0A3P9DPJ5_BMF-02      --------------------------------------------------
A0A3B4ETH0_BMF-01      --------------------------------------------------
A0A3Q3C5V2_BMF-01      --------------------------------------------------
A0A672HG10_BMF-01      --------------------------------------------------
A0A3P8UA78_BMF-02      --------------------------------------------------
A0A3P8UA78_BMF-01      --------------------------------------------------
A0A3P8UA78_BMF-03      --------------------------------------------------
A0A3Q3GUU5_BMF-01      --------------------------------------------------
A0A3Q3VLX6_BMF-01      --------------------------------------------------
A0A3Q2ZA20_BMF-01      --------------------------------------------------
A0A667YNR9_BMF-01      --------------------------------------------------
A0A3Q3LME3_BMF-01      --------------------------------------------------
A0A3Q3LME3_BMF-02      --------------------------------------------------
A0A3Q3LME3_BMF-03      --------------------------------------------------
A0A3Q1IPR4_BMF-01      --------------------------------------------------
A0A3Q3QZ16_BMF-01      --------------------------------------------------
A0A3Q3QZ16_BMF-02      --------------------------------------------------
A0A665VG08_BMF-01      --------------------------------------------------
A0A673C8N3_BMF-01      --------------------------------------------------
A0A3Q1FVH7_BMF-01      --------------------------------------------------
A0A3Q1FVH7_BMF-02      --------------------------------------------------
A0A3B5B8F6_BMF-01      --------------------------------------------------
A0A3Q1D1K3_BMF-01      --------------------------------------------------
A0A3P8RKY9_BMF-01      --------------------------------------------------
A0A671X848_BMF-01      --------------------------------------------------
A0A0F8AD62_BMF-01      --------------------------------------------------
A0A4W6DUL1_BMF-01      --------------------------------------------------
A0A2U9CJH3_BMF-01      --------------------------------------------------
A0A3B4U5H8_BMF-01      --------------------------------------------------
A0A3B4WM88_BMF-01      --------------------------------------------------
A0A3P8ZIE7_BMF-01      --------------------------------------------------
A0A4W5N3A7_BMF-01      --------------------------------------------------
A0A6F9BGV6_BMF-01      --------------------------------------------------
A0A1S3SNN2_BMF-01      --------------------------------------------------
A0A674EF64_BMF-01      --------------------------------------------------
A0A1S3P5K4_BMF-01      --------------------------------------------------
A0A6F9B4C5_BMF-01      --------------------------------------------------
A0A4W5N721_BMF-01      --------------------------------------------------
A0A1S3P5K4_BMF-02      --------------------------------------------------
A0A673YQV3_BMF-01      --------------------------------------------------
A0A4W4DZH9_BMF-01      --------------------------------------------------
A0A3B4CNJ8_BMF-01      --------------------------------------------------
A0A3B1K1X5_BMF-01      --------------------------------------------------
A0A3B4B6Y3_BMF-01      --------------------------------------------------
A0A6I8NF73_BMF-01      --------------------------------------------------
A0A5F8GKJ8_BMF-01      --------------------------------------------------
G3WDQ2_BMF-01          --------------------------------------------------
A0A4X2KLG2_BMF-01      --------------------------------------------------
Q8K589_BMF-01          --------------------------------------------------
Q91ZE9_BMF-02          --------------------------------------------------
Q91ZE9_BMF-01          --------------------------------------------------
Q91ZE9_BMF-06          --------------------------------------------------
A0A287CXH0_BMF-01      --------------------------------------------------
A0A287CXH0_BMF-02      --------------------------------------------------
A0A671DWL6_BMF-01      --------------------------------------------------
A0A671DWL6_BMF-02      --------------------------------------------------
A0A2K6FFN3_BMF-01      --------------------------------------------------
A0A2K6FFN3_BMF-02      --------------------------------------------------
A0A673TA87_BMF-01      --------------------------------------------------
L8IXF5_BMF-01          --------------------------------------------------
A0A4W2EII1_BMF-01      --------------------------------------------------
A0A4W2EII1_BMF-01      --------------------------------------------------
Q05KI3_BMF-01          --------------------------------------------------
Q05KI3_BMF-02          --------------------------------------------------
A0A4W2INA4_BMF-01      --------------------------------------------------
A0A4W2INA4_BMF-01      --------------------------------------------------
A0A452F2E0_BMF-01      --------------------------------------------------
A0A452F2E0_BMF-02      --------------------------------------------------
W5QFV1_BMF-01          --------------------------------------------------
H0WYH6_BMF-01          --------------------------------------------------
A0A337ST43_BMF-02      --------------------------------------------------
A0A337ST43_BMF-03      --------------------------------------------------
A0A337ST43_BMF-05      --------------------------------------------------
A0A337ST43_BMF-01      --------------------------------------------------
A0A337ST43_BMF-04      --------------------------------------------------
A0A667H967_BMF-01      --------------------------------------------------
M3YAD5_BMF-01          --------------------------------------------------
U6CSY8_BMF-01          --------------------------------------------------
A0A452SED0_BMF-01      --------------------------------------------------
A0A384D070_BMF-01      --------------------------------------------------
A0A5F4CJ04_BMF-04      --------------------------------------------------
A0A5F4CJ04_BMF-03      --------------------------------------------------
A0A5F4CJ04_BMF-01      --------------------------------------------------
A0A5F4CJ04_BMF-02      --------------------------------------------------
A0A4X1UQ42_BMF-01      --------------------------------------------------
A0A4X1UQ42_BMF-02      --------------------------------------------------
A0A287AIU8_BMF-01      --------------------------------------------------
A0A287AIU8_BMF-02      --------------------------------------------------
A0A3Q2HR24_BMF-01      --------------------------------------------------
A0A3Q2HR24_BMF-02      --------------------------------------------------
G1SR62_BMF-01          --------------------------------------------------
A0A286XXB0_BMF-03      --------------------------------------------------
A0A286XXB0_BMF-01      --------------------------------------------------
A0A286XXB0_BMF-02      --------------------------------------------------
A0A2K5KGP2_BMF-01      --------------------------------------------------
A0A0D9R4R5_BMF-01      --------------------------------------------------
A0A2K5VLE9_BMF-01      --------------------------------------------------
A0A2K5VLE9_BMF-02      --------------------------------------------------
A0A096NTE9_BMF-02      --------------------------------------------------
A0A096NTE9_BMF-01      --------------------------------------------------
A0A096NTE9_BMF-03      --------------------------------------------------
A0A5F7ZML1_BMF-01      --------------------------------------------------
A0A5F7ZML1_BMF-02      --------------------------------------------------
A0A5F7ZML1_BMF-03      --------------------------------------------------
A0A2K5MJW4_BMF-01      --------------------------------------------------
A0A2K6B5F6_BMF-03      --------------------------------------------------
A0A2K5Z4A9_BMF-02      --------------------------------------------------
A0A2K5MJW4_BMF-02      --------------------------------------------------
A0A2K6B5F6_BMF-01      --------------------------------------------------
A0A2K6B5F6_BMF-02      --------------------------------------------------
A0A2K6B5F6_BMF-04      --------------------------------------------------
A0A2K5Z4A9_BMF-01      --------------------------------------------------
A0A2K5KGP2_BMF-02      --------------------------------------------------
A0A2K6RAW1_BMF-02      --------------------------------------------------
A0A2K6RAW1_BMF-01      --------------------------------------------------
A0A2K6L919_BMF-01      --------------------------------------------------
A0A2K6L919_BMF-03      --------------------------------------------------
A0A2K6L919_BMF-02      --------------------------------------------------
A0A2U4BC98_BMF-01      --------------------------------------------------
G1PAU1_BMF-01          --------------------------------------------------
A0A2I3HD83_BMF-01      --------------------------------------------------
A0A2K6TW78_BMF-03      --------------------------------------------------
A0A2K6TW78_BMF-02      --------------------------------------------------
A0A2K6TW78_BMF-01      --------------------------------------------------
A0A2J8T301_BMF-01      --------------------------------------------------
G3T7Z4_BMF-01          --------------------------------------------------
A0A2K5RN49_BMF-02      --------------------------------------------------
A0A2K5RN49_BMF-01      --------------------------------------------------
F7HZL0_BMF-01          --------------------------------------------------
A0A2K5E1Q4_BMF-02      --------------------------------------------------
A0A2K5E1Q4_BMF-01      --------------------------------------------------
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          --------------------------------------------------
Q96LC9_BMF-02          --------------------------------------------------
Q96LC9_BMF-03          --------------------------------------------------
Q96LC9_BMF-04          --------------------------------------------------
A0A2J8QDD5_BMF-01      --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
Q96LC9_BMF-06          --------------------------------------------------
A0A2I2Z168_BMF-02      --------------------------------------------------
A0A2I2Z168_BMF-01      --------------------------------------------------
Q96LC9_BMF-08          --------------------------------------------------
A0A2R9BS98_BMF-01      --------------------------------------------------
A0A2J8QDD5_BMF-02      --------------------------------------------------
                                                                         

A0A672RK14_BMF-01      tgcgtcacttactatggcccctggggcctcaga---agggccaagagcac
A0A673JJ10_BMF-01      -------------------------------ga---agggccaagagcac
A0A3B4UNJ0_BMF-01      -------------------------gtcaccgc-----tgctcctctcat
W5N4P7_BMF-01          --------------------gtggtgtcggagc---agagcctcgccgac
A3KND0_BMF-01          --------------------gtggggtgtctga---aactcctcaaagac
Q0GKC7_BMF-01          --------------------gccg---gcatctccagcagcacggacact
A0A671M0H4_BMF-01      --------------------gccgagtgcatgt---cgagcccacacgct
A0A671M0H4_BMF-02      --------------------gccgagtgcatgt---cgagcccacacgct
A0A671MNR9_BMF-01      --------------------gccgagtgaatgt---ggagcccagacgct
A0A672JWL9_BMF-01      --------------------gtcgagtgcatgt---ggagcccagacgct
A0A672JWL9_BMF-02      --------------------gtcgagtgcatgt---ggagcccagacgct
A0A673HDR4_BMF-01      --------------------gccgagtgcatgt---ggagcccagacgct
A0A3B3RH63_BMF-01      --------------------gtggcgtgggcca---agagccacgcagac
K7FRX2_BMF-01          --------------------gtggagtcactga---agagccccagagac
A0A452H3N6_BMF-01      --------------------gtggagtcactga---agagccccagagac
A0A674IPL3_BMF-01      --------------------gtggagtcactga---agagccccagagac
A0A493T7X1_BMF-01      --------------------gtggagtcactga---agagccccggagac
A0A3Q2UCA0_BMF-01      --------------------gtggagtcactga---agagccccggagac
A0A3Q2UCA0_BMF-02      --------------------gtggagtcactga---agagccccggagac
A0A669PL85_BMF-02      --------------------gtggagtcactga---agagccccggagac
A0A493T7X1_BMF-02      --------------------gtggagtcactga---agagccccggagac
A0A3Q2UCA0_BMF-03      --------------------gtggagtcactga---agagccccggagac
A0A3Q2UCA0_BMF-04      --------------------gtggagtcactga---agagccccggagac
A9XRH0_BMF-01          --------------------------------------------------
G1NHG8_BMF-01          --------------------gtggagtcactga---agagccccggagac
A0A669PL85_BMF-01      --------------------gtggagtcactga---agagccccggagac
U3JS06_BMF-01          --------------------gtggagtcactga---agagccacggagac
A0A674GIP8_BMF-03      --------------------gtggagtcactga---agagccaaggagac
A0A674GIP8_BMF-01      --------------------gtggagtcactga---agagccaaggagac
A0A674GIP8_BMF-02      --------------------gtggagtcactga---agagccaaggagac
A0A672V891_BMF-01      --------------------gtggagtcactga---agagccccggagac
A0A663DZQ4_BMF-01      --------------------gtggagtcactga---agagccccggagac
A0A663MPI8_BMF-01      --------------------gtggagtcactga---agagccccggagac
A0A670XMZ5_BMF-01      --------------------gtggagtcactga---agagcctcagagac
H9GL49_BMF-01          --------------------gtggagtcacaga---agaaccccagagac
A0A670JUU6_BMF-01      --------------------gtggagtcactga---agagccccagagac
A0A670JUU6_BMF-05      --------------------gtggagtcactga---agagccccagagac
A0A670JUU6_BMF-04      --------------------gtggagtcactga---agagccccagagac
A0A670JUU6_BMF-02      --------------------gtggagtcactga---agagccccagagac
A0A670JUU6_BMF-03      --------------------gtggagtcactga---agagccccagagac
A0A4W3JXA1_BMF-01      --------------------gcggagttggagc---acaccctcgaagac
A0A3Q2CXC4_BMF-01      --------------------gtggagttgtgga---ggagcccagaccac
A0A3Q2CXC4_BMF-02      --------------------gtggagttgtgga---ggagcccagaccac
A0A3B5QK08_BMF-01      --------------------gtggtgttgtgga---ggagcccagacgac
A0A3B5QK08_BMF-02      --------------------gtggtgttgtgga---ggagcccagacgac
A0A096LRV0_BMF-01      --------------------gtggtgttgcgga---ggagcccagacgac
A0A3B3WU80_BMF-01      --------------------gtggtgttgcgga---ggagcccagacgac
A0A3P9Q8E2_BMF-01      --------------------gtggtgttgcgga---ggagcccagacgat
A0A3Q2PJX9_BMF-01      --------------------gcggcgttgcgga---ggagcccagacaac
A0A3Q2PJX9_BMF-03      --------------------gcggcgttgcgga---ggagcccagacaac
A0A3Q2PJX9_BMF-02      --------------------gcggcgttgcgga---ggagcccagacaac
A0A3Q2YCX7_BMF-01      --------------------gtggagtcgcaga---ggagccaagaccac
A0A3Q2YCX7_BMF-02      --------------------gtggagtcgcaga---ggagccaagaccac
A0A3B5KWG6_BMF-02      --------------------gtggagtcgcaga---agagcccagactac
A0A3B5KWG6_BMF-01      --------------------gtggagtcgcaga---agagcccagactac
A0A3B5KWG6_BMF-03      --------------------gtggagtcgcaga---agagcccagactac
A0A3B3CGR9_BMF-01      --------------------gtggacttgcaga---ggagcccagaccac
A0A3P9K487_BMF-01      --------------------gtggactttcaga---ggagcccagaccac
A0A3P9K487_BMF-02      --------------------gtggactttcaga---ggagcccagaccac
A0A3B3HAU1_BMF-01      --------------------gtggacttgcaga---ggagcccagaccac
A0A3B3HAU1_BMF-02      --------------------gtggacttgcaga---ggagcccagaccac
A0A3B3HAU1_BMF-03      --------------------gtggacttgcaga---ggagcccagaccac
A0A3B3HAU1_BMF-04      --------------------gtggacttgcaga---ggagcccagaccac
A0A3P9ICE1_BMF-04      --------------------gtggacttgcaga---ggagcccagaccac
A0A3P9ICE1_BMF-01      --------------------gtggacttgcaga---ggagcccagaccac
A0A3P9ICE1_BMF-02      --------------------gtggacttgcaga---ggagcccagaccac
A0A3P9ICE1_BMF-03      --------------------gtggacttgcaga---ggagcccagaccac
A0A3P9ICE1_BMF-05      --------------------gtggacttgcaga---ggagcccagaccac
A0A3P8NFE2_BMF-02      --------------------gtggagtcgcaga---ggagcccagaccac
A0A668TQU8_BMF-01      --------------------gtggagtcgcaga---ggagcccagaccac
I3K2D6_BMF-01          --------------------gtggagtcgcaga---ggagcccagaccac
A0A3Q4G1I4_BMF-01      --------------------gtggagtcgcaga---ggagcccagaccac
A0A3P8NFE2_BMF-01      --------------------gtggagtcgcaga---ggagcccagaccac
A0A3P9DPJ5_BMF-01      --------------------gtggagtcgcaga---ggagcccagaccac
A0A3P9DPJ5_BMF-02      --------------------gtggagtcgcaga---ggagcccagaccac
A0A3B4ETH0_BMF-01      --------------------gtggagtcgcaga---ggagcccagaccac
A0A3Q3C5V2_BMF-01      --------------------gtggagtcgcaga---ggagcccagaccac
A0A672HG10_BMF-01      --------------------gtggagtcgcaga---ggaacccagaccac
A0A3P8UA78_BMF-02      --------------------gtggggtgggaga---ggagcccagaccac
A0A3P8UA78_BMF-01      --------------------gtggggtgggaga---ggagcccagaccac
A0A3P8UA78_BMF-03      --------------------gtggggtgggaga---ggagcccagaccac
A0A3Q3GUU5_BMF-01      --------------------gtggagtcgcaga---ggagcccagaccac
A0A3Q3VLX6_BMF-01      --------------------gtggagtcgcaga---ggaacccagacacc
A0A3Q2ZA20_BMF-01      --------------------gtggagtcgcaga---ggagcccagaccac
A0A667YNR9_BMF-01      --------------------gtggagtcgcaga---ggagcccagaccac
A0A3Q3LME3_BMF-01      --------------------gtggagtcgcaga---ggagccaagaccac
A0A3Q3LME3_BMF-02      --------------------gtggagtcgcaga---ggagccaagaccac
A0A3Q3LME3_BMF-03      --------------------gtggagtcgcaga---ggagccaagaccac
A0A3Q1IPR4_BMF-01      --------------------gtggagtcgcaga---ggagcccagaccac
A0A3Q3QZ16_BMF-01      --------------------gtggagttgcaga---ggatcccagaccac
A0A3Q3QZ16_BMF-02      --------------------gtggagttgcaga---ggatcccagaccac
A0A665VG08_BMF-01      --------------------gtggcatcgcaaa---agagccaagaccac
A0A673C8N3_BMF-01      --------------------gtggagtcgcaga---agagcccagaccac
A0A3Q1FVH7_BMF-01      --------------------gtggagtcgcaga---ggagcccagaccac
A0A3Q1FVH7_BMF-02      --------------------gtggagtcgcaga---ggagcccagaccac
A0A3B5B8F6_BMF-01      --------------------gtggagtcgcaga---ggagcccagaccac
A0A3Q1D1K3_BMF-01      --------------------gtggagtcgcaga---ggagcccagaccac
A0A3P8RKY9_BMF-01      --------------------gtggagtcgcaga---ggagcccagaccac
A0A671X848_BMF-01      --------------------gtggagtcgcaga---ggagcccagaccac
A0A0F8AD62_BMF-01      --------------------gtggagtcgcgga---ggagcccagaccac
A0A4W6DUL1_BMF-01      --------------------gtggagtcgagga---ggagcccagaccac
A0A2U9CJH3_BMF-01      --------------------gtggagttgcaga---ggagcccagaccac
A0A3B4U5H8_BMF-01      --------------------gtggagtcgcaaa---ggagcccagaccac
A0A3B4WM88_BMF-01      --------------------gtggagtcgcaaa---ggagcccagaccac
A0A3P8ZIE7_BMF-01      --------------------gcagattggacca---ggatcccagaccac
A0A4W5N3A7_BMF-01      --------------------gtgg------------ggagcccagaccac
A0A6F9BGV6_BMF-01      --------------------gtggggtggccca---ggagcccagaccac
A0A1S3SNN2_BMF-01      --------------------gtggggtggccca---ggagcccagaccac
A0A674EF64_BMF-01      --------------------gtggggtggccca---ggagcccagaccac
A0A1S3P5K4_BMF-01      --------------------gcggggtggccca---ggagcccagaccac
A0A6F9B4C5_BMF-01      --------------------gcggggtggccca---ggagcccagaccac
A0A4W5N721_BMF-01      --------------------gcggggtggccca---ggagcccagaccac
A0A1S3P5K4_BMF-02      --------------------gcggggtggccca---ggagcccagaccac
A0A673YQV3_BMF-01      --------------------gcggggtggccca---ggagcccagaccac
A0A4W4DZH9_BMF-01      --------------------gcggcgtgtccga---agagccccgacgcc
A0A3B4CNJ8_BMF-01      --------------------gtggagtgtctga---ggagccaagacgcc
A0A3B1K1X5_BMF-01      --------------------gcggaatatccga---ggagccaagacgcc
A0A3B4B6Y3_BMF-01      --------------------gtggagtggcaga---ggagcctagaccac
A0A6I8NF73_BMF-01      --------------------gcggagtgaccga---agagccccggcgcc
A0A5F8GKJ8_BMF-01      --------------------gtggagtgactga---agagccccaccgac
G3WDQ2_BMF-01          --------------------gtggagttaccga---agaaccccaccgac
A0A4X2KLG2_BMF-01      --------------------gtggagtgactga---agaaccccaccgac
Q8K589_BMF-01          --------------------gtggggtgacaga---ggaaccccagagac
Q91ZE9_BMF-02          --------------------gtggggtgacaga---ggaaccccagagac
Q91ZE9_BMF-01          --------------------gtggggtgacaga---ggaaccccagagac
Q91ZE9_BMF-06          --------------------gtggggtgacaga---ggaaccccagagac
A0A287CXH0_BMF-01      --------------------gtggagtgactga---agaaccccagcgac
A0A287CXH0_BMF-02      --------------------gtggagtgactga---agaaccccagcgac
A0A671DWL6_BMF-01      --------------------gtggggtgactga---ggaaccccagcgac
A0A671DWL6_BMF-02      --------------------gtggggtgactga---ggaaccccagcgac
A0A2K6FFN3_BMF-01      --------------------gtggggtgaccga---ggaaccccagagac
A0A2K6FFN3_BMF-02      --------------------gtggggtgaccga---ggaaccccagagac
A0A673TA87_BMF-01      --------------------gtggggtgaccga---agaaccccagcgac
L8IXF5_BMF-01          --------------------gtggggtgactga---ggagccccagcgac
A0A4W2EII1_BMF-01      --------------------gtggggtgactga---ggagccccagcgac
A0A4W2EII1_BMF-01      --------------------gtggggtgactga---ggagccccagcgac
Q05KI3_BMF-01          --------------------gtggggtgactga---ggagccccagcgac
Q05KI3_BMF-02          --------------------gtggggtgactga---ggagccccagcgac
A0A4W2INA4_BMF-01      --------------------gtggggtgactga---ggagccccagcgac
A0A4W2INA4_BMF-01      --------------------gtggggtgactga---ggagccccagcgac
A0A452F2E0_BMF-01      --------------------gtggggtgactga---ggagccccagcgac
A0A452F2E0_BMF-02      --------------------gtggggtgactga---ggagccccagcgac
W5QFV1_BMF-01          --------------------gtggggtgactga---ggagccccagcgac
H0WYH6_BMF-01          --------------------gtggggtgactga---agaaccccagagac
A0A337ST43_BMF-02      --------------------gtggggtgaccga---agaaccccagcgac
A0A337ST43_BMF-03      --------------------gtggggtgaccga---agaaccccagcgac
A0A337ST43_BMF-05      --------------------gtggggtgaccga---agaaccccagcgac
A0A337ST43_BMF-01      --------------------gtggggtgaccga---agaaccccagcgac
A0A337ST43_BMF-04      --------------------gtggggtgaccga---agaaccccagcgac
A0A667H967_BMF-01      --------------------gtggggtgaccga---agaaccccagcgac
M3YAD5_BMF-01          --------------------gtggggtgaccga---agaaccccagcgac
U6CSY8_BMF-01          --------------------gtggggtgaccga---agaaccccagcgac
A0A452SED0_BMF-01      --------------------gtggggtgaccga---agaaccccagcgac
A0A384D070_BMF-01      --------------------gtggggtgaccga---agaaccccagcgac
A0A5F4CJ04_BMF-04      --------------------gtggggtgaccga---agagccccagcgac
A0A5F4CJ04_BMF-03      --------------------gtggggtgaccga---agagccccagcgac
A0A5F4CJ04_BMF-01      --------------------gtggggtgaccga---agagccccagcgac
A0A5F4CJ04_BMF-02      --------------------gtggggtgaccga---agagccccagcgac
A0A4X1UQ42_BMF-01      --------------------gtggggtgactga---ggaaccccagcgac
A0A4X1UQ42_BMF-02      --------------------gtggggtgactga---ggaaccccagcgac
A0A287AIU8_BMF-01      --------------------gtggggtgactga---ggaaccccagcgac
A0A287AIU8_BMF-02      --------------------gtggggtgactga---ggaaccccagcgac
A0A3Q2HR24_BMF-01      --------------------gtggggtgaccga---ggaaccccagcgac
A0A3Q2HR24_BMF-02      --------------------gtggggtgaccga---ggaaccccagcgac
G1SR62_BMF-01          --------------------gtggggtgaccga---ggaaccccagcgac
A0A286XXB0_BMF-03      --------------------gtggggtgactga---ggaaccccagcgac
A0A286XXB0_BMF-01      --------------------gtggggtgactga---ggaaccccagcgac
A0A286XXB0_BMF-02      --------------------gtggggtgactga---ggaaccccagcgac
A0A2K5KGP2_BMF-01      --------------------gtggggtaactga---ggaaccccagcgac
A0A0D9R4R5_BMF-01      --------------------gtggggtaactga---ggaaccccagcgac
A0A2K5VLE9_BMF-01      --------------------gtggggtaactga---ggaaccccagcgac
A0A2K5VLE9_BMF-02      --------------------gtggggtaactga---ggaaccccagcgac
A0A096NTE9_BMF-02      --------------------gtggggtaactga---ggaaccccagcgac
A0A096NTE9_BMF-01      --------------------gtggggtaactga---ggaaccccagcgac
A0A096NTE9_BMF-03      --------------------gtggggtaactga---ggaaccccagcgac
A0A5F7ZML1_BMF-01      --------------------gtggggtaactga---ggaaccccagcgac
A0A5F7ZML1_BMF-02      --------------------gtggggtaactga---ggaaccccagcgac
A0A5F7ZML1_BMF-03      --------------------gtggggtaactga---ggaaccccagcgac
A0A2K5MJW4_BMF-01      --------------------gtggggtaactga---ggaaccccagcgac
A0A2K6B5F6_BMF-03      --------------------gtggggtaactga---ggaaccccagcgac
A0A2K5Z4A9_BMF-02      --------------------gtggggtaactga---ggaaccccagcgac
A0A2K5MJW4_BMF-02      --------------------gtggggtaactga---ggaaccccagcgac
A0A2K6B5F6_BMF-01      --------------------gtggggtaactga---ggaaccccagcgac
A0A2K6B5F6_BMF-02      --------------------gtggggtaactga---ggaaccccagcgac
A0A2K6B5F6_BMF-04      --------------------gtggggtaactga---ggaaccccagcgac
A0A2K5Z4A9_BMF-01      --------------------gtggggtaactga---ggaaccccagcgac
A0A2K5KGP2_BMF-02      --------------------gtggggtaactga---ggaaccccagcgac
A0A2K6RAW1_BMF-02      --------------------gtggggtaactga---ggaaccccagcgac
A0A2K6RAW1_BMF-01      --------------------gtggggtaactga---ggaaccccagcgac
A0A2K6L919_BMF-01      --------------------gtggggtaactga---ggaaccccagcgac
A0A2K6L919_BMF-03      --------------------gtggggtaactga---ggaaccccagcgac
A0A2K6L919_BMF-02      --------------------gtggggtaactga---ggaaccccagcgac
A0A2U4BC98_BMF-01      --------------------gtggggtgactga---ggaaccccagcgac
G1PAU1_BMF-01          --------------------gtggggtgaccga---ggaaccccagcgac
A0A2I3HD83_BMF-01      --------------------gtggggtgactga---ggaaccccagcgac
A0A2K6TW78_BMF-03      --------------------gtggggtgactga---ggaaccccagcgac
A0A2K6TW78_BMF-02      --------------------gtggggtgactga---ggaaccccagcgac
A0A2K6TW78_BMF-01      --------------------gtggggtgactga---ggaaccccagcgac
A0A2J8T301_BMF-01      --------------------gtggggtgactga---ggaaccccagcgac
G3T7Z4_BMF-01          --------------------gtggggtgaccga---ggaaccccagcgac
A0A2K5RN49_BMF-02      --------------------gtggggtgactga---ggaaccccagcgac
A0A2K5RN49_BMF-01      --------------------gtggggtgactga---ggaaccccagcgac
F7HZL0_BMF-01          --------------------gtggggtgactga---ggaaccccagcgac
A0A2K5E1Q4_BMF-02      --------------------gtggggtgactga---ggaaccccagcgac
A0A2K5E1Q4_BMF-01      --------------------gtggggtgactga---ggaaccccagcgac
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          --------------------gtggggtgactga---ggaaccccagcgac
Q96LC9_BMF-07          --------------------gtggggtgactga---ggaaccccagcgac
Q96LC9_BMF-01          --------------------gtggggtgactga---ggaaccccagcgac
Q96LC9_BMF-02          --------------------gtggggtgactga---ggaaccccagcgac
Q96LC9_BMF-03          --------------------gtggggtgactga---ggaaccccagcgac
Q96LC9_BMF-04          --------------------gtggggtgactga---ggaaccccagcgac
A0A2J8QDD5_BMF-01      --------------------gtggggtgactga---ggaaccccagcgac
A0A2R9BS98_BMF-02      --------------------gtggggtgactga---ggaaccccagcgac
Q96LC9_BMF-06          --------------------gtggggtgactga---ggaaccccagcgac
A0A2I2Z168_BMF-02      --------------------gtggggtgactga---ggaaccccagcgac
A0A2I2Z168_BMF-01      --------------------gtggggtgactga---ggaaccccagcgac
Q96LC9_BMF-08          --------------------------------------------------
A0A2R9BS98_BMF-01      --------------------gtggggtgactga---ggaaccccagcgac
A0A2J8QDD5_BMF-02      --------------------gtggggtgactga---ggaaccccagcgac
                                                                         

A0A672RK14_BMF-01      tttttcatg--------------------gaaatgctgg-------attt
A0A673JJ10_BMF-01      tttttcatg--------------------gaaatgctgg-------attt
A0A3B4UNJ0_BMF-01      tcttttt----------------------gtttggtgggttcctcattgg
W5N4P7_BMF-01          tcttctatg--------------------gtaatgctgc-------cttt
A3KND0_BMF-01          ttttttatg--------------------gtaaggaggc-----------
Q0GKC7_BMF-01          ttctctacg--------------------gtaacgcagaattgctggttc
A0A671M0H4_BMF-01      ttctctacg--------------------ggaacgcaggattgttacttc
A0A671M0H4_BMF-02      ttctctacg--------------------ggaacgcaggattgttacttc
A0A671MNR9_BMF-01      ttctctacg--------------------gtaacacaggactgctgctgc
A0A672JWL9_BMF-01      ttctctacg--------------------gtaacacaggactgctgctgc
A0A672JWL9_BMF-02      ttctctacg--------------------gtaacacaggactgctgctgc
A0A673HDR4_BMF-01      ttctctacg--------------------gtaacacaggactgctgctgc
A0A3B3RH63_BMF-01      tcttctacg--------------------gtagtgcagg-------cttg
K7FRX2_BMF-01          tcttctatg--------------------ggaatgctgg-------gtac
A0A452H3N6_BMF-01      tcttctatg--------------------ggaatgctgg-------gtac
A0A674IPL3_BMF-01      tcttctatg--------------------ggaatgctgg-------gtac
A0A493T7X1_BMF-01      tcttctatgcatcagcagaacagaaatcaagtgtggtgg-------cagc
A0A3Q2UCA0_BMF-01      tcttctatg--------------------ggaatgctgg-------ttac
A0A3Q2UCA0_BMF-02      tcttctatg--------------------ggaatgctgg-------ttac
A0A669PL85_BMF-02      tcttctatg--------------------ggaatgctgg-------ttac
A0A493T7X1_BMF-02      tcttctatg--------------------ggaatgctgg-------ttac
A0A3Q2UCA0_BMF-03      tcttctatg--------------------ggaatgctgg-------ttac
A0A3Q2UCA0_BMF-04      tcttctatg--------------------ggaatgctgg-------ttac
A9XRH0_BMF-01          --------g--------------------ggaatgctgg-------ttac
G1NHG8_BMF-01          tcttctatg--------------------ggaatgctgg-------ttac
A0A669PL85_BMF-01      tcttctatg--------------------ggaatgctgg-------ttac
U3JS06_BMF-01          tcttctatg--------------------ggagtgctgg-------ttac
A0A674GIP8_BMF-03      tcttctatg--------------------ggagtgctgg-------ttac
A0A674GIP8_BMF-01      tcttctatg--------------------ggagtgctgg-------ttac
A0A674GIP8_BMF-02      tcttctatg--------------------ggagtgctgg-------ttac
A0A672V891_BMF-01      tcttctatg--------------------ggaatgctgg-------ttac
A0A663DZQ4_BMF-01      tcttctatg--------------------gcaatgctgg-------ttac
A0A663MPI8_BMF-01      tcttctatg--------------------gcaatgctgg-------ttac
A0A670XMZ5_BMF-01      tcttttatg--------------------gaaatgctgg-------atac
H9GL49_BMF-01          tcttctatg--------------------ggaatgctgg-------gtac
A0A670JUU6_BMF-01      tcttctatg--------------------ggaacgccgg-------gttc
A0A670JUU6_BMF-05      tcttctatg--------------------ggaacgccgg-------gttc
A0A670JUU6_BMF-04      tcttctatg--------------------ggaacgccgg-------gttc
A0A670JUU6_BMF-02      tcttctatg--------------------ggaacgccgg-------gttc
A0A670JUU6_BMF-03      tcttctatg--------------------ggaacgccgg-------gttc
A0A4W3JXA1_BMF-01      tgttttatg--------------------ggaatgcagg-------atat
A0A3Q2CXC4_BMF-01      ttttctacc--------------------gtaacgcagg-------tttt
A0A3Q2CXC4_BMF-02      ttttctacc--------------------gtaacgcagg-------tttt
A0A3B5QK08_BMF-01      tattctacg--------------------gtaacgcagg-------tttt
A0A3B5QK08_BMF-02      tattctacg--------------------gtaacgcagg-------tttt
A0A096LRV0_BMF-01      tattctacg--------------------gtaacgcagg-------tttt
A0A3B3WU80_BMF-01      tattctacg--------------------gtaacgcagg-------tttt
A0A3P9Q8E2_BMF-01      tattctacg--------------------gtaacgcagg-------tttt
A0A3Q2PJX9_BMF-01      tgttctacg--------------------gtaacgcagg-------tttt
A0A3Q2PJX9_BMF-03      tgttctacg--------------------gtaacgcagg-------tttt
A0A3Q2PJX9_BMF-02      tgttctacg--------------------gtaacgcagg-------tttt
A0A3Q2YCX7_BMF-01      tcttctacg--------------------gtaacgcagg-------tttt
A0A3Q2YCX7_BMF-02      tcttctacg--------------------gtaacgcagg-------tttt
A0A3B5KWG6_BMF-02      tcttctacg--------------------gcaacgcagg-------tttt
A0A3B5KWG6_BMF-01      tcttctacg--------------------gcaacgcagg-------tttt
A0A3B5KWG6_BMF-03      tcttctacg--------------------gcaacgcagg-------tttt
A0A3B3CGR9_BMF-01      ttttctacg--------------------gtaacgcagg-------tttt
A0A3P9K487_BMF-01      ttttctacg--------------------gtaacgcagg-------tttt
A0A3P9K487_BMF-02      ttttctacg--------------------gtaacgcagg-------tttt
A0A3B3HAU1_BMF-01      ttttctacg--------------------gtaacgcagg-------tttt
A0A3B3HAU1_BMF-02      ttttctacg--------------------gtaacgcagg-------tttt
A0A3B3HAU1_BMF-03      ttttctacg--------------------gtaacgcagg-------tttt
A0A3B3HAU1_BMF-04      ttttctacg--------------------gtaacgcagg-------tttt
A0A3P9ICE1_BMF-04      ttttctacg--------------------gtaacgcagg-------tttt
A0A3P9ICE1_BMF-01      ttttctacg--------------------gtaacgcagg-------tttt
A0A3P9ICE1_BMF-02      ttttctacg--------------------gtaacgcagg-------tttt
A0A3P9ICE1_BMF-03      ttttctacg--------------------gtaacgcagg-------tttt
A0A3P9ICE1_BMF-05      ttttctacg--------------------gtaacgcagg-------tttt
A0A3P8NFE2_BMF-02      tcttctacg--------------------gtaacgcagg-------tttt
A0A668TQU8_BMF-01      tcttctacg--------------------gtga-----g-------tgtt
I3K2D6_BMF-01          tcttctacg--------------------gtaacgcagg-------tttt
A0A3Q4G1I4_BMF-01      tcttctacg--------------------gtaacgcagg-------tttt
A0A3P8NFE2_BMF-01      tcttctacg--------------------gtaacgcagg-------tttt
A0A3P9DPJ5_BMF-01      tcttctacg--------------------gtaacgcagg-------tttt
A0A3P9DPJ5_BMF-02      tcttctacg--------------------gtaacgcagg-------tttt
A0A3B4ETH0_BMF-01      tcttctacg--------------------gtaacgcagg-------tttt
A0A3Q3C5V2_BMF-01      tcttctacg--------------------gtaacgcagg-------tttt
A0A672HG10_BMF-01      tcttctacg--------------------gtaacgcagg-------tttt
A0A3P8UA78_BMF-02      tcttctacg--------------------gcaacgcagg-------cttt
A0A3P8UA78_BMF-01      tcttctacg--------------------gcaacgcagg-------cttt
A0A3P8UA78_BMF-03      tcttctacg--------------------gcaacgcagg-------cttt
A0A3Q3GUU5_BMF-01      tcttctacg--------------------gcaacgcagg-------tttt
A0A3Q3VLX6_BMF-01      tcttctacg--------------------tgacctca-------------
A0A3Q2ZA20_BMF-01      tattctacg--------------------gtaacgcagg-------tttt
A0A667YNR9_BMF-01      tcttctacg--------------------gcaacgcggg-------tttt
A0A3Q3LME3_BMF-01      tcttctacg--------------------gcaacgcagg-------tttt
A0A3Q3LME3_BMF-02      tcttctacg--------------------gcaacgcagg-------tttt
A0A3Q3LME3_BMF-03      tcttctacg--------------------gcaacgcagg-------tttt
A0A3Q1IPR4_BMF-01      tcttctacg--------------------gcaacgcagg-------tttt
A0A3Q3QZ16_BMF-01      tcttctatg--------------------gcaacgcagg-------tttt
A0A3Q3QZ16_BMF-02      tcttctatg--------------------gcaacgcagg-------tttt
A0A665VG08_BMF-01      tcttctacg--------------------gcaacgcagg-------tttt
A0A673C8N3_BMF-01      tcttctacg--------------------gcaacgcagg-------tttt
A0A3Q1FVH7_BMF-01      tcttctacg--------------------gtaacgcagg-------tttt
A0A3Q1FVH7_BMF-02      tcttctacg--------------------gtaacgcagg-------tttt
A0A3B5B8F6_BMF-01      tcttctacg--------------------gtaacgcagg-------tttt
A0A3Q1D1K3_BMF-01      tcttctacg--------------------gtaacgcagg-------tttt
A0A3P8RKY9_BMF-01      tcttctacg--------------------gtaacgcagg-------tttt
A0A671X848_BMF-01      tcttctacg--------------------gcaacgcagg-------tttt
A0A0F8AD62_BMF-01      tcttctacg--------------------gcaacgcagg-------tttt
A0A4W6DUL1_BMF-01      tcttctacg--------------------gcaacgcagg-------tttt
A0A2U9CJH3_BMF-01      tcttctacg--------------------gcaacgcggg-------tttt
A0A3B4U5H8_BMF-01      tcttctacg--------------------gcaacgcagg-------tttt
A0A3B4WM88_BMF-01      tcttctacg--------------------gcaacgcagg-------tttt
A0A3P8ZIE7_BMF-01      tgttctacg--------------------gtaacgcagg-------cttt
A0A4W5N3A7_BMF-01      tcttctacg--------------------gcaatgcagg-------cttt
A0A6F9BGV6_BMF-01      tcttctacg--------------------gcaacgcagg-------cttt
A0A1S3SNN2_BMF-01      tcttctatg--------------------gcaacgcagg-------cttt
A0A674EF64_BMF-01      tcttctacg--------------------gcaacgcagg-------cttt
A0A1S3P5K4_BMF-01      tcttctacg--------------------gcaacgcagg-------cttt
A0A6F9B4C5_BMF-01      tcttctacg--------------------gcaacgcagg-------cttt
A0A4W5N721_BMF-01      tcttctacg--------------------gcaacgcagg-------cttt
A0A1S3P5K4_BMF-02      tcttctacg--------------------gcaacgcagg-------cttt
A0A673YQV3_BMF-01      tcttctacg--------------------gcaacgcagg-------cttt
A0A4W4DZH9_BMF-01      tcttctacg--------------------gtagtgcaggactgctcctgc
A0A3B4CNJ8_BMF-01      tattctacg--------------------gtagcgcaggattgctactac
A0A3B1K1X5_BMF-01      tcttctacg--------------------gtagtgcaggactgttattac
A0A3B4B6Y3_BMF-01      tcttttacg--------------------cacattttga-------actt
A0A6I8NF73_BMF-01      tcttctacg--------------------gccacgccgg-------gtac
A0A5F8GKJ8_BMF-01      tcttttatg--------------------gcaatgctgg-------atat
G3WDQ2_BMF-01          tcttttatg--------------------gcaacgctgg-------atat
A0A4X2KLG2_BMF-01      tcttttatg--------------------gcaatgctgg-------atac
Q8K589_BMF-01          tcttttacg--------------------gcaacgctgg-------ctac
Q91ZE9_BMF-02          tcttttacg--------------------gcaacgctgg-------ctac
Q91ZE9_BMF-01          tcttttacg--------------------gcaacgctgg-------ctac
Q91ZE9_BMF-06          tcttttacg--------------------gcaacgctgg-------ctac
A0A287CXH0_BMF-01      tcttttatg--------------------gcaatgctgg-------ctac
A0A287CXH0_BMF-02      tcttttatg--------------------gcaatgctgg-------ctac
A0A671DWL6_BMF-01      tcttttatg--------------------gcaatgctgg-------ctac
A0A671DWL6_BMF-02      tcttttatg--------------------gcaatgctgg-------ctac
A0A2K6FFN3_BMF-01      tcttttatg--------------------gcaatgctgg-------ctac
A0A2K6FFN3_BMF-02      tcttttatg-----------------------------------------
A0A673TA87_BMF-01      tcttttatg--------------------gcaacgccgg-------ctac
L8IXF5_BMF-01          tcttttatg--------------------gcaatgctgg-------ctac
A0A4W2EII1_BMF-01      tcttttatg--------------------gccatgctgg-------ctac
A0A4W2EII1_BMF-01      tcttttatg--------------------gccatgctgg-------ctac
Q05KI3_BMF-01          tcttttatg--------------------gccatgctgg-------ctac
Q05KI3_BMF-02          tcttttatg--------------------gccatgctgg-------ctac
A0A4W2INA4_BMF-01      tcttttatg--------------------gcaatgctgg-------ctac
A0A4W2INA4_BMF-01      tcttttatg--------------------gcaatgctgg-------ctac
A0A452F2E0_BMF-01      tcttttatg--------------------gcaatgctgg-------ctac
A0A452F2E0_BMF-02      tcttttatg--------------------gcaatgctgg-------ctac
W5QFV1_BMF-01          tcttttatg--------------------gcaatgctgg-------ctac
H0WYH6_BMF-01          tcttttatg--------------------gtaatgttgg-------ctac
A0A337ST43_BMF-02      tcttttatg-----------------------------------------
A0A337ST43_BMF-03      tcttttatg--------------------gcaacgctgg-------ctac
A0A337ST43_BMF-05      tcttttatg--------------------gcaacgctgg-------ctac
A0A337ST43_BMF-01      tcttttatg--------------------gcaacgctgg-------ctac
A0A337ST43_BMF-04      tcttttatg--------------------gcaacgctgg-------ctac
A0A667H967_BMF-01      tcttttatg--------------------gcaacgctgg-------ctac
M3YAD5_BMF-01          tcttttatg--------------------gcaacgctgg-------ctac
U6CSY8_BMF-01          tcttttatg--------------------gcaacgctgg-------ctac
A0A452SED0_BMF-01      tcttttatg--------------------gcaacgcagg-------ctac
A0A384D070_BMF-01      tcttttatg--------------------gcaacgcagg-------ctac
A0A5F4CJ04_BMF-04      tcttttatg--------------------gcaacgctgg-------ctac
A0A5F4CJ04_BMF-03      tcttttatg--------------------gcaacgctgg-------ctac
A0A5F4CJ04_BMF-01      tcttttatg--------------------gcaacgctgg-------ctac
A0A5F4CJ04_BMF-02      tcttttatg--------------------gcaacgctgg-------ctac
A0A4X1UQ42_BMF-01      tcttttatg--------------------gcaatgctgg-------ctac
A0A4X1UQ42_BMF-02      tcttttatg--------------------gcaatgctgg-------ctac
A0A287AIU8_BMF-01      tcttttatg--------------------gcaatgctgg-------ctac
A0A287AIU8_BMF-02      tcttttat------------------------------------------
A0A3Q2HR24_BMF-01      tcttttatg--------------------gcaatgctgg-------ctac
A0A3Q2HR24_BMF-02      tcttttatg--------------------gcaatgctgg-------ctac
G1SR62_BMF-01          tcttttatg--------------------gcaatgctgg-------ctac
A0A286XXB0_BMF-03      tcttttatg--------------------gcaatgctgg-------ctac
A0A286XXB0_BMF-01      tcttttatg--------------------gcaatgctgg-------ctac
A0A286XXB0_BMF-02      tcttttatg--------------------gcaatgctgg-------ctac
A0A2K5KGP2_BMF-01      tgttttatg-----------------------------------------
A0A0D9R4R5_BMF-01      tcttttacg--------------------gcaatgctgg-------ctac
A0A2K5VLE9_BMF-01      tcttttacg-----------------------------------------
A0A2K5VLE9_BMF-02      tcttttacg--------------------gcaatgctgg-------ctac
A0A096NTE9_BMF-02      tcttttacg--------------------gcaatgctgg-------ctac
A0A096NTE9_BMF-01      tcttttacg--------------------gcaatgctgg-------ctac
A0A096NTE9_BMF-03      tcttttacg-----------------------------------------
A0A5F7ZML1_BMF-01      tcttttacg--------------------gcaatgctgg-------ctac
A0A5F7ZML1_BMF-02      tcttttacg--------------------gcaatgctgg-------ctac
A0A5F7ZML1_BMF-03      tcttttacg--------------------gcaatgctgg-------ctac
A0A2K5MJW4_BMF-01      tcttttacg-----------------------------------------
A0A2K6B5F6_BMF-03      tcttttacg-----------------------------------------
A0A2K5Z4A9_BMF-02      tcttttacg-----------------------------------------
A0A2K5MJW4_BMF-02      tcttttacg--------------------gcaatgctgg-------ctac
A0A2K6B5F6_BMF-01      tcttttacg--------------------gcaatgctgg-------ctac
A0A2K6B5F6_BMF-02      tcttttacg--------------------gcaatgctgg-------ctac
A0A2K6B5F6_BMF-04      tcttttacg--------------------gcaatgctgg-------ctac
A0A2K5Z4A9_BMF-01      tcttttacg--------------------gcaatgctgg-------ctac
A0A2K5KGP2_BMF-02      tgttttatg--------------------gcaatgctgg-------ctac
A0A2K6RAW1_BMF-02      tgttttatg-----------------------------------------
A0A2K6RAW1_BMF-01      tgttttatg--------------------gcaatgctgg-------ctac
A0A2K6L919_BMF-01      tgttttatg--------------------gcaatgctgg-------ctac
A0A2K6L919_BMF-03      tgttttatg--------------------gcaatgctgg-------ctac
A0A2K6L919_BMF-02      tgttttatg--------------------gcaatgctgg-------ctac
A0A2U4BC98_BMF-01      tcttttatg--------------------gcaatgccgg-------ctac
G1PAU1_BMF-01          tcttttatg--------------------gcaatgctgg-------ctac
A0A2I3HD83_BMF-01      tcttttatg-----------------------------------------
A0A2K6TW78_BMF-03      tcttttatg-----------------------------------------
A0A2K6TW78_BMF-02      tcttttatg--------------------gcaatgctgg-------ctac
A0A2K6TW78_BMF-01      tcttttatg--------------------gcaatgctgg-------ctac
A0A2J8T301_BMF-01      tcttttatg--------------------gcaatgctgg-------ctac
G3T7Z4_BMF-01          tcttttatg--------------------gcaatgctgg-------ctac
A0A2K5RN49_BMF-02      tcttttatg-----------------------------------------
A0A2K5RN49_BMF-01      tcttttatg--------------------gcaatgctgg-------ctac
F7HZL0_BMF-01          tcttttacg--------------------gcaatgctgg-------ctac
A0A2K5E1Q4_BMF-02      tcttttacg-----------------------------------------
A0A2K5E1Q4_BMF-01      tcttttacg--------------------gcaatgctgg-------ctat
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          tcttttatg-----------------------------------------
Q96LC9_BMF-07          tcttttatg-----------------------------------------
Q96LC9_BMF-01          tcttttatg--------------------gcaatgctgg-------ctat
Q96LC9_BMF-02          tcttttatg--------------------gcaatgctgg-------ctat
Q96LC9_BMF-03          tcttttatg--------------------gcaatgctgg-------ctat
Q96LC9_BMF-04          tcttttatg--------------------gcaatgctgg-------ctat
A0A2J8QDD5_BMF-01      tcttttatg-----------------------------------------
A0A2R9BS98_BMF-02      tcttttatg-----------------------------------------
Q96LC9_BMF-06          tcttttatg--------------------gcaatgctgg-------ctat
A0A2I2Z168_BMF-02      tcttttatg-----------------------------------------
A0A2I2Z168_BMF-01      tcttttatg--------------------gcaatgctgg-------ctat
Q96LC9_BMF-08          --------------------------------------------------
A0A2R9BS98_BMF-01      tcttttatg--------------------gcaatgctgg-------ctat
A0A2J8QDD5_BMF-02      tcttttatg--------------------gcaatgctgg-------ctat
                                                                         

A0A672RK14_BMF-01      cgtgcacacttccccgcactg---tttg---aaccc----ctcctggatg
A0A673JJ10_BMF-01      cgttcacacttccccgcattg---ttcg---aaccc----gtcccggata
A0A3B4UNJ0_BMF-01      gaactgtcccccagtaccaa-----------aatgaatatgttaagattc
W5N4P7_BMF-01          cgattgcacttccctgcacat---tttg---aacag----ggcggggatg
A3KND0_BMF-01          ------------------------ctta----------------------
Q0GKC7_BMF-01          tagctgcgtccagccgcgctcagcctccagacgtggtgttacggcagaac
A0A671M0H4_BMF-01      tagcgtctcccagccgctctcagcctccagacgtggttctccggcaggac
A0A671M0H4_BMF-02      tagcgtctcccagccgctctcagcctccagacgtggttctccggcaggac
A0A671MNR9_BMF-01      tagcgccgcctagccgctctcggcctccagacgtggttctccggcagaac
A0A672JWL9_BMF-01      tagcgccgcctagccgctctcggcctccagacgtggttctccggcagaac
A0A672JWL9_BMF-02      tagcgccgcctagccgctctcggcctccagacgtggttctccggcagaac
A0A673HDR4_BMF-01      tagcgccgcctagccgctctcggcctccagacgtggttctccggcagaac
A0A3B3RH63_BMF-01      cggctgcatttcccggcactt---tcgg---tgccc----ggcgggcacc
K7FRX2_BMF-01          cgtttacatgaac-ccccagttggcttc------------gcattgaatc
A0A452H3N6_BMF-01      cgtttacatgtcc-ccccagttggcttt------------gcattgaatc
A0A674IPL3_BMF-01      cgtttacatgtcc-ccccagttggcttt------------gcattgaatc
A0A493T7X1_BMF-01      tttttctctttctacacaacttggccttaaacgtggaggcgaacaggaac
A0A3Q2UCA0_BMF-01      cgcttacatgtcc-ctccagttggcttt------------gcattggatc
A0A3Q2UCA0_BMF-02      cgcttacatgtcc-ctccagttggcttt------------gcattggatc
A0A669PL85_BMF-02      cgcttacatgtcc-ccccagttggcttt------------gcattggatc
A0A493T7X1_BMF-02      cgtttacatgtcc-ctccagttggcttt------------gcattggatc
A0A3Q2UCA0_BMF-03      cgcttacatgtcc-ctccagttggcttt------------gcattggatc
A0A3Q2UCA0_BMF-04      cgcttacatgtcc-ctccagttggcttt------------gcattggatc
A9XRH0_BMF-01          cgcttacatgtcc-ctccagttggcttt------------gcattggatc
G1NHG8_BMF-01          cgcttacatgtcc-ccccagttggcttt------------gcattggatc
A0A669PL85_BMF-01      cgcttacatgtcc-ccccagttggcttt------------gcattggatc
U3JS06_BMF-01          cgtttacatgtcc-ctccagctggcttt------------gtgttggatc
A0A674GIP8_BMF-03      cgtttacatgtcc-ctccagctgggttt------------gtgttggatc
A0A674GIP8_BMF-01      cgtttacatgtcc-ctccagctgggttt------------gtgttggatc
A0A674GIP8_BMF-02      cgtttacatgtcc-ctccagctgggttt------------gtgttggatc
A0A672V891_BMF-01      cgtttacacatcc-ctccagtcggcttt------------gcgttggatc
A0A663DZQ4_BMF-01      cgtttacacgtcc-ctccagttggcttt------------gcgttggatc
A0A663MPI8_BMF-01      cgtttacacgtcc-ctccagttggcttt------------gcgttggatc
A0A670XMZ5_BMF-01      cgtttacatgtcc-aaccaatcggtttc------------acattgaatc
H9GL49_BMF-01          cgtttacacgtca-gcccaattggtttc------------tcattgaatc
A0A670JUU6_BMF-01      cgtttacatgtca-accccattggtttc------------tcattgagtc
A0A670JUU6_BMF-05      cgtttacatgtca-accccattggtttc------------tcattgagtc
A0A670JUU6_BMF-04      cgtttacatgtca-accccattggtttc------------tcattgagtc
A0A670JUU6_BMF-02      cgtttacatgtca-accccattggtttc------------tcattgagtc
A0A670JUU6_BMF-03      cgtttacatgtca-accccattggtttc------------tcattgagtc
A0A4W3JXA1_BMF-01      cggctgggttctccgg---------------aggtg----tttgaagtgc
A0A3Q2CXC4_BMF-01      cgattgcacttcccagcacat---tttg---agctt----gtcggggatt
A0A3Q2CXC4_BMF-02      cgattgcacttcccagcacat---tttg---agctt----gtcggggatt
A0A3B5QK08_BMF-01      cgattgcacttcccagcgcat---tttg---aactt----gtcggggatt
A0A3B5QK08_BMF-02      cgattgcacttcccagcgcat---tttg---aactt----gtcggggatt
A0A096LRV0_BMF-01      cgattgcacttcccagcgcat---tttg---aactt----gtcggggatt
A0A3B3WU80_BMF-01      cgattgcacttcccagcgcat---tttg---aactt----gtcggggatt
A0A3P9Q8E2_BMF-01      cgattgcacttcccagcgcat---tttg---aactt----gtcagggatt
A0A3Q2PJX9_BMF-01      cgattgcacttcccagcacat---tttg---agctt----gtcggggatt
A0A3Q2PJX9_BMF-03      cgattgcacttcccagcacat---tttg---agctt----gtcggggatt
A0A3Q2PJX9_BMF-02      cgattgcacttcccagcacat---tttg---agctt----gtcggggatt
A0A3Q2YCX7_BMF-01      cgattgcacttcccggcccac---tttg---aactt----gttggtgaac
A0A3Q2YCX7_BMF-02      cgattgcacttcccggcccac---tttg---aactt----gttggtgaac
A0A3B5KWG6_BMF-02      cgattgcacttccccgcacgc---ttcg---aggtt----ctcggggatc
A0A3B5KWG6_BMF-01      cgattgcacttccccgcacgc---ttcg---aggtt----ctcggggatc
A0A3B5KWG6_BMF-03      cgattgcacttccccgcacgc---ttcg---aggtt----ctcggggatc
A0A3B3CGR9_BMF-01      cgattgcacttcccagcacgc---ttcg---agctt----gctggggatc
A0A3P9K487_BMF-01      cgattgcacttcccagcacgc---tttg---agctt----gctggggatc
A0A3P9K487_BMF-02      cgattgcacttcccagcacgc---tttg---agctt----gctggggatc
A0A3B3HAU1_BMF-01      cgattgcacttcccagcacgc---tttg---agctt----gctggggatc
A0A3B3HAU1_BMF-02      cgattgcacttcccagcacgc---tttg---agctt----gctggggatc
A0A3B3HAU1_BMF-03      cgattgcacttcccagcacgc---tttg---agctt----gctggggatc
A0A3B3HAU1_BMF-04      cgattgcacttcccagcacgc---tttg---agctt----gctggggatc
A0A3P9ICE1_BMF-04      cgattgcacttcccagcacgc---tttg---agctt----gctggggatc
A0A3P9ICE1_BMF-01      cgattgcacttcccagcacgc---tttg---agctt----gctggggatc
A0A3P9ICE1_BMF-02      cgattgcacttcccagcacgc---tttg---agctt----gctggggatc
A0A3P9ICE1_BMF-03      cgattgcacttcccagcacgc---tttg---agctt----gctggggatc
A0A3P9ICE1_BMF-05      cgattgcacttcccagcacgc---tttg---agctt----gctggggatc
A0A3P8NFE2_BMF-02      cgattgcacttcccggcacgc---ttcg---agctc----gtcggggatc
A0A668TQU8_BMF-01      --actgcactgatc-tcaccc---ct------------------------
I3K2D6_BMF-01          cgattgcacttcccggcacgc---ttcg---aactc----gtcggggatc
A0A3Q4G1I4_BMF-01      cgattgcacttcccggcacgc---ttcg---agctc----gtcggggatc
A0A3P8NFE2_BMF-01      cgattgcacttcccggcacgc---ttcg---agctc----gtcggggatc
A0A3P9DPJ5_BMF-01      cgattgcacttcccggcacgc---ttcg---agctc----gtcggggatc
A0A3P9DPJ5_BMF-02      cgattgcacttcccggcacgc---ttcg---agctc----gtcggggatc
A0A3B4ETH0_BMF-01      cgattgcacttcccggcacgc---ttcg---agctc----gtcggggatc
A0A3Q3C5V2_BMF-01      cgattgcacttcccggcacgc---ttcg---agctc----gtcggggatc
A0A672HG10_BMF-01      cgattgcacttcccggcacac---tttg---agctt----gtgggggatc
A0A3P8UA78_BMF-02      cgattgcacttcccagctcac---tttg---agcta----attggagatc
A0A3P8UA78_BMF-01      cgattgcacttcccagctcac---tttg---agcta----attggagatc
A0A3P8UA78_BMF-03      cgattgcacttcccagctcac---tttg---agcta----attggagatc
A0A3Q3GUU5_BMF-01      cgattacacttccctgcaaac---tttg---agctt----gttggggatc
A0A3Q3VLX6_BMF-01      ---------tccctggcgc----------------------ctgatagtc
A0A3Q2ZA20_BMF-01      cgattgcacttcccagctcgc---ttcg---aactc----atcagggatc
A0A667YNR9_BMF-01      cgattgcacttcccagcacac---tttg---agctt----gtcggggacc
A0A3Q3LME3_BMF-01      cgattgcacttcccggcacat---tttg---aactt----gttggggatc
A0A3Q3LME3_BMF-02      cgattgcacttcccggcacat---tttg---aactt----gttggggatc
A0A3Q3LME3_BMF-03      cgattgcacttcccggcacat---tttg---aactt----gttggggatc
A0A3Q1IPR4_BMF-01      cggttgcacttcccagcacac---ttcg---agctt----gttggggatc
A0A3Q3QZ16_BMF-01      cgattgcacttcccagcacac---tttg---agctt----gttggggatc
A0A3Q3QZ16_BMF-02      cgattgcacttcccagcacac---tttg---agctt----gttggggatc
A0A665VG08_BMF-01      cgattgcacttcccggcacaa---tttg---agctt----gctggggatc
A0A673C8N3_BMF-01      cgattgcacttcccggcacat---tttg---aactc----tttggggatc
A0A3Q1FVH7_BMF-01      cgactgcacttcccagcacac---tttg---agctt----att-------
A0A3Q1FVH7_BMF-02      cgactgcacttcccagcacac---tttg---agctt----att-------
A0A3B5B8F6_BMF-01      cgattgcacttcccagcacgc---tttg---agctt----attggggatc
A0A3Q1D1K3_BMF-01      cgactgcacttcccagcacgc---tttg---agctt----attgggaatc
A0A3P8RKY9_BMF-01      cgactgcacttcccagcacgc---tttg---agctt----attgggaatc
A0A671X848_BMF-01      cgattgcacttcccggcacac---tttg---agctt----gtcggagatc
A0A0F8AD62_BMF-01      cgattgcacttcccggcacac---tttg---agctt----gttggcgatc
A0A4W6DUL1_BMF-01      cgattgcacttcccggcacac---tttg---agctc----gctgggaatc
A0A2U9CJH3_BMF-01      cgattgcacttcccggcacac---tttg---agctt----tttggggatc
A0A3B4U5H8_BMF-01      cgattgcacttcccggcacat---tttg---agctt----gttggggatc
A0A3B4WM88_BMF-01      cgattgcacttcccggcacat---tttg---agctt----gttggggatc
A0A3P8ZIE7_BMF-01      cgattgcactttccggcccag---tttg---agtgc----gttggagacc
A0A4W5N3A7_BMF-01      cgattgcactttccagcgcgg---tttg---agcag----gttggagacc
A0A6F9BGV6_BMF-01      cgattgcacttcccagcgcgg---tttg---agcag----gttggagacc
A0A1S3SNN2_BMF-01      cgattgcactttccagcgcgg---tttg---agcag----gttggagacc
A0A674EF64_BMF-01      cgattgcactttccagcacgg---tttg---agcag----gttggagacc
A0A1S3P5K4_BMF-01      cgattgcacttcccagcgcag---tttg---agcgt----gttggagacc
A0A6F9B4C5_BMF-01      cgattgcacttcccagcgcag---tttg---agcgt----gttggagacc
A0A4W5N721_BMF-01      cgattgcacttcccagcgcag---tttg---agcgt----gttggagacc
A0A1S3P5K4_BMF-02      cgattgcacttcccagcgcag---tttg---agcgt----gttggagacc
A0A673YQV3_BMF-01      cgattgcacttcccagcgcag---tttg---agcgt----gttggagacc
A0A4W4DZH9_BMF-01      tagcaccacctgcacg--------cccc---aacagtgcagacgacgcca
A0A3B4CNJ8_BMF-01      tagcaccatctgtccgt-------cctg---aacac----gttgagggtg
A0A3B1K1X5_BMF-01      tggcaccgtctgcccgt-------tctg---aacgc----gtcggggacg
A0A3B4B6Y3_BMF-01      ggtgaagatcaggaggcaagtgaatcac---tacaa----gagggagaga
A0A6I8NF73_BMF-01      cgcctctcttccctcaccagct--ttcc---cgggg----acc-------
A0A5F8GKJ8_BMF-01      cgacttcccctcccagccagtt--ttcc---tgcta----gcc-------
G3WDQ2_BMF-01          cgacttcccctcccagctaatt--ttcc---ttcga----gcc-------
A0A4X2KLG2_BMF-01      cgacttcccctcccagccaatt--ttcc---tgtga----gcc-------
Q8K589_BMF-01          aggcttcctctccctgccagtt--tccc---cgcag----gct-------
Q91ZE9_BMF-02          aggcttcctctccctgccagtt--tccc---tgcag----gct-------
Q91ZE9_BMF-01          aggcttcctctccctgccagtt--tccc---tgcag----gct-------
Q91ZE9_BMF-06          aggcttcctctccctgccagtt--tccc---tgcag----gct-------
A0A287CXH0_BMF-01      cggcttcctctccctgctagtt--tccc---tgcag----gct-------
A0A287CXH0_BMF-02      cggcttcctctccctgctagtt--tccc---tgcag----gct-------
A0A671DWL6_BMF-01      cggctccctctccctgccagtt--tccc---tgcag----gct-------
A0A671DWL6_BMF-02      cggctccctctccctgccagtt--tccc---tgcag----gct-------
A0A2K6FFN3_BMF-01      cggcttcctctccctgccagtt--tccc---tgcag----gct-------
A0A2K6FFN3_BMF-02      --------------------------------------------------
A0A673TA87_BMF-01      cggctccctctccctgccagtt--tccc---tgcag----gct-------
L8IXF5_BMF-01          cggctcccccttcctgccagtt--tccc---tgcag----gct-------
A0A4W2EII1_BMF-01      cggctcccccttcctgccagtt--tccc---tgcag----gct-------
A0A4W2EII1_BMF-01      cggctcccccttcctgccagtt--tccc---tgcag----gct-------
Q05KI3_BMF-01          cggctcccccttcctgccagtt--tccc---tgcag----gct-------
Q05KI3_BMF-02          cggctcccccttcctgccagtt--tccc---tgcag----gct-------
A0A4W2INA4_BMF-01      cggctcccccttcctgccagtt--tccc---tgcag----gct-------
A0A4W2INA4_BMF-01      cggctcccccttcctgccagtt--tccc---tgcag----gct-------
A0A452F2E0_BMF-01      cggctcccccttcctgccagtt--tccc---tgcag----gct-------
A0A452F2E0_BMF-02      cggctcccccttcctgccagtt--tccc---tgcag----gct-------
W5QFV1_BMF-01          cggctcccccttcctgccagtt--tccc---tgcag----gct-------
H0WYH6_BMF-01          cggcttcctctccctgccagtt--tccc---tgcag----gct-------
A0A337ST43_BMF-02      --------------------------------------------------
A0A337ST43_BMF-03      cggctccctctccctgccagtt--tccc---tgcag----gct-------
A0A337ST43_BMF-05      cggctccctctccctgccagtt--tccc---tgcag----gct-------
A0A337ST43_BMF-01      cggctccctctccctgccagtt--tccc---tgcag----gct-------
A0A337ST43_BMF-04      cggctccctctccctgccagtt--tccc---tgcag----gct-------
A0A667H967_BMF-01      cggctccctctccctgccagtt--tccc---tgcag----gct-------
M3YAD5_BMF-01          cggctccctctccctgccagct--tccc---tgcag----gct-------
U6CSY8_BMF-01          cggctccctctccctgccagct--tccc---tgcag----gct-------
A0A452SED0_BMF-01      cggctccctctccctgccagtt--tccc---tgcag----gct-------
A0A384D070_BMF-01      cggctccctctccctgccagtt--tccc---tgcag----gct-------
A0A5F4CJ04_BMF-04      cggctccctctccctgccagtt--tccc---tgcag----gct-------
A0A5F4CJ04_BMF-03      cggctccctctccctgccagtt--tccc---tgcag----gct-------
A0A5F4CJ04_BMF-01      cggctccctctccctgccagtt--tccc---tgcag----gct-------
A0A5F4CJ04_BMF-02      cggctccctctccctgccagtt--tccc---tgcag----gct-------
A0A4X1UQ42_BMF-01      cggctccctctccctgccggtt--tccc---cgcag----gct-------
A0A4X1UQ42_BMF-02      cggctccctctccctgccggtt--tccc---cgcag----gct-------
A0A287AIU8_BMF-01      cggctccctctccctgccggtt--tccc---cgcag----gct-------
A0A287AIU8_BMF-02      -----------------------------------g----gct-------
A0A3Q2HR24_BMF-01      cggctccctctccctgccagtt--tccc---tgcag----gct-------
A0A3Q2HR24_BMF-02      cggctccctctccctgccagtt--tccc---tgcag----gct-------
G1SR62_BMF-01          cggctccctctccctgccagtt--tccc---tgcaa----act-------
A0A286XXB0_BMF-03      cggcttcctctccctgccagtt--tccc---tgcag----gct-------
A0A286XXB0_BMF-01      cggcttcctctccctgccagtt--tccc---tgcag----gct-------
A0A286XXB0_BMF-02      cggcttcctctccctgccagtt--tccc---tgcag----gct-------
A0A2K5KGP2_BMF-01      --------------------------------------------------
A0A0D9R4R5_BMF-01      cggcttcctctccctgccagtt--tccc---ggcag----tct-------
A0A2K5VLE9_BMF-01      --------------------------------------------------
A0A2K5VLE9_BMF-02      cggcttcctctccctgccagtt--tccc---ggcag----tct-------
A0A096NTE9_BMF-02      cggcttcctctccctgccagtt--tccc---ggcag----tct-------
A0A096NTE9_BMF-01      cggcttcctctccctgccagtt--tccc---ggcag----tct-------
A0A096NTE9_BMF-03      --------------------------------------------------
A0A5F7ZML1_BMF-01      cggcttcctctccctgccagtt--tccc---ggcag----tct-------
A0A5F7ZML1_BMF-02      cggcttcctctccctgccagtt--tccc---ggcag----tct-------
A0A5F7ZML1_BMF-03      cggcttcctctccctgccagtt--tccc---ggcag----tct-------
A0A2K5MJW4_BMF-01      --------------------------------------------------
A0A2K6B5F6_BMF-03      --------------------------------------------------
A0A2K5Z4A9_BMF-02      --------------------------------------------------
A0A2K5MJW4_BMF-02      cggcttcctctccctgccagtt--tccc---ggcag----tct-------
A0A2K6B5F6_BMF-01      cggcttcctctccctgccagtt--tccc---ggcag----tct-------
A0A2K6B5F6_BMF-02      cggcttcctctccctgccagtt--tccc---ggcag----tct-------
A0A2K6B5F6_BMF-04      cggcttcctctccctgccagtt--tccc---ggcag----tct-------
A0A2K5Z4A9_BMF-01      cggcttcctctccctgccagtt--tccc---ggcag----tct-------
A0A2K5KGP2_BMF-02      cggcttcctctccctgccagtt--tccc---ggcag----tct-------
A0A2K6RAW1_BMF-02      --------------------------------------------------
A0A2K6RAW1_BMF-01      cggcttcctctccctgccagtt--tccc---ggcag----tct-------
A0A2K6L919_BMF-01      cggcttcctctccctgccagtt--tccc---ggcag----tct-------
A0A2K6L919_BMF-03      cggcttcctctccctgccagtt--tccc---ggcag----tct-------
A0A2K6L919_BMF-02      cggcttcctctccctgccagtt--tccc---ggcag----tct-------
A0A2U4BC98_BMF-01      cggctccccctccctgccggtt--tccc---tgcag----gct-------
G1PAU1_BMF-01          cggctccctctccctgccagtt--tccc---tgcag----gct-------
A0A2I3HD83_BMF-01      --------------------------------------------------
A0A2K6TW78_BMF-03      --------------------------------------------------
A0A2K6TW78_BMF-02      cggcttcctctccctgccagtt--tccc---ggcag----tct-------
A0A2K6TW78_BMF-01      cggcttcctctccctgccagtt--tccc---ggcag----tct-------
A0A2J8T301_BMF-01      cggcttcctctccctgccagtt--tccc---ggcag----tct-------
G3T7Z4_BMF-01          cggctccctctccctgccagtt--tccc---tgcag----gct-------
A0A2K5RN49_BMF-02      --------------------------------------------------
A0A2K5RN49_BMF-01      cggcttcctctccctgccagtt--tccc---ggcag----tct-------
F7HZL0_BMF-01          cggcttcctctccctgccagtt--tccc---ggcag----tct-------
A0A2K5E1Q4_BMF-02      --------------------------------------------------
A0A2K5E1Q4_BMF-01      cggcttcctctccctgccagtt--tccc---agcag----tct-------
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          cggcttcctctccctgccagtt--tccc---agcag----tct-------
Q96LC9_BMF-02          cggcttcctctccctgccagtt--tccc---agcag----tct-------
Q96LC9_BMF-03          cggcttcctctccctgccagtt--tccc---agcag----tct-------
Q96LC9_BMF-04          cggcttcctctccctgccagtt--tccc---agcag----tct-------
A0A2J8QDD5_BMF-01      --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
Q96LC9_BMF-06          cggcttcctctccctgccagtt--tccc---agcag----tct-------
A0A2I2Z168_BMF-02      --------------------------------------------------
A0A2I2Z168_BMF-01      cggcttcctctccctgccagtt--tccc---agcag----tct-------
Q96LC9_BMF-08          --------------------------------------------------
A0A2R9BS98_BMF-01      cggcttcctctccctgccagtt--tccc---agcag----tct-------
A0A2J8QDD5_BMF-02      cggcttcctctccctgccagtt--tccc---agcag----tct-------
                                                                         

A0A672RK14_BMF-01      gcacac----------------------------aaaacgcagaagagga
A0A673JJ10_BMF-01      gcacac----------------------------aaaacgcagaagagga
A0A3B4UNJ0_BMF-01      tcagag-------------------------------------aataggc
W5N4P7_BMF-01          aggaag-----------------------------aggagacgggtgaag
A3KND0_BMF-01          --------------------------------------------------
Q0GKC7_BMF-01          gtctca-------------------------------------------c
A0A671M0H4_BMF-01      ctgcgg-------------------------------------------a
A0A671M0H4_BMF-02      ctgcgg-------------------------------------------a
A0A671MNR9_BMF-01      ctgcgc-------------------------------------------a
A0A672JWL9_BMF-01      ctgcgc-------------------------------------------a
A0A672JWL9_BMF-02      ctgcgc-------------------------------------------a
A0A673HDR4_BMF-01      ctgcgc-------------------------------------------a
A0A3B3RH63_BMF-01      cgccgc--aggag-------------------------------------
K7FRX2_BMF-01          cgcacc--tccaa-------------------------------------
A0A452H3N6_BMF-01      cgcacc--tccaa-------------------------------------
A0A674IPL3_BMF-01      cgcacc--tccaa-------------------------------------
A0A493T7X1_BMF-01      cacactgggcaga-------------------------------------
A0A3Q2UCA0_BMF-01      caaatc--tccaa-------------------------------------
A0A3Q2UCA0_BMF-02      caaatc--tccaa-------------------------------------
A0A669PL85_BMF-02      caaatc--tccaa-------------------------------------
A0A493T7X1_BMF-02      cacacc--tccaa-------------------------------------
A0A3Q2UCA0_BMF-03      caaatc--tccaa-------------------------------------
A0A3Q2UCA0_BMF-04      caaatc--tccaa-------------------------------------
A9XRH0_BMF-01          caaatc--tccaa-------------------------------------
G1NHG8_BMF-01          caaatc--tccaa-------------------------------------
A0A669PL85_BMF-01      caaatc--tccaa-------------------------------------
U3JS06_BMF-01          cgcacc--tccaa-------------------------------------
A0A674GIP8_BMF-03      cgcacc--tccag-------------------------------------
A0A674GIP8_BMF-01      cgcacc--tccag-------------------------------------
A0A674GIP8_BMF-02      cgcacc--tccag-------------------------------------
A0A672V891_BMF-01      cacacc--tccaa-------------------------------------
A0A663DZQ4_BMF-01      cgcacc--tccaa-------------------------------------
A0A663MPI8_BMF-01      cgcacc--tccaa-------------------------------------
A0A670XMZ5_BMF-01      cacatc--tccag-------------------------------------
H9GL49_BMF-01          cacact--tccag-------------------------------------
A0A670JUU6_BMF-01      cacacc--tccgg-------------------------------------
A0A670JUU6_BMF-05      cacacc--tccgg-------------------------------------
A0A670JUU6_BMF-04      cacacc--tccgg-------------------------------------
A0A670JUU6_BMF-02      cacacc--tccgg-------------------------------------
A0A670JUU6_BMF-03      cacacc--tccgg-------------------------------------
A0A4W3JXA1_BMF-01      cacggt--ccagtggcctcccccatcaaggccgaggggatggaatgccaa
A0A3Q2CXC4_BMF-01      ttgacg--taagg---cgaca------------agcggagcacaacagga
A0A3Q2CXC4_BMF-02      ttgacg--taagg---cgaca------------agcggagcacaacagga
A0A3B5QK08_BMF-01      ttgacg--cgagg---caaca------------agaggagcagaacagga
A0A3B5QK08_BMF-02      ttgacg--cgagg---caaca------------agaggagcagaacagga
A0A096LRV0_BMF-01      ttgacg--cgagg---caaca------------agaggagcagaacagga
A0A3B3WU80_BMF-01      ttgacg--cgagg---caaca------------agaggagcagaacagga
A0A3P9Q8E2_BMF-01      ttgacg--cgagg---caaca------------agaggagcagaacagga
A0A3Q2PJX9_BMF-01      ttgacg--cgagg---cgaca------------ggaggagcagaacagga
A0A3Q2PJX9_BMF-03      ttgacg--cgagg---cgaca------------ggaggagcagaacagga
A0A3Q2PJX9_BMF-02      ttgacg--cgagg---cgaca------------ggaggagcagaacagga
A0A3Q2YCX7_BMF-01      aggagg--agcga---ctgcaagaaagc---gacg---------acggaa
A0A3Q2YCX7_BMF-02      aggagg--agcga---ctgcaagaaagc---gacg---------acggaa
A0A3B5KWG6_BMF-02      gaggag--tgagg---cggcgagacacc---ggaggggcgcccaacggga
A0A3B5KWG6_BMF-01      gaggag--tgagg---cggcgagacacc---ggaggggcgcccaacggga
A0A3B5KWG6_BMF-03      gaggag--tgagg---cggcgagacacc---ggaggggcgcccaacggga
A0A3B3CGR9_BMF-01      ttgagg--cgagg---cggcacgacagg---gaagcggagcggggcggga
A0A3P9K487_BMF-01      ttgagg--tgagg---cggcacgacagg---gaagcagagcggcgcggga
A0A3P9K487_BMF-02      ttgagg--tgagg---cggcacgacagg---gaagcagagcggcgcggga
A0A3B3HAU1_BMF-01      ttgagg--tgagg---cggcacgacagg---gaagcagagcggcgcggga
A0A3B3HAU1_BMF-02      ttgagg--tgagg---cggcacgacagg---gaagcagagcggcgcggga
A0A3B3HAU1_BMF-03      ttgagg--tgagg---cggcacgacagg---gaagcagagcggcgcggga
A0A3B3HAU1_BMF-04      ttgagg--tgagg---cggcacgacagg---gaagcagagcggcgcggga
A0A3P9ICE1_BMF-04      ttgagg--tgagg---cggcacgacagg---gaagcagagcggcgcggga
A0A3P9ICE1_BMF-01      ttgagg--tgagg---cggcacgacagg---gaagcagagcggcgcggga
A0A3P9ICE1_BMF-02      ttgagg--tgagg---cggcacgacagg---gaagcagagcggcgcggga
A0A3P9ICE1_BMF-03      ttgagg--tgagg---cggcacgacagg---gaagcagagcggcgcggga
A0A3P9ICE1_BMF-05      ttgagg--tgagg---cggcacgacagg---gaagcagagcggcgcggga
A0A3P8NFE2_BMF-02      acagag--cgagt---cgacaaggaagc---acggagcagcaaaacagca
A0A668TQU8_BMF-01      -----g--cgagg---cgacaagaaatc---gcggagcagcaaaacagca
I3K2D6_BMF-01          acagag--cgagg---cgacaagaaatc---gcggagcagcaaaacagca
A0A3Q4G1I4_BMF-01      acagag--cgagt---cgacaaggaagc---acggagcagcaaaacagca
A0A3P8NFE2_BMF-01      acagag--cgagt---cgacaaggaagc---acggagcagcaaaacagca
A0A3P9DPJ5_BMF-01      acagag--cgagt---cgacaaggaagc---acggagcagcaaaacagca
A0A3P9DPJ5_BMF-02      acagag--cgagt---cgacaaggaagc---acggagcagcaaaacagca
A0A3B4ETH0_BMF-01      acagag--cgagt---cgacaaggaagc---acggagcagcaaaacagca
A0A3Q3C5V2_BMF-01      acagag--cgagt---cgacaaggaagc---acggagcagcaaaacagca
A0A672HG10_BMF-01      accgag--tgagg---cggagagaaagc---gaagagcagcagaacggga
A0A3P8UA78_BMF-02      gggaaa--caagg---agaagacaaagt---gacgaggagcgaaatagga
A0A3P8UA78_BMF-01      gggaaa--caagg---agaagacaaagt---gacgaggagcgaaatagga
A0A3P8UA78_BMF-03      gggaaa--caagg---agaagacaaagt---gacgaggagcgaaatagga
A0A3Q3GUU5_BMF-01      aggaag--agagc---ggacaagaaagc---gagctgcagcaaattggga
A0A3Q3VLX6_BMF-01      gtga------------taac-----------tgtagggagcgaaacggga
A0A3Q2ZA20_BMF-01      ttgaag--cgagg---caacaagacagg---gaagaggagccaaacagga
A0A667YNR9_BMF-01      aggagg--cgcgg---cagcaagaaagg---gaagaggagcagaacggga
A0A3Q3LME3_BMF-01      aggaag--tgagg---caacaagaaaga---gaagaggagcaaaacagga
A0A3Q3LME3_BMF-02      aggaag--tgagg---caacaagaaaga---gaagaggagcaaaacagga
A0A3Q3LME3_BMF-03      aggaag--tgagg---caacaagaaaga---gaagaggagcaaaacagga
A0A3Q1IPR4_BMF-01      tggaag--tgagg---caacaagacagt---gaggaggaacaaaacggga
A0A3Q3QZ16_BMF-01      aggaag--cgagg---cgaca------------agaggatcaaaacggga
A0A3Q3QZ16_BMF-02      aggaag--cgagg---cgaca------------agaggatcaaaacggga
A0A665VG08_BMF-01      aggaag--tgagg---ggtcaaggaagc---gaagaggagcaaaacggga
A0A673C8N3_BMF-01      ---cag--tgagg---cgacaagtgagtgaggaagaggagcaaaacggga
A0A3Q1FVH7_BMF-01      -----g--cgagg---caacaaggaagt---gaaatggagcaaaatggga
A0A3Q1FVH7_BMF-02      -----g--cgagg---caacaaggaagt---gaaatggagcaaaatggga
A0A3B5B8F6_BMF-01      accaag--cgaggcaacaacaaggaagt---gaaatggagcaaaacggga
A0A3Q1D1K3_BMF-01      accaag--cgagg---caacaaggaagt---gaaatggagcaaaatggga
A0A3P8RKY9_BMF-01      accaag--caagg---caacaaggaagt---gaaatggagcaaaatggga
A0A671X848_BMF-01      aggaag--cgagg---cgacaagacagc---ggaggggagcaaagcggga
A0A0F8AD62_BMF-01      aggaag--caagg---caccaagaaagc---gaaggggagcaaaacagga
A0A4W6DUL1_BMF-01      aggaag--cgagg---cgacaggaaagt---gaagaggagcgaaacggga
A0A2U9CJH3_BMF-01      aggaag--tgagg---ggacacgagagc---gaagaggagcgaagcggga
A0A3B4U5H8_BMF-01      aggaag--cgagg---cgacaaggaagc---ggagaggagcgaaacggga
A0A3B4WM88_BMF-01      aggaag--cgagg---cgacaaggaagc---ggagaggagcgaaacggga
A0A3P8ZIE7_BMF-01      cgggg-----------cctcagcagcgtccccaggcggtgagagggggga
A0A4W5N3A7_BMF-01      agggg-----------cctcacgagcagcatcaaggggagcgagggagaa
A0A6F9BGV6_BMF-01      agggg-----------cctcaggagcggcatcagggggagagagggagga
A0A1S3SNN2_BMF-01      agggg-----------cctcaggagcagcatcagggggagcgagggagga
A0A674EF64_BMF-01      agggg-----------cctcaggagcagcatcagggggagcgagggagga
A0A1S3P5K4_BMF-01      agggg-----------cctc---tg---------ggagagcgagggggga
A0A6F9B4C5_BMF-01      agggg-----------cctc---ag---------ggggagcgagggggga
A0A4W5N721_BMF-01      agggg-----------cctc---tg---------ggggagcgagggggga
A0A1S3P5K4_BMF-02      agggg-----------cctc---tg---------ggagagcgagggggga
A0A673YQV3_BMF-01      agggg-----------cctc---tgggagagcgaggagagcgagggggga
A0A4W4DZH9_BMF-01      tgctcc--cagag-------------------------------------
A0A3B4CNJ8_BMF-01      ccatgc--ttcag-------------------------------------
A0A3B1K1X5_BMF-01      ccatgt--ttcgg-------------------------------------
A0A3B4B6Y3_BMF-01      tgcaga--acggg-------------------------------------
A0A6I8NF73_BMF-01      ccagtc--tcggc-------------------------------------
A0A5F8GKJ8_BMF-01      tgcggc--ttgga-------------------------------------
G3WDQ2_BMF-01          tgaggc--ttgga-------------------------------------
A0A4X2KLG2_BMF-01      tgaggc--ttgga-------------------------------------
Q8K589_BMF-01          cagccc--ttggg-------------------------------------
Q91ZE9_BMF-02          cacccc--ttggg-------------------------------------
Q91ZE9_BMF-01          cacccc--ttggg-------------------------------------
Q91ZE9_BMF-06          cacccc--ttggg-------------------------------------
A0A287CXH0_BMF-01      tgcccc--ttgga-------------------------------------
A0A287CXH0_BMF-02      tgcccc--ttgga-------------------------------------
A0A671DWL6_BMF-01      tacctc--ttggc-------------------------------------
A0A671DWL6_BMF-02      tacctc--ttggc-------------------------------------
A0A2K6FFN3_BMF-01      tgcccc--ttggg-------------------------------------
A0A2K6FFN3_BMF-02      --------------------------------------------------
A0A673TA87_BMF-01      tgcccc--ttggt-------------------------------------
L8IXF5_BMF-01          tgcccc--ttggt-------------------------------------
A0A4W2EII1_BMF-01      tgcccc--ttggt-------------------------------------
A0A4W2EII1_BMF-01      tgcccc--ttggt-------------------------------------
Q05KI3_BMF-01          tgcccc--ttggt-------------------------------------
Q05KI3_BMF-02          tgcccc--ttggt-------------------------------------
A0A4W2INA4_BMF-01      tgcccc--ttggt-------------------------------------
A0A4W2INA4_BMF-01      tgcccc--ttggt-------------------------------------
A0A452F2E0_BMF-01      tgcccc--ttggt-------------------------------------
A0A452F2E0_BMF-02      tgcccc--ttggt-------------------------------------
W5QFV1_BMF-01          tgcccc--ttggt-------------------------------------
H0WYH6_BMF-01          tgccca--ttggg-------------------------------------
A0A337ST43_BMF-02      --------------------------------------------------
A0A337ST43_BMF-03      tgcccc--ttggt-------------------------------------
A0A337ST43_BMF-05      tgcccc--ttggt-------------------------------------
A0A337ST43_BMF-01      tgcccc--ttggt-------------------------------------
A0A337ST43_BMF-04      tgcccc--ttggt-------------------------------------
A0A667H967_BMF-01      tgcccc--ttggt-------------------------------------
M3YAD5_BMF-01          tgcctc--tcggg-------------------------------------
U6CSY8_BMF-01          tgcccc--tcggg-------------------------------------
A0A452SED0_BMF-01      tgcccc--ttggg-------------------------------------
A0A384D070_BMF-01      tgcccc--ttggg-------------------------------------
A0A5F4CJ04_BMF-04      tgcctc--tcctc-------------------------------------
A0A5F4CJ04_BMF-03      tgcctc--tcctc-------------------------------------
A0A5F4CJ04_BMF-01      tgcctc--tcctc-------------------------------------
A0A5F4CJ04_BMF-02      tgcctc--tcctc-------------------------------------
A0A4X1UQ42_BMF-01      tgcccc--ttggc-------------------------------------
A0A4X1UQ42_BMF-02      tgcccc--ttggc-------------------------------------
A0A287AIU8_BMF-01      tgcccc--ttggc-------------------------------------
A0A287AIU8_BMF-02      tgcccc--ttggc-------------------------------------
A0A3Q2HR24_BMF-01      tgcccc--ttggt-------------------------------------
A0A3Q2HR24_BMF-02      tgcccc--ttggt-------------------------------------
G1SR62_BMF-01          tcgcgc--tgggg-------------------------------------
A0A286XXB0_BMF-03      tgcccc--ttggg-------------------------------------
A0A286XXB0_BMF-01      tgcccc--ttggg-------------------------------------
A0A286XXB0_BMF-02      tgcccc--ttggg-------------------------------------
A0A2K5KGP2_BMF-01      --------------------------------------------------
A0A0D9R4R5_BMF-01      tgccca--tcggg-------------------------------------
A0A2K5VLE9_BMF-01      --------------------------------------------------
A0A2K5VLE9_BMF-02      tgccca--tcggg-------------------------------------
A0A096NTE9_BMF-02      tgccca--tcggg-------------------------------------
A0A096NTE9_BMF-01      tgccca--tcggg-------------------------------------
A0A096NTE9_BMF-03      --------------------------------------------------
A0A5F7ZML1_BMF-01      tgccca--tcggg-------------------------------------
A0A5F7ZML1_BMF-02      tgccca--tcggg-------------------------------------
A0A5F7ZML1_BMF-03      tgccca--tcggg-------------------------------------
A0A2K5MJW4_BMF-01      --------------------------------------------------
A0A2K6B5F6_BMF-03      --------------------------------------------------
A0A2K5Z4A9_BMF-02      --------------------------------------------------
A0A2K5MJW4_BMF-02      tgccca--tcggg-------------------------------------
A0A2K6B5F6_BMF-01      tgccca--tcggg-------------------------------------
A0A2K6B5F6_BMF-02      tgccca--tcggg-------------------------------------
A0A2K6B5F6_BMF-04      tgccca--tcggg-------------------------------------
A0A2K5Z4A9_BMF-01      tgccca--tcggg-------------------------------------
A0A2K5KGP2_BMF-02      tgccca--tcggg-------------------------------------
A0A2K6RAW1_BMF-02      --------------------------------------------------
A0A2K6RAW1_BMF-01      tgccca--tcggg-------------------------------------
A0A2K6L919_BMF-01      tgccca--tcggg-------------------------------------
A0A2K6L919_BMF-03      tgccca--tcggg-------------------------------------
A0A2K6L919_BMF-02      tgccca--tcggg-------------------------------------
A0A2U4BC98_BMF-01      tgcccc--ttggt-------------------------------------
G1PAU1_BMF-01          cgcccc--ttggt-------------------------------------
A0A2I3HD83_BMF-01      --------------------------------------------------
A0A2K6TW78_BMF-03      --------------------------------------------------
A0A2K6TW78_BMF-02      tgcccc--ttggg-------------------------------------
A0A2K6TW78_BMF-01      tgcccc--ttggg-------------------------------------
A0A2J8T301_BMF-01      tgccta--ctggg-------------------------------------
G3T7Z4_BMF-01          tgccac--ttggg-------------------------------------
A0A2K5RN49_BMF-02      --------------------------------------------------
A0A2K5RN49_BMF-01      tgcccc--ttggg-------------------------------------
F7HZL0_BMF-01          tgcccc--ttggg-------------------------------------
A0A2K5E1Q4_BMF-02      --------------------------------------------------
A0A2K5E1Q4_BMF-01      tgcccc--ttggg-------------------------------------
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          tgccca--ttggg-------------------------------------
Q96LC9_BMF-02          tgccca--ttggg-------------------------------------
Q96LC9_BMF-03          tgccca--ttggg-------------------------------------
Q96LC9_BMF-04          tgccca--ttggg-------------------------------------
A0A2J8QDD5_BMF-01      --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
Q96LC9_BMF-06          tgccca--ttggg-------------------------------------
A0A2I2Z168_BMF-02      --------------------------------------------------
A0A2I2Z168_BMF-01      tgccca--ttggg-------------------------------------
Q96LC9_BMF-08          --------------------------------------------------
A0A2R9BS98_BMF-01      tgccca--ttggg-------------------------------------
A0A2J8QDD5_BMF-02      tgccca--ttggg-------------------------------------
                                                                         

A0A672RK14_BMF-01      cgaagggagaccag------------------------------aagaaa
A0A673JJ10_BMF-01      cggagggacaccag------------------------------aagaaa
A0A3B4UNJ0_BMF-01      ccgaggagcaggca--------------------------------gggg
W5N4P7_BMF-01          ctgaggagc-----------------------------------------
A3KND0_BMF-01          --------------------------------------------------
Q0GKC7_BMF-01          cgatggagcgacca------------------------------------
A0A671M0H4_BMF-01      tgatggacccagcg------------------------------------
A0A671M0H4_BMF-02      tgatggacccagcg------------------------------------
A0A671MNR9_BMF-01      tgatggatccggcg------------------------------------
A0A672JWL9_BMF-01      tgatggatccggcg------------------------------------
A0A672JWL9_BMF-02      tgatggatccggcg------------------------------------
A0A673HDR4_BMF-01      tgatggatccggcg------------------------------------
A0A3B3RH63_BMF-01      --gagcggcagccc------------------------------------
K7FRX2_BMF-01          --gaggagcctcgg--------------------------------gaa-
A0A452H3N6_BMF-01      --gaggagcctcgg--------------------------------gaa-
A0A674IPL3_BMF-01      --gaggagcctcgg--------------------------------gaa-
A0A493T7X1_BMF-01      --ggtgagcttcac--------------------------------ccac
A0A3Q2UCA0_BMF-01      --gaagagcctcag--------------------------------gaa-
A0A3Q2UCA0_BMF-02      --gaagagcctcag--------------------------------gaa-
A0A669PL85_BMF-02      --gaagagcctcag--------------------------------gaa-
A0A493T7X1_BMF-02      --gaggagcctcag--------------------------------gaa-
A0A3Q2UCA0_BMF-03      --gaagagcctcag--------------------------------gaa-
A0A3Q2UCA0_BMF-04      --gaagagcctcag--------------------------------gaa-
A9XRH0_BMF-01          --gaagagcctcag--------------------------------gaa-
G1NHG8_BMF-01          --gaagagcctcag--------------------------------gaa-
A0A669PL85_BMF-01      --gaagagcctcag--------------------------------gaa-
U3JS06_BMF-01          --gaggaacctcag--------------------------------gaa-
A0A674GIP8_BMF-03      --gaggaacctcag--------------------------------gaa-
A0A674GIP8_BMF-01      --gaggaacctcag--------------------------------gaa-
A0A674GIP8_BMF-02      --gaggaacctcag--------------------------------gaa-
A0A672V891_BMF-01      --gaggagcctcag--------------------------------gaa-
A0A663DZQ4_BMF-01      --gaggagcctcag--------------------------------gaa-
A0A663MPI8_BMF-01      --gaggagcctcga--------------------------------gaa-
A0A670XMZ5_BMF-01      --gaggaacctcag--------------------------------gaa-
H9GL49_BMF-01          --gaggagccccag--------------------------------gag-
A0A670JUU6_BMF-01      --gaggaacctcgg--------------------------------gaa-
A0A670JUU6_BMF-05      --gaggaacctcgg--------------------------------gaa-
A0A670JUU6_BMF-04      --gaggaacctcgg--------------------------------gaa-
A0A670JUU6_BMF-02      --gaggaacctcgg--------------------------------gaa-
A0A670JUU6_BMF-03      --gaggaacctcgg--------------------------------gaa-
A0A4W3JXA1_BMF-01      tggagctgcagcct--------------------------------gagg
A0A3Q2CXC4_BMF-01      tggagcagttacct---------------------------tt---gcaa
A0A3Q2CXC4_BMF-02      tggagcagttacct---------------------------tt---gcaa
A0A3B5QK08_BMF-01      tggagcagttaccc---------------------------ct---gcac
A0A3B5QK08_BMF-02      tggagcagttaccc---------------------------ct---gcac
A0A096LRV0_BMF-01      tggagcagttaccc---------------------------ct---gcac
A0A3B3WU80_BMF-01      tggagcagttaccc---------------------------ct---gcac
A0A3P9Q8E2_BMF-01      tggagcagttaccc---------------------------ct---gcac
A0A3Q2PJX9_BMF-01      tggagccgttaccc---------------------------ct---gcac
A0A3Q2PJX9_BMF-03      tggagccgttaccc---------------------------ct---gcac
A0A3Q2PJX9_BMF-02      tggagccgttaccc---------------------------ct---gcac
A0A3Q2YCX7_BMF-01      tggagcagcaactccagcagcag------------------cagcagcag
A0A3Q2YCX7_BMF-02      tggagcagcaactccagcagcag------------------cagcagcag
A0A3B5KWG6_BMF-02      tggagccgctgccc---------------------------ca---gcat
A0A3B5KWG6_BMF-01      tggagccgctgccc---------------------------ca---gcag
A0A3B5KWG6_BMF-03      tggagccgctgccc---------------------------ca---gcag
A0A3B3CGR9_BMF-01      tggagcggcttccc---------------------------cg---gcag
A0A3P9K487_BMF-01      tggagcggcttccc---------------------------cg---gcag
A0A3P9K487_BMF-02      tggagcggcttccc---------------------------cg---gcag
A0A3B3HAU1_BMF-01      tggagcggcttccc---------------------------cg---gcag
A0A3B3HAU1_BMF-02      tggagcggcttccc---------------------------cg---gcag
A0A3B3HAU1_BMF-03      tggagcggcttccc---------------------------cg---gcag
A0A3B3HAU1_BMF-04      tggagcggcttccc---------------------------cg---gcag
A0A3P9ICE1_BMF-04      tggagcggcttccc---------------------------cg---gcag
A0A3P9ICE1_BMF-01      tggagcggcttccc---------------------------cg---gcag
A0A3P9ICE1_BMF-02      tggagcggcttccc---------------------------cg---gcag
A0A3P9ICE1_BMF-03      tggagcggcttccc---------------------------cg---gcag
A0A3P9ICE1_BMF-05      tggagcggcttccc---------------------------cg---gcag
A0A3P8NFE2_BMF-02      tggagcgcctgccc---------------------------cg---ccag
A0A668TQU8_BMF-01      tggagcgcctgccc---------------------------cg---gcag
I3K2D6_BMF-01          tggagcgcctgccc---------------------------cg---gcag
A0A3Q4G1I4_BMF-01      tggagcgcctgccc---------------------------cg---ccag
A0A3P8NFE2_BMF-01      tggagcgcctgccc---------------------------cg---ccag
A0A3P9DPJ5_BMF-01      tggagcgcctgccc---------------------------cg---ccag
A0A3P9DPJ5_BMF-02      tggagcgcctgccc---------------------------cg---ccag
A0A3B4ETH0_BMF-01      tggagcgcctgccc---------------------------cg---ccag
A0A3Q3C5V2_BMF-01      tggagcgcctgccc---------------------------cg---ccag
A0A672HG10_BMF-01      tggatcagctgccc---------------------------cg---gcag
A0A3P8UA78_BMF-02      tggagccgcggccccagcagcagcagcagcagcagcggcagcagcagcag
A0A3P8UA78_BMF-01      tggagccgcggccccagcagcagcagcagcagcagcggcagcagcagcag
A0A3P8UA78_BMF-03      tggagccgcggccccagcagcagcagcagcagcagcggcagcagcagcag
A0A3Q3GUU5_BMF-01      tggagca---------------------------------------gcag
A0A3Q3VLX6_BMF-01      tggagcggcttcca---------------------------cg---gcag
A0A3Q2ZA20_BMF-01      tggagcggctgccc---------------------------cg---gcag
A0A667YNR9_BMF-01      tggagcagcgaccc---------------------------cg---gcag
A0A3Q3LME3_BMF-01      tggagcagctaccc---------------------------ag---gcag
A0A3Q3LME3_BMF-02      tggagcagctaccc---------------------------ag---gcag
A0A3Q3LME3_BMF-03      tggagcagctaccc---------------------------ag---gcag
A0A3Q1IPR4_BMF-01      tggagatcccaccc---------------------------cg---gcaa
A0A3Q3QZ16_BMF-01      tggagcatctaccc---------------------------cg---gcag
A0A3Q3QZ16_BMF-02      tggagcatctaccc---------------------------cg---gcag
A0A665VG08_BMF-01      tggagcagctaccc---------------------------cg---gcag
A0A673C8N3_BMF-01      tggagcagctaccc---------------------------cg---gcag
A0A3Q1FVH7_BMF-01      tggagcagctgccc---------------------------cg---gcag
A0A3Q1FVH7_BMF-02      tggagcagctgccc---------------------------cg---gcag
A0A3B5B8F6_BMF-01      tggagcagctgccc---------------------------cg---gcag
A0A3Q1D1K3_BMF-01      tggagcagctgccc---------------------------cg---gcag
A0A3P8RKY9_BMF-01      tggagcagctgccc---------------------------cg---gcag
A0A671X848_BMF-01      tggagcagcttccc---------------------------cg---gccg
A0A0F8AD62_BMF-01      tggagcagcttcca---------------------------cg---gcag
A0A4W6DUL1_BMF-01      tggagcagctaccc---------------------------ca---gcgg
A0A2U9CJH3_BMF-01      tggagcagctaccg---------------------------cggcagcag
A0A3B4U5H8_BMF-01      tggagcagctaccc---------------------------cg---gcag
A0A3B4WM88_BMF-01      tggagcagctaccc---------------------------cg---gcag
A0A3P8ZIE7_BMF-01      tggagcacccccaa---------------------------cagctgccc
A0A4W5N3A7_BMF-01      tggaatggcttcaa---------------------------cagcagcct
A0A6F9BGV6_BMF-01      tggaaaggcttcaa---------------------------cagcagcct
A0A1S3SNN2_BMF-01      tggaacggcttcaa------------------------------------
A0A674EF64_BMF-01      tggaacggcttcta------------------------------------
A0A1S3P5K4_BMF-01      tggagaggctcaat---------------------------cagcagccc
A0A6F9B4C5_BMF-01      tggagcggctcgaa---------------------------cagcagccc
A0A4W5N721_BMF-01      tggagcggctcgat---------------------------cagcagccc
A0A1S3P5K4_BMF-02      tggagaggctcaat---------------------------cagcagccc
A0A673YQV3_BMF-01      tggagaggctcaat---------------------------cagcagccc
A0A4W4DZH9_BMF-01      --aaccagctggct--------------------------------gtgg
A0A3B4CNJ8_BMF-01      --gaggaccagctc--------------------------------gcca
A0A3B1K1X5_BMF-01      --gaggagcatcga--------------------------------gccg
A0A3B4B6Y3_BMF-01      --agggagccactc--------------------------------ccca
A0A6I8NF73_BMF-01      --gaggagcccccc--------------------------------gagg
A0A5F8GKJ8_BMF-01      --gaggagccccct--------------------------------gaag
G3WDQ2_BMF-01          --gcggagcctccc--------------------------------gagg
A0A4X2KLG2_BMF-01      --gaggagccccct--------------------------------caag
Q8K589_BMF-01          --gagcagccccct--------------------------------gaag
Q91ZE9_BMF-02          --gagcagccccct--------------------------------gaag
Q91ZE9_BMF-01          --gagcagccccct--------------------------------gaag
Q91ZE9_BMF-06          --gagcagccccct--------------------------------gaag
A0A287CXH0_BMF-01      --gagcagccccct--------------------------------gaag
A0A287CXH0_BMF-02      --gagcagccccct--------------------------------gaag
A0A671DWL6_BMF-01      --gagcagccccct--------------------------------gaag
A0A671DWL6_BMF-02      --gagcagccccct--------------------------------gaag
A0A2K6FFN3_BMF-01      --gaacagcccgct--------------------------------gaag
A0A2K6FFN3_BMF-02      --------------------------------------------------
A0A673TA87_BMF-01      --gagcagccccct--------------------------------gaag
L8IXF5_BMF-01          --gagcaaccccct--------------------------------gaag
A0A4W2EII1_BMF-01      --gagcagccccct--------------------------------gaag
A0A4W2EII1_BMF-01      --gagcagccccct--------------------------------gaag
Q05KI3_BMF-01          --gagcagccccct--------------------------------gaag
Q05KI3_BMF-02          --gagcagccccct--------------------------------gaag
A0A4W2INA4_BMF-01      --gagcagccccct--------------------------------gaag
A0A4W2INA4_BMF-01      --gagcagccccct--------------------------------gaag
A0A452F2E0_BMF-01      --gagcaaccccct--------------------------------gaag
A0A452F2E0_BMF-02      --gagcaaccccct--------------------------------gaag
W5QFV1_BMF-01          --gagcaaccccct--------------------------------gaag
H0WYH6_BMF-01          --gagcagccccct--------------------------------gaag
A0A337ST43_BMF-02      --------------------------------------------------
A0A337ST43_BMF-03      --gagcagccccct--------------------------------gaag
A0A337ST43_BMF-05      --gagcagccccct--------------------------------gaag
A0A337ST43_BMF-01      --gagcagccccct--------------------------------gaag
A0A337ST43_BMF-04      --gagcagccccct--------------------------------gaag
A0A667H967_BMF-01      --gagcagccccct--------------------------------gaag
M3YAD5_BMF-01          --gaccagccccct--------------------------------gaag
U6CSY8_BMF-01          --gaccagccccct--------------------------------gaag
A0A452SED0_BMF-01      --gagcagccccca--------------------------------gaag
A0A384D070_BMF-01      --gagcagccccca--------------------------------gaag
A0A5F4CJ04_BMF-04      --gagcagcccccg--------------------------------gaag
A0A5F4CJ04_BMF-03      --gagcagcccccg--------------------------------gaag
A0A5F4CJ04_BMF-01      --gagcagcccccg--------------------------------gaag
A0A5F4CJ04_BMF-02      --gagcagcccccg--------------------------------gaag
A0A4X1UQ42_BMF-01      --gaacagccccct--------------------------------gaag
A0A4X1UQ42_BMF-02      --gaacagccccct--------------------------------gaag
A0A287AIU8_BMF-01      --gaacagcccccc--------------------------------gaag
A0A287AIU8_BMF-02      --gaacagcccccc--------------------------------gaag
A0A3Q2HR24_BMF-01      --gagcagccccct--------------------------------gaag
A0A3Q2HR24_BMF-02      --gagcagccccct--------------------------------gaag
G1SR62_BMF-01          --gagcagccccct--------------------------------gaag
A0A286XXB0_BMF-03      --gagcagccccct--------------------------------gaag
A0A286XXB0_BMF-01      --gagcagccccct--------------------------------gaag
A0A286XXB0_BMF-02      --gagcagccccct--------------------------------gaag
A0A2K5KGP2_BMF-01      --------------------------------------------------
A0A0D9R4R5_BMF-01      --gagcagcccccc--------------------------------gaag
A0A2K5VLE9_BMF-01      --------------------------------------------------
A0A2K5VLE9_BMF-02      --gagcagcccccc--------------------------------gaag
A0A096NTE9_BMF-02      --gagcagcccccc--------------------------------gaag
A0A096NTE9_BMF-01      --gagcagcccccc--------------------------------gaag
A0A096NTE9_BMF-03      --------------------------------------------------
A0A5F7ZML1_BMF-01      --gagcagcccccc--------------------------------gaag
A0A5F7ZML1_BMF-02      --gagcagcccccc--------------------------------gaag
A0A5F7ZML1_BMF-03      --gagcagcccccc--------------------------------gaag
A0A2K5MJW4_BMF-01      --------------------------------------------------
A0A2K6B5F6_BMF-03      --------------------------------------------------
A0A2K5Z4A9_BMF-02      --------------------------------------------------
A0A2K5MJW4_BMF-02      --gagcagcccccc--------------------------------gaag
A0A2K6B5F6_BMF-01      --gagcagcccccc--------------------------------gaag
A0A2K6B5F6_BMF-02      --gagcagcccccc--------------------------------gaag
A0A2K6B5F6_BMF-04      --gagcagcccccc--------------------------------gaag
A0A2K5Z4A9_BMF-01      --gagcagcccccc--------------------------------gaag
A0A2K5KGP2_BMF-02      --gagcagcccccc--------------------------------gaag
A0A2K6RAW1_BMF-02      --------------------------------------------------
A0A2K6RAW1_BMF-01      --gagcagcccccc--------------------------------gaag
A0A2K6L919_BMF-01      --gagcagcccccc--------------------------------gaag
A0A2K6L919_BMF-03      --gagcagcccccc--------------------------------gaag
A0A2K6L919_BMF-02      --gagcagcccccc--------------------------------gaag
A0A2U4BC98_BMF-01      --gagcagcccgct--------------------------------gaag
G1PAU1_BMF-01          --gagcagcccccg--------------------------------gaag
A0A2I3HD83_BMF-01      --------------------------------------------------
A0A2K6TW78_BMF-03      --------------------------------------------------
A0A2K6TW78_BMF-02      --gagcagccccct--------------------------------gaag
A0A2K6TW78_BMF-01      --gagcagccccct--------------------------------gaag
A0A2J8T301_BMF-01      --gagcagccccct--------------------------------gaag
G3T7Z4_BMF-01          --gagcagccccct--------------------------------gaag
A0A2K5RN49_BMF-02      --------------------------------------------------
A0A2K5RN49_BMF-01      --gaacagcccccc--------------------------------gaag
F7HZL0_BMF-01          --gagcagcccccc--------------------------------gaag
A0A2K5E1Q4_BMF-02      --------------------------------------------------
A0A2K5E1Q4_BMF-01      --gagcagcccccc--------------------------------gaag
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          --gagcagcccccc--------------------------------gaag
Q96LC9_BMF-02          --gagcagcccccc--------------------------------gaag
Q96LC9_BMF-03          --gagcagcccccc--------------------------------gaag
Q96LC9_BMF-04          --gagcagcccccc--------------------------------gaag
A0A2J8QDD5_BMF-01      --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
Q96LC9_BMF-06          --gagcagcccccc--------------------------------gaag
A0A2I2Z168_BMF-02      --------------------------------------------------
A0A2I2Z168_BMF-01      --gagcagcccccc--------------------------------gaag
Q96LC9_BMF-08          --------------------------------------------------
A0A2R9BS98_BMF-01      --gagcagcccccc--------------------------------gaag
A0A2J8QDD5_BMF-02      --gagcagcccccc--------------------------------gaag
                                                                         

A0A672RK14_BMF-01      aggaagacgaac------gtgacgtgggaa--------------ttagtg
A0A673JJ10_BMF-01      aggaagatgaac------gtgatgtgggaa--------------ttagcg
A0A3B4UNJ0_BMF-01      --------------------------------------------tgagcg
W5N4P7_BMF-01          ------------------agccggtg-------c----------ggagtg
A3KND0_BMF-01          -------------------------------------------------t
Q0GKC7_BMF-01          ------------------gagccccgacctgcac----------agagcg
A0A671M0H4_BMF-01      ------------------gtggcgcggcccgagc----------ggagcg
A0A671M0H4_BMF-02      ------------------gtggcgcggcccgagc----------ggagcg
A0A671MNR9_BMF-01      ------------------g-------------------------agagcg
A0A672JWL9_BMF-01      ------------------g-------------------------agagcg
A0A672JWL9_BMF-02      ------------------g-------------------------agagcg
A0A673HDR4_BMF-01      ------------------g-------------------------agagcg
A0A3B3RH63_BMF-01      ---------gac------gaccgcccgcaa---c----------cgagcg
K7FRX2_BMF-01          ------------------ggtcaccaggaagccc-------------ggg
A0A452H3N6_BMF-01      ------------------ggtcagcgggaagcac-------------ttg
A0A674IPL3_BMF-01      ------------------ggtcaacgggaagcac-------------gta
A0A493T7X1_BMF-01      ctgtttcaggccacatccagtctgcagggagcactgaacaaacactggtt
A0A3Q2UCA0_BMF-01      ------------------ggtcagcgggaggcac-------------gta
A0A3Q2UCA0_BMF-02      ------------------ggtcagcgggaggcac-------------gta
A0A669PL85_BMF-02      ------------------ggtcagcgggaggcgc-------------gta
A0A493T7X1_BMF-02      ------------------ggtcagcaggaggcgc-------------gtg
A0A3Q2UCA0_BMF-03      ------------------ggtcagcgggaggcac-------------gta
A0A3Q2UCA0_BMF-04      ------------------ggtcagcgggaggcac-------------gta
A9XRH0_BMF-01          ------------------ggtcagcgggaggcac-------------gta
G1NHG8_BMF-01          ------------------ggtcagcgggaggcgc-------------gta
A0A669PL85_BMF-01      ------------------ggtcagcgggaggcgc-------------gta
U3JS06_BMF-01          ------------------ggtcagcgggaagcac-------------gtg
A0A674GIP8_BMF-03      ------------------ggtcagcgggaagcac-------------gtg
A0A674GIP8_BMF-01      ------------------ggtcagcgggaagcac-------------gtg
A0A674GIP8_BMF-02      ------------------ggtcagcgggaagcac-------------gtg
A0A672V891_BMF-01      ------------------ggtcagcgggaagcgc-------------gtg
A0A663DZQ4_BMF-01      ------------------ggtcagcgggaagcgc-------------gtg
A0A663MPI8_BMF-01      ------------------ggtcagcgggaagcac-------------gtg
A0A670XMZ5_BMF-01      ------------------agtctgcaggaattgc-------------gta
H9GL49_BMF-01          ------------------agtccacaggaactgc-------------gta
A0A670JUU6_BMF-01      ------------------agcccacaggaactgc-------------gaa
A0A670JUU6_BMF-05      ------------------agcccacaggaactgc-------------gaa
A0A670JUU6_BMF-04      ------------------agcccacaggaactgc-------------gaa
A0A670JUU6_BMF-02      ------------------agcccacaggaactgc-------------gaa
A0A670JUU6_BMF-03      ------------------agcccacaggaactgc-------------gaa
A0A4W3JXA1_BMF-01      --------------------------------------------acagag
A0A3Q2CXC4_BMF-01      -----------c------agccggcagca----c----------tcagct
A0A3Q2CXC4_BMF-02      -----------c------agccggcagca----c----------tcagct
A0A3B5QK08_BMF-01      -----------c------agccggctgca----c----------tcagct
A0A3B5QK08_BMF-02      -----------c------agccggctgca----c----------tcagct
A0A096LRV0_BMF-01      -----------c------agccggctgca----c----------tcagct
A0A3B3WU80_BMF-01      -----------c------agccggctgca----c----------tcagct
A0A3P9Q8E2_BMF-01      -----------c------agccggctgca----c----------tcagct
A0A3Q2PJX9_BMF-01      -----------c------agccggcagcg----c----------tcagct
A0A3Q2PJX9_BMF-03      -----------c------agccggcagcg----c----------tcagct
A0A3Q2PJX9_BMF-02      -----------c------agccggcagcg----c----------tcagct
A0A3Q2YCX7_BMF-01      -----------c------agcccgtggca----c----------gcagca
A0A3Q2YCX7_BMF-02      -----------c------agcccgtggca----c----------gcagca
A0A3B5KWG6_BMF-02      -----------g------gtcctgtggtg----c----------gcagca
A0A3B5KWG6_BMF-01      -----------g------gtcctgtggtg----c----------gcagca
A0A3B5KWG6_BMF-03      -----------g------gtcctgtggtg----c----------gcagca
A0A3B3CGR9_BMF-01      -----------c------agcctgcggca----c----------gcagca
A0A3P9K487_BMF-01      -----------c------agcctgtggca----c----------gcagca
A0A3P9K487_BMF-02      -----------c------agcctgtggca----c----------gcagca
A0A3B3HAU1_BMF-01      -----------c------agcctgtggca----c----------gcagca
A0A3B3HAU1_BMF-02      -----------c------agcctgtggca----c----------gcagca
A0A3B3HAU1_BMF-03      -----------c------agcctgtggca----c----------gcagca
A0A3B3HAU1_BMF-04      -----------c------agcctgtggca----c----------gcagca
A0A3P9ICE1_BMF-04      -----------c------agcctgtggca----c----------gcagca
A0A3P9ICE1_BMF-01      -----------c------agcctgtggca----c----------gcagca
A0A3P9ICE1_BMF-02      -----------c------agcctgtggca----c----------gcagca
A0A3P9ICE1_BMF-03      -----------c------agcctgtggca----c----------gcagca
A0A3P9ICE1_BMF-05      -----------c------agcctgtggca----c----------gcagca
A0A3P8NFE2_BMF-02      -----------c------gacccgcggct----c----------gcagcg
A0A668TQU8_BMF-01      -----------c------aacctgcggct----c----------gcagcg
I3K2D6_BMF-01          -----------c------gacctgcggct----c----------gcagcg
A0A3Q4G1I4_BMF-01      -----------c------gacccgcggct----c----------gcagcg
A0A3P8NFE2_BMF-01      -----------c------gacccgcggct----c----------gcagcg
A0A3P9DPJ5_BMF-01      -----------c------gacccgcggct----c----------gcagcg
A0A3P9DPJ5_BMF-02      -----------c------gacccgcggct----c----------gcagcg
A0A3B4ETH0_BMF-01      -----------c------gacccgcggct----c----------gcagcg
A0A3Q3C5V2_BMF-01      -----------c------gacccgcggct----c----------gcagcg
A0A672HG10_BMF-01      -----------c------ggcctgcggcg----c----------aaagcg
A0A3P8UA78_BMF-02      -----------c------agcctgtgcag----c----------gcagcg
A0A3P8UA78_BMF-01      -----------c------agcctgtgcag----c----------gcagcg
A0A3P8UA78_BMF-03      -----------c------agcctgtgcag----c----------gcagcg
A0A3Q3GUU5_BMF-01      -----------c------aacctgttgcc----c----------acagtg
A0A3Q3VLX6_BMF-01      -----------c------agcctgtggct----c----------acagtg
A0A3Q2ZA20_BMF-01      -----------c------tgcccgtggcg----c----------gcagct
A0A667YNR9_BMF-01      -----------c------aacctgttgcg----c----------gcagcg
A0A3Q3LME3_BMF-01      -----------c------aacctctcgtg----c----------acagtg
A0A3Q3LME3_BMF-02      -----------c------aacctctcgtg----c----------acagtg
A0A3Q3LME3_BMF-03      -----------c------aacctctcgtg----c----------acagtg
A0A3Q1IPR4_BMF-01      -----------c------aaccactgatg----c----------aaagcg
A0A3Q3QZ16_BMF-01      -----------c------aacgtgtggcg----c----------gcagtg
A0A3Q3QZ16_BMF-02      -----------c------aacgtgtggcg----c----------gcagtg
A0A665VG08_BMF-01      -----------c------agcctgtggca----c----------gcagca
A0A673C8N3_BMF-01      -----------c------aacctatggca----c----------gcagtg
A0A3Q1FVH7_BMF-01      -----------c------aacctatggca----c----------acagcg
A0A3Q1FVH7_BMF-02      -----------c------aacctatggca----c----------acagcg
A0A3B5B8F6_BMF-01      -----------c------aacctgtggcg----c----------gcagcg
A0A3Q1D1K3_BMF-01      -----------c------aacctgtggca----c----------gcagca
A0A3P8RKY9_BMF-01      -----------c------aacctgtggca----c----------gtagca
A0A671X848_BMF-01      -----------c------aacctgtggca----c----------gcagtg
A0A0F8AD62_BMF-01      -----------c------aacctgtggcc----c----------gcagtg
A0A4W6DUL1_BMF-01      -----------c------agcctgtggcg----c----------gcagtg
A0A2U9CJH3_BMF-01      -----------c------agcctgtggcg----c----------acagcg
A0A3B4U5H8_BMF-01      -----------c------agcctgtggcg----c----------gcagtg
A0A3B4WM88_BMF-01      -----------c------agcctgtggcg----c----------gcagtg
A0A3P8ZIE7_BMF-01      -----------c------agcagccagta----g----------cccg--
A0A4W5N3A7_BMF-01      -----------c------agcagccagca----c----------atagca
A0A6F9BGV6_BMF-01      -----------c------agcagccagca----c----------aaagca
A0A1S3SNN2_BMF-01      -----------c------agcagccagcg----c----------aaagca
A0A674EF64_BMF-01      -----------c------agcagccagtg----c----------aaagca
A0A1S3P5K4_BMF-01      -----------c------agcagccagca----c----------gcagca
A0A6F9B4C5_BMF-01      -----------c------agcagccagca----c----------gcagca
A0A4W5N721_BMF-01      -----------c------agctgccagca----c----------gcagca
A0A1S3P5K4_BMF-02      -----------c------agcagccagca----c----------gcagca
A0A673YQV3_BMF-01      -----------c------agcagccagca----c----------gcagca
A0A4W4DZH9_BMF-01      agcctccccggc------g----gaggcccctcc----------atagcg
A0A3B4CNJ8_BMF-01      tggaacctcgga------g----acggcccccac----------acagtg
A0A3B1K1X5_BMF-01      ttgagcctcggc------g----gcggccggcgc----------acagcg
A0A3B4B6Y3_BMF-01      ---------ggc------accctgtggcagta-c----------gcagca
A0A6I8NF73_BMF-01      ---------cgc------c----gtgggaa---c----------ggagac
A0A5F8GKJ8_BMF-01      ---------agc------a----gtgggag---c----------atcgag
G3WDQ2_BMF-01          ---------agc------a----gtgggag---c----------atcgag
A0A4X2KLG2_BMF-01      ---------agc------a----gtgggaa---c----------atcgaa
Q8K589_BMF-01          ---------gac------a----gttccttcagc----------accgag
Q91ZE9_BMF-02          ---------gac------a----gttccttcagc----------accgag
Q91ZE9_BMF-01          ---------gac------a----gttccttcagc----------accgag
Q91ZE9_BMF-06          ---------gac------a----gttccttcagc----------accgag
A0A287CXH0_BMF-01      ---------gtc------a----gtggcaa---c----------atcgag
A0A287CXH0_BMF-02      ---------gtc------a----gtggcaa---c----------atcgag
A0A671DWL6_BMF-01      ---------ggc------a----gtggcaa---c----------atcgag
A0A671DWL6_BMF-02      ---------ggc------a----gtggcaa---c----------atcgag
A0A2K6FFN3_BMF-01      ---------ggc------a----gtggcaa---c----------atcgag
A0A2K6FFN3_BMF-02      --------------------------------------------------
A0A673TA87_BMF-01      ---------ggc------a----ttggcaa---c----------atcgag
L8IXF5_BMF-01          ---------ggc------a----gtggcaa---c----------atcgag
A0A4W2EII1_BMF-01      ---------ggc------a----gtggcaa---c----------atcgag
A0A4W2EII1_BMF-01      ---------ggc------a----gtggcaa---c----------atcgag
Q05KI3_BMF-01          ---------ggc------a----gtggcaa---c----------atcgag
Q05KI3_BMF-02          ---------ggc------a----gtggcaa---c----------atcgag
A0A4W2INA4_BMF-01      ---------ggc------a----gtggcaa---c----------atcgag
A0A4W2INA4_BMF-01      ---------ggc------a----gtggcaa---c----------atcgag
A0A452F2E0_BMF-01      ---------ggc------a----gtggcaa---c----------atcgag
A0A452F2E0_BMF-02      ---------ggc------a----gtggcaa---c----------atcgag
W5QFV1_BMF-01          ---------ggc------a----gtggcaa---c----------atcgag
H0WYH6_BMF-01          ---------ggc------a----atggcaa---c----------atcgag
A0A337ST43_BMF-02      --------------------------------------------------
A0A337ST43_BMF-03      ---------ggc------a----ttggcag---c----------atcgag
A0A337ST43_BMF-05      ---------ggc------a----ttggcag---c----------atcgag
A0A337ST43_BMF-01      ---------ggc------a----ttggcag---c----------atcgag
A0A337ST43_BMF-04      ---------ggc------a----ttggcag---c----------atcgag
A0A667H967_BMF-01      ---------ggc------a----ttggcag---c----------atcgag
M3YAD5_BMF-01          ---------ggc------a----gtggcag---c----------atcgag
U6CSY8_BMF-01          ---------ggc------a----gtggcag---c----------atcgag
A0A452SED0_BMF-01      ---------ggc------c----gtggcaa---c----------atcgag
A0A384D070_BMF-01      ---------ggc------c----gtggcaa---c----------atcgag
A0A5F4CJ04_BMF-04      ---------ggc------a----gtggcaa---c----------atcgag
A0A5F4CJ04_BMF-03      ---------ggc------a----gtggcaa---c----------atcgag
A0A5F4CJ04_BMF-01      ---------ggc------a----gtggcaa---c----------atcgag
A0A5F4CJ04_BMF-02      ---------ggc------a----gtggcaa---c----------atcgag
A0A4X1UQ42_BMF-01      ---------ggc------a----gtggcaa---c----------atcgag
A0A4X1UQ42_BMF-02      ---------ggc------a----gtggcaa---c----------atcgag
A0A287AIU8_BMF-01      ---------ggc------a----gtggcaa---c----------atcgag
A0A287AIU8_BMF-02      ---------ggc------a----gtggcaa---c----------atcgag
A0A3Q2HR24_BMF-01      ---------ggc------a----gtggcaa---c----------atcgag
A0A3Q2HR24_BMF-02      ---------ggc------a----gtggcaa---c----------atcgag
G1SR62_BMF-01          ---------ggc------a----gtggcag---c----------atcgag
A0A286XXB0_BMF-03      ---------gtc------a----gtggcaa---c----------atcgag
A0A286XXB0_BMF-01      ---------gtc------a----gtggcaa---c----------atcgag
A0A286XXB0_BMF-02      ---------gtc------a----gtggcaa---c----------atcgag
A0A2K5KGP2_BMF-01      --------------------------------------------------
A0A0D9R4R5_BMF-01      ---------ggc------a----gtggcaa---c----------atcgag
A0A2K5VLE9_BMF-01      --------------------------------------------------
A0A2K5VLE9_BMF-02      ---------ggc------a----gtggcaa---c----------atcgag
A0A096NTE9_BMF-02      ---------ggc------a----gtggcaa---c----------atcgag
A0A096NTE9_BMF-01      ---------ggc------a----gtggcaa---c----------atcgag
A0A096NTE9_BMF-03      --------------------------------------------------
A0A5F7ZML1_BMF-01      ---------ggc------a----gtggcaa---c----------atcgag
A0A5F7ZML1_BMF-02      ---------ggc------a----gtggcaa---c----------atcgag
A0A5F7ZML1_BMF-03      ---------ggc------a----gtggcaa---c----------atcgag
A0A2K5MJW4_BMF-01      --------------------------------------------------
A0A2K6B5F6_BMF-03      --------------------------------------------------
A0A2K5Z4A9_BMF-02      --------------------------------------------------
A0A2K5MJW4_BMF-02      ---------ggc------a----gtggcaa---c----------atcgag
A0A2K6B5F6_BMF-01      ---------ggc------a----gtggcaa---c----------atcgag
A0A2K6B5F6_BMF-02      ---------ggc------a----gtggcaa---c----------atcgag
A0A2K6B5F6_BMF-04      ---------ggc------a----gtggcaa---c----------atcgag
A0A2K5Z4A9_BMF-01      ---------ggc------a----gtggcaa---c----------atcgag
A0A2K5KGP2_BMF-02      ---------ggc------a----gtggcaa---c----------atcgag
A0A2K6RAW1_BMF-02      --------------------------------------------------
A0A2K6RAW1_BMF-01      ---------ggc------a----gtggcaa---c----------atcgag
A0A2K6L919_BMF-01      ---------ggc------a----gtggcaa---c----------atcgag
A0A2K6L919_BMF-03      ---------ggc------a----gtggcaa---c----------atcgag
A0A2K6L919_BMF-02      ---------ggc------a----gtggcaa---c----------atcgag
A0A2U4BC98_BMF-01      ---------ggc------a----gtggcaa---c----------atcgag
G1PAU1_BMF-01          ---------gac------a----gtggcaacatc----------atcgag
A0A2I3HD83_BMF-01      --------------------------------------------------
A0A2K6TW78_BMF-03      --------------------------------------------------
A0A2K6TW78_BMF-02      ---------ggc------a----gtggcaa---c----------atcgag
A0A2K6TW78_BMF-01      ---------ggc------a----gtggcaa---c----------atcgag
A0A2J8T301_BMF-01      ---------ggc------a----gtggcaa---c----------atcgag
G3T7Z4_BMF-01          ---------ggc------a----gtggcaa---c----------atcgag
A0A2K5RN49_BMF-02      --------------------------------------------------
A0A2K5RN49_BMF-01      ---------ggc------a----gtggcaa---c----------atcgag
F7HZL0_BMF-01          ---------ggc------a----gtggcaa---c----------atcgag
A0A2K5E1Q4_BMF-02      --------------------------------------------------
A0A2K5E1Q4_BMF-01      ---------ggc------a----gtggcaa---c----------atcgag
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          ---------ggc------a----gtggcaa---c----------atcaag
Q96LC9_BMF-02          ---------ggc------a----gtggcaa---c----------atcaag
Q96LC9_BMF-03          ---------ggc------a----gtggcaa---c----------atcaag
Q96LC9_BMF-04          ---------ggc------a----gtggcaa---c----------atcaag
A0A2J8QDD5_BMF-01      --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
Q96LC9_BMF-06          ---------ggc------a----gtggcaa---c----------atcaag
A0A2I2Z168_BMF-02      --------------------------------------------------
A0A2I2Z168_BMF-01      ---------ggc------a----gtggcaa---c----------atcgag
Q96LC9_BMF-08          --------------------------------------------------
A0A2R9BS98_BMF-01      ---------ggc------a----gtggcaa---c----------atcgag
A0A2J8QDD5_BMF-02      ---------ggc------a----gtggcaa---c----------atcgag
                                                                         

A0A672RK14_BMF-01      tggaga-------ttcagattgg---acgtaaac----------------
A0A673JJ10_BMF-01      tggaga-------ttcagattgg---acgtaaac----------------
A0A3B4UNJ0_BMF-01      tcgagg-------cgcaaattgg---ccgtaaac----------------
W5N4P7_BMF-01          ctgagg-------ttcgaatagg---ccaaaagc----------------
A3KND0_BMF-01          cagaga---------tataccgtatgtttaatgc----------------
Q0GKC7_BMF-01          tggaaa-------ccctcatcgg---acagaagc----------------
A0A671M0H4_BMF-01      tggaga-------ccctcatcgg---gcagaagc----------------
A0A671M0H4_BMF-02      tggaga-------ccctcatcgg---gcagaagc----------------
A0A671MNR9_BMF-01      tggaga-------ccctcatcgg---gcagaagc----------------
A0A672JWL9_BMF-01      tggaga-------ccctcatcgg---gcagaagc----------------
A0A672JWL9_BMF-02      tggaga-------ccctcatcgg---gcagaagc----------------
A0A673HDR4_BMF-01      tggaga-------ccctcatcgg---gcagaagc----------------
A0A3B3RH63_BMF-01      ccgagg-------tccggattgg---ccagaagc----------------
K7FRX2_BMF-01          ctgagg-------ttcagattgc---acggaagt----------------
A0A452H3N6_BMF-01      ctgagg-------ttcagattgc---acggaagt----------------
A0A674IPL3_BMF-01      ctgagg-------ttcagattgc---acggaagt----------------
A0A493T7X1_BMF-01      cgggggagagacatgcacaccgccggccggatgtgaggactctgaaattc
A0A3Q2UCA0_BMF-01      ctgagg-------tgcagattgc---acggaagt----------------
A0A3Q2UCA0_BMF-02      ctgagg-------tgcagattgc---acggaagt----------------
A0A669PL85_BMF-02      ctgagg-------tgcagattgc---acggaagt----------------
A0A493T7X1_BMF-02      ctgagg-------tgcagattgc---acggaagt----------------
A0A3Q2UCA0_BMF-03      ctgagg-------tgcagattgc---acggaagt----------------
A0A3Q2UCA0_BMF-04      ctgagg-------tgcagattgc---acggaagt----------------
A9XRH0_BMF-01          ctgagg-------tgcagattgc---acggaagt----------------
G1NHG8_BMF-01          ctgagg-------tgcagattgc---acggaagt----------------
A0A669PL85_BMF-01      ctgagg-------tgcagattgc---acggaagt----------------
U3JS06_BMF-01          ctgagg-------tgcagattgc---acggaagt----------------
A0A674GIP8_BMF-03      ctgagg-------tgcaaattgc---acggaagt----------------
A0A674GIP8_BMF-01      ctgagg-------tgcaaattgc---acggaagt----------------
A0A674GIP8_BMF-02      ctgagg-------tgcaaattgc---acggaagt----------------
A0A672V891_BMF-01      ccgagg-------tgcagattgc---acggaagt----------------
A0A663DZQ4_BMF-01      ccgagg-------tgcagattgc---acggaagt----------------
A0A663MPI8_BMF-01      ccgagg-------tgcagattgc---acggaagt----------------
A0A670XMZ5_BMF-01      ccgaag-------ttcagattgc---acggaagt----------------
H9GL49_BMF-01          ctgaag-------ttcagattgc---acggaagt----------------
A0A670JUU6_BMF-01      ctgaag-------ttcagattgc---acggaagt----------------
A0A670JUU6_BMF-05      ctgaag-------ttcagattgc---acggaagt----------------
A0A670JUU6_BMF-04      ctgaag-------ttcagattgc---acggaagt----------------
A0A670JUU6_BMF-02      ctgaag-------ttcagattgc---acggaagt----------------
A0A670JUU6_BMF-03      ctgaag-------ttcagattgc---acggaagt----------------
A0A4W3JXA1_BMF-01      tggagg-------tcgggattgg---ccggaagc----------------
A0A3Q2CXC4_BMF-01      tggagg-------cctgcatcgg---gcagaaac----------------
A0A3Q2CXC4_BMF-02      tggagg-------cctgcatcgg---gcagaaac----------------
A0A3B5QK08_BMF-01      tggagg-------cctccatcgg---gcagaaac----------------
A0A3B5QK08_BMF-02      tggagg-------cctccatcgg---gcagaaac----------------
A0A096LRV0_BMF-01      tggagg-------cctgcatcgg---gcagaagc----------------
A0A3B3WU80_BMF-01      tggagg-------cctgcatcgg---gcagaagc----------------
A0A3P9Q8E2_BMF-01      tggagg-------cttgcatcgg---gcagaagc----------------
A0A3Q2PJX9_BMF-01      tggagg-------cctgcatcgg---gcagaagc----------------
A0A3Q2PJX9_BMF-03      tggagg-------cctgcatcgg---gcagaagc----------------
A0A3Q2PJX9_BMF-02      tggagg-------cctgcatcgg---gcagaagc----------------
A0A3Q2YCX7_BMF-01      tagagg-------cctgcgtcgg---tcagaaac----------------
A0A3Q2YCX7_BMF-02      tagagg-------cctgcgtcgg---tcagaaac----------------
A0A3B5KWG6_BMF-02      cggagg-------cttgcattgg---ccagaagc----------------
A0A3B5KWG6_BMF-01      cggagg-------cttgcattgg---ccagaagc----------------
A0A3B5KWG6_BMF-03      cggagg-------cttgcattgg---ccagaagc----------------
A0A3B3CGR9_BMF-01      cggagg-------cctgcattgc---acagaaac----------------
A0A3P9K487_BMF-01      cggagg-------cctgcattgc---acagaaac----------------
A0A3P9K487_BMF-02      cggagg-------cctgcattgc---acagaaac----------------
A0A3B3HAU1_BMF-01      cggagg-------cctgcattgc---acagaaac----------------
A0A3B3HAU1_BMF-02      cggagg-------cctgcattgc---acagaaac----------------
A0A3B3HAU1_BMF-03      cggagg-------cctgcattgc---acagaaac----------------
A0A3B3HAU1_BMF-04      cggagg-------cctgcattgc---acagaaac----------------
A0A3P9ICE1_BMF-04      cggagg-------cctgcattgc---acagaaac----------------
A0A3P9ICE1_BMF-01      cggagg-------cctgcattgc---acagaaac----------------
A0A3P9ICE1_BMF-02      cggagg-------cctgcattgc---acagaaac----------------
A0A3P9ICE1_BMF-03      cggagg-------cctgcattgc---acagaaac----------------
A0A3P9ICE1_BMF-05      cggagg-------cctgcattgc---acagaaac----------------
A0A3P8NFE2_BMF-02      tggagg-------cctgcattgg---acagaaac----------------
A0A668TQU8_BMF-01      tggagg-------cctgcatcgg---acagaaac----------------
I3K2D6_BMF-01          tggagg-------cctgcatcgg---acagaaac----------------
A0A3Q4G1I4_BMF-01      tggagg-------cctgcatcgg---acagaaac----------------
A0A3P8NFE2_BMF-01      tggagg-------cctgcattgg---acagaaac----------------
A0A3P9DPJ5_BMF-01      tggagg-------cctgcattgg---acagaaac----------------
A0A3P9DPJ5_BMF-02      tggagg-------cctgcattgg---acagaaac----------------
A0A3B4ETH0_BMF-01      tggagg-------cctgcattgg---acagaaac----------------
A0A3Q3C5V2_BMF-01      tggagg-------cctgcattgg---acagaaac----------------
A0A672HG10_BMF-01      tggagg-------cttgcatcgg---acagaagc----------------
A0A3P8UA78_BMF-02      tggagg-------tccgcattgg---ccagaaac----------------
A0A3P8UA78_BMF-01      tggagg-------tccgcattgg---ccagaaac----------------
A0A3P8UA78_BMF-03      tggagg-------tccgcattgg---ccagaaac----------------
A0A3Q3GUU5_BMF-01      tggagg-------ccagcatcgg---tctgaaac----------------
A0A3Q3VLX6_BMF-01      tggagg-------cctgcatcgg---ccagaagc----------------
A0A3Q2ZA20_BMF-01      tggaag-------tttgtattgg---acagaaac----------------
A0A667YNR9_BMF-01      tagagg-------cccgcatcgg---ccagaaac----------------
A0A3Q3LME3_BMF-01      tggagg-------cgtgtattgg---ccagaaac----------------
A0A3Q3LME3_BMF-02      tggagg-------cgtgtattgg---ccagaaac----------------
A0A3Q3LME3_BMF-03      tggagg-------cgtgtattgg---ccagaaac----------------
A0A3Q1IPR4_BMF-01      tggaag-------cctgtattgg---ccagaaac----------------
A0A3Q3QZ16_BMF-01      tggagg-------cctgtattgg---ccagaaac----------------
A0A3Q3QZ16_BMF-02      tggagg-------cctgtattgg---ccagaaac----------------
A0A665VG08_BMF-01      ttgaag-------tctgcattgg---ccagaaac----------------
A0A673C8N3_BMF-01      tggagg-------cgtgcattgg---ccagaaac----------------
A0A3Q1FVH7_BMF-01      tggagg-------cttgcattgg---acagaaac----------------
A0A3Q1FVH7_BMF-02      tggagg-------cttgcattgg---acagaaac----------------
A0A3B5B8F6_BMF-01      tggagg-------cttgcattgg---acagaaac----------------
A0A3Q1D1K3_BMF-01      tggagg-------cttgcattgg---acagaaac----------------
A0A3P8RKY9_BMF-01      tggagg-------cttgcattgg---acagaaac----------------
A0A671X848_BMF-01      tggagg-------cctgcatcgg---ccagaaac----------------
A0A0F8AD62_BMF-01      tggagg-------cctgcattgg---ccagaaac----------------
A0A4W6DUL1_BMF-01      tggagg-------cttgcattgg---ccagaaac----------------
A0A2U9CJH3_BMF-01      tggagg-------cctgcattgg---ccagaaac----------------
A0A3B4U5H8_BMF-01      tggagg-------cctgcattgg---tcagaaac----------------
A0A3B4WM88_BMF-01      tggagg-------cctgcattgg---tcagaaac----------------
A0A3P8ZIE7_BMF-01      --------------ttgcattgg---acagaagc----------------
A0A4W5N3A7_BMF-01      tggagg-------tctgcattgg---acagaaac----------------
A0A6F9BGV6_BMF-01      tggagg-------tctgcattgg---acagaaac----------------
A0A1S3SNN2_BMF-01      tggagg-------tctgcattgg---acagaaac----------------
A0A674EF64_BMF-01      tggagg-------tctgcattgg---acagaaac----------------
A0A1S3P5K4_BMF-01      tagaga-------tctgcattgg---acagaaac----------------
A0A6F9B4C5_BMF-01      tagagg-------tctacattgg---acagaaac----------------
A0A4W5N721_BMF-01      tagagg-------tctgcattgg---acagaaac----------------
A0A1S3P5K4_BMF-02      tagaga-------tctgcattgg---acagaaac----------------
A0A673YQV3_BMF-01      tagaga-------tctgcattgg---acagaaac----------------
A0A4W4DZH9_BMF-01      tggagg-------ccagcattgg---tcaaaagc----------------
A0A3B4CNJ8_BMF-01      tggagg-------cccgtatcgg---tcagaagc----------------
A0A3B1K1X5_BMF-01      tggagg-------cccgtatcgg---acagaagc----------------
A0A3B4B6Y3_BMF-01      tggagg-------cctgcatcgg---ccacaaac----------------
A0A6I8NF73_BMF-01      ccgaaa-------tgcaggtcgc---ccgcaagc----------------
A0A5F8GKJ8_BMF-01      ccgagg-------tgcagattgc---ccaaaagc----------------
G3WDQ2_BMF-01          ctgagg-------tgcagattgc---ccgaaagc----------------
A0A4X2KLG2_BMF-01      ctgagg-------tgcagattgc---ccgaaagc----------------
Q8K589_BMF-01          cagagg-------tacagatcgc---cagaaagc----------------
Q91ZE9_BMF-02          cagagg-------tgcagatcgc---cagaaagc----------------
Q91ZE9_BMF-01          cagagg-------tgcagatcgc---cagaaagc----------------
Q91ZE9_BMF-06          cagagg-------tgcagatcgc---cagaaagc----------------
A0A287CXH0_BMF-01      cagagg-------tacagatcgc---ccgaaaac----------------
A0A287CXH0_BMF-02      cagagg-------tacagatcgc---ccgaaaac----------------
A0A671DWL6_BMF-01      cagaga-------tacagattgc---ccgaaagc----------------
A0A671DWL6_BMF-02      cagaga-------tacagattgc---ccgaaagc----------------
A0A2K6FFN3_BMF-01      cagagg-------tacagattgc---ccgaaagc----------------
A0A2K6FFN3_BMF-02      --------------------------------------------------
A0A673TA87_BMF-01      cagagg-------tacagattgc---ccggaagc----------------
L8IXF5_BMF-01          cagaga-------tacagattgc---ccgaaaac----------------
A0A4W2EII1_BMF-01      cagaga-------tacagattgc---ccgaaaac----------------
A0A4W2EII1_BMF-01      cagaga-------tacagattgc---ccgaaaac----------------
Q05KI3_BMF-01          cagaga-------tacagattgc---ccgaaaac----------------
Q05KI3_BMF-02          cagaga-------tacagattgc---ccgaaaac----------------
A0A4W2INA4_BMF-01      cagaga-------tacagattgc---ccgaaaac----------------
A0A4W2INA4_BMF-01      cagaga-------tacagattgc---ccgaaaac----------------
A0A452F2E0_BMF-01      cagaga-------tacagattgc---ccgaaaac----------------
A0A452F2E0_BMF-02      cagaga-------tacagattgc---ccgaaaac----------------
W5QFV1_BMF-01          cagaga-------tacagattgc---ccgaaaac----------------
H0WYH6_BMF-01          cagagg-------tacagattgc---ccgaaagc----------------
A0A337ST43_BMF-02      --------------------------------------------------
A0A337ST43_BMF-03      cagagg-------tacagattgc---ccgaaagc----------------
A0A337ST43_BMF-05      cagagg-------tacagattgc---ccgaaagc----------------
A0A337ST43_BMF-01      cagagg-------tacagattgc---ccgaaagc----------------
A0A337ST43_BMF-04      cagagg-------tacagattgc---ccgaaagc----------------
A0A667H967_BMF-01      cagagg-------tacagattgc---ccgaaagc----------------
M3YAD5_BMF-01          cagagg-------tacagattgc---ccgaaagc----------------
U6CSY8_BMF-01          cagagg-------tacagattgc---ccgaaagc----------------
A0A452SED0_BMF-01      cagagg-------tacagattgc---ccgaaagc----------------
A0A384D070_BMF-01      cagagg-------tacagattgc---ccgaaagc----------------
A0A5F4CJ04_BMF-04      cagagg-------tacagattgc---ccgaaagc----------------
A0A5F4CJ04_BMF-03      cagagg-------tacagattgc---ccgaaagc----------------
A0A5F4CJ04_BMF-01      cagagg-------tacagattgc---ccgaaagc----------------
A0A5F4CJ04_BMF-02      cagagg-------tacagattgc---ccgaaagc----------------
A0A4X1UQ42_BMF-01      cagagg-------tacagattgc---ccgaaaac----------------
A0A4X1UQ42_BMF-02      cagagg-------tacagattgc---ccgaaaac----------------
A0A287AIU8_BMF-01      cagagg-------tacagattgc---ccgaaaac----------------
A0A287AIU8_BMF-02      cagagg-------tacagattgc---ccgaaaac----------------
A0A3Q2HR24_BMF-01      cagagg-------tacagattgc---ccgaaaac----------------
A0A3Q2HR24_BMF-02      cagagg-------tacagattgc---ccgaaaac----------------
G1SR62_BMF-01          cagagg-------tccagattgc---tcggaagc----------------
A0A286XXB0_BMF-03      cagagg-------tacagatcgc---ccggaagc----------------
A0A286XXB0_BMF-01      cagagg-------tacagatcgc---ccggaagc----------------
A0A286XXB0_BMF-02      cagagg-------tacagatcgc---ccggaagc----------------
A0A2K5KGP2_BMF-01      --------------------------------------------------
A0A0D9R4R5_BMF-01      cagagg-------tacagattgc---ccgaaagc----------------
A0A2K5VLE9_BMF-01      --------------------------------------------------
A0A2K5VLE9_BMF-02      cagagg-------tacagattgc---ccgaaagc----------------
A0A096NTE9_BMF-02      cagagg-------tacagattgc---ccgaaagc----------------
A0A096NTE9_BMF-01      cagagg-------tacagattgc---ccgaaagc----------------
A0A096NTE9_BMF-03      --------------------------------------------------
A0A5F7ZML1_BMF-01      cagagg-------tacagattgc---ccgaaagc----------------
A0A5F7ZML1_BMF-02      cagagg-------tacagattgc---ccgaaagc----------------
A0A5F7ZML1_BMF-03      cagagg-------tacagattgc---ccgaaagc----------------
A0A2K5MJW4_BMF-01      --------------------------------------------------
A0A2K6B5F6_BMF-03      --------------------------------------------------
A0A2K5Z4A9_BMF-02      --------------------------------------------------
A0A2K5MJW4_BMF-02      cagagg-------tacagattgc---ccgaaagc----------------
A0A2K6B5F6_BMF-01      cagagg-------tacagattgc---ccgaaagc----------------
A0A2K6B5F6_BMF-02      cagagg-------tacagattgc---ccgaaagc----------------
A0A2K6B5F6_BMF-04      cagagg-------tacagattgc---ccgaaagc----------------
A0A2K5Z4A9_BMF-01      cagagg-------tacagattgc---ccgaaagc----------------
A0A2K5KGP2_BMF-02      cagagg-------tacagattgc---ccgaaagc----------------
A0A2K6RAW1_BMF-02      --------------------------------------------------
A0A2K6RAW1_BMF-01      cagagg-------tacagattgc---ccgaaagc----------------
A0A2K6L919_BMF-01      cagagg-------tacagattgc---ccgaaagc----------------
A0A2K6L919_BMF-03      cagagg-------tacagattgc---ccgaaagc----------------
A0A2K6L919_BMF-02      cagagg-------tacagattgc---ccgaaagc----------------
A0A2U4BC98_BMF-01      cagagg-------tacagattgc---ccgaaaac----------------
G1PAU1_BMF-01          cagaga-------tccagatcgc---cagaaagc----------------
A0A2I3HD83_BMF-01      --------------------------------------------------
A0A2K6TW78_BMF-03      --------------------------------------------------
A0A2K6TW78_BMF-02      cagagg-------tacagattgc---ccgaaagc----------------
A0A2K6TW78_BMF-01      cagagg-------tacagattgc---ccgaaagc----------------
A0A2J8T301_BMF-01      cagagg-------tacagattgc---ccgaaagc----------------
G3T7Z4_BMF-01          cagagg-------tacagattgc---ccgaaagc----------------
A0A2K5RN49_BMF-02      --------------------------------------------------
A0A2K5RN49_BMF-01      cagagg-------tacagattgc---ccgaaagc----------------
F7HZL0_BMF-01          cagagg-------tacagattgc---ccgaaagc----------------
A0A2K5E1Q4_BMF-02      --------------------------------------------------
A0A2K5E1Q4_BMF-01      cagagg-------tacagattgc---ccgaaagc----------------
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          cagagg-------tacagattgc---ccgaaagc----------------
Q96LC9_BMF-02          cagagg-------tacagattgc---ccgaaagc----------------
Q96LC9_BMF-03          cagagg-------tacagattgc---ccgaaagc----------------
Q96LC9_BMF-04          cagagg-------tacagattgc---ccgaaagc----------------
A0A2J8QDD5_BMF-01      --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
Q96LC9_BMF-06          cagag---------------------------------------------
A0A2I2Z168_BMF-02      --------------------------------------------------
A0A2I2Z168_BMF-01      cagagg-------tacagattgc---ccgaaagc----------------
Q96LC9_BMF-08          --------------------------------------------------
A0A2R9BS98_BMF-01      cagagg-------tacagattgc---ccgaaagc----------------
A0A2J8QDD5_BMF-02      cagagg-------tacagattgc---ccgaaagc----------------
                                                                         

A0A672RK14_BMF-01      -----------------tgcgtgaaatgggggatcagtttcagcaggatc
A0A673JJ10_BMF-01      -----------------tgcgtgaaatgggggatcagtttcagcaggaac
A0A3B4UNJ0_BMF-01      -----------------ttcgggagattggagacaagttccaacaggatc
W5N4P7_BMF-01          -----------------tccagaggataggagatcagtttcaccgagact
A3KND0_BMF-01          -----------------ttca----atcccacatgaatctcatagattcc
Q0GKC7_BMF-01          -----------------tgcagctgattggagatcagttctatcaggagc
A0A671M0H4_BMF-01      -----------------tccagctgatcggagatcagttctatcaggagc
A0A671M0H4_BMF-02      -----------------tccagctgatcggagatcagttctatcaggagc
A0A671MNR9_BMF-01      -----------------tccagctgatcggagatcagttctatcaggagc
A0A672JWL9_BMF-01      -----------------tccagctgatcggagatcagttctatcaggagc
A0A672JWL9_BMF-02      -----------------tccagctgatcggagatcagttctatcag----
A0A673HDR4_BMF-01      -----------------tccagctgatcggagatcagttctatcaggagc
A0A3B3RH63_BMF-01      -----------------ttcagatgattggagaccagtttcaccaagacc
K7FRX2_BMF-01          -----------------tacagtgcatagcagaccagttccacaggctcc
A0A452H3N6_BMF-01      -----------------tacagtgcattgcagaccagttccacaggctcc
A0A674IPL3_BMF-01      -----------------tacagtgcattgcagaccagttccacaggctcc
A0A493T7X1_BMF-01      ttctactcgtcttcaagtttggggttttatggactcctctttgctgctcc
A0A3Q2UCA0_BMF-01      -----------------tgcagtgcattgcagaccagttccaccggctcc
A0A3Q2UCA0_BMF-02      -----------------tgcagtgcattgcagaccagttccaccggctcc
A0A669PL85_BMF-02      -----------------tgcagtgcattgcagaccagttccaccggctcc
A0A493T7X1_BMF-02      -----------------tgcagtgcattgcagaccagttccaccggctcc
A0A3Q2UCA0_BMF-03      -----------------tgcagtgcattgcagaccagttccaccggctcc
A0A3Q2UCA0_BMF-04      -----------------tgcagtgcattgcagaccagttccaccggctcc
A9XRH0_BMF-01          -----------------tgcagtgcattgcagaccagttccaccggctcc
G1NHG8_BMF-01          -----------------tgcagtgcattgcagaccagttccaccggctcc
A0A669PL85_BMF-01      -----------------tgcagtgcattgcagaccagttccaccggctcc
U3JS06_BMF-01          -----------------tgcagtgcattgccgaccagttccaccggctcc
A0A674GIP8_BMF-03      -----------------tgcagtgcattgccgaccagttccaccggctcc
A0A674GIP8_BMF-01      -----------------tgcagtgcattgccgaccagttccaccggctcc
A0A674GIP8_BMF-02      -----------------tgcagtgcattgccgaccagttccaccggctcc
A0A672V891_BMF-01      -----------------tgcagtgcattgctgaccagttccaccggctcc
A0A663DZQ4_BMF-01      -----------------tgcagtgcattgccgaccagttccaccggctcc
A0A663MPI8_BMF-01      -----------------tgcagtgcattgccgaccagttccaccggctcc
A0A670XMZ5_BMF-01      -----------------tacagtgcattgcagatcagttccacaggcttc
H9GL49_BMF-01          -----------------tgcagtgcattgcagaccagttccacaggcttc
A0A670JUU6_BMF-01      -----------------tacagtgcattgcggaccagtttcacaggctgc
A0A670JUU6_BMF-05      -----------------tacagtgcattgcggaccagtttcacaggctgc
A0A670JUU6_BMF-04      -----------------tacagtgcattgcggaccagtttcacaggctgc
A0A670JUU6_BMF-02      -----------------tacagtgcattgcggaccagtttcacaggctgc
A0A670JUU6_BMF-03      -----------------tacagtgcattgcggaccagtttcacaggctgc
A0A4W3JXA1_BMF-01      -----------------tgcagcagatcggggaccagtttcacagctcct
A0A3Q2CXC4_BMF-01      -----------------ttcagataataggcgaccagtttcaccgggaac
A0A3Q2CXC4_BMF-02      -----------------ttcagataataggcgaccagtttcaccgggaac
A0A3B5QK08_BMF-01      -----------------ttcagctgataggcgaccagtttcaccgggaac
A0A3B5QK08_BMF-02      -----------------ttcagctgataggcgaccagtttcaccgggaac
A0A096LRV0_BMF-01      -----------------ttcagctgataggcgaccagtttcaccgggaac
A0A3B3WU80_BMF-01      -----------------ttcagctgataggcgaccagtttcaccgggaac
A0A3P9Q8E2_BMF-01      -----------------ttcagctgataggcgaccagtttcaccgggaac
A0A3Q2PJX9_BMF-01      -----------------ttcagctgataggcgaccagtttcatcgggaac
A0A3Q2PJX9_BMF-03      -----------------ttcagctgataggcgaccagtttcatcgggaac
A0A3Q2PJX9_BMF-02      -----------------ttcagctgataggcgaccagtttcatcgggaac
A0A3Q2YCX7_BMF-01      -----------------tccagctgattggagaccagtttcatcgggaac
A0A3Q2YCX7_BMF-02      -----------------tccagctgattggagaccagtttcatcgggaac
A0A3B5KWG6_BMF-02      -----------------tccagctgattggggatcagtttcatcgggaac
A0A3B5KWG6_BMF-01      -----------------tccagctgattggggatcagtttcatcgggaac
A0A3B5KWG6_BMF-03      -----------------tccagctgattggggatcagtttcatcgggaac
A0A3B3CGR9_BMF-01      -----------------tccagctgataggggaccagtttcaccgggaac
A0A3P9K487_BMF-01      -----------------tccagctgataggggaccagtttcaccgggaac
A0A3P9K487_BMF-02      -----------------tccagctgataggggaccagtttcaccgggaac
A0A3B3HAU1_BMF-01      -----------------tccagctgataggggaccagtttcaccgggaac
A0A3B3HAU1_BMF-02      -----------------tccagctgataggggaccagtttcaccgggaac
A0A3B3HAU1_BMF-03      -----------------tccagctgataggggaccagtttcaccgggaac
A0A3B3HAU1_BMF-04      -----------------tccagctgataggggaccagtttcaccgggaac
A0A3P9ICE1_BMF-04      -----------------tccagctgataggggaccagtttcaccgggaac
A0A3P9ICE1_BMF-01      -----------------tccagctgataggggaccagtttcaccgggaac
A0A3P9ICE1_BMF-02      -----------------tccagctgataggggaccagtttcaccgggaac
A0A3P9ICE1_BMF-03      -----------------tccagctgataggggaccagtttcaccgggaac
A0A3P9ICE1_BMF-05      -----------------tccagctgataggggaccagtttcaccgggaac
A0A3P8NFE2_BMF-02      -----------------tccagctcataggagaccagtttcactgggaac
A0A668TQU8_BMF-01      -----------------tccagctcataggagaccagtttcactgggaac
I3K2D6_BMF-01          -----------------tccagctcataggagaccagtttcactgggaac
A0A3Q4G1I4_BMF-01      -----------------tccagctcataggagaccagtttcactgggaac
A0A3P8NFE2_BMF-01      -----------------tccagctcataggagaccagtttcactgggaac
A0A3P9DPJ5_BMF-01      -----------------tccagctcataggagaccagtttcactgggaac
A0A3P9DPJ5_BMF-02      -----------------tccagctcataggagaccagtttcactgggaac
A0A3B4ETH0_BMF-01      -----------------tccagctcataggagaccagtttcactgggaac
A0A3Q3C5V2_BMF-01      -----------------tccagctcataggagaccagtttcactgggaac
A0A672HG10_BMF-01      -----------------tccagctcataggagaccagtttcaccgggaac
A0A3P8UA78_BMF-02      -----------------tccagctaataggagaccagttccaccgggatc
A0A3P8UA78_BMF-01      -----------------tccagctaataggagaccagttccaccgggatc
A0A3P8UA78_BMF-03      -----------------tccagctaataggagaccagttccaccgggatc
A0A3Q3GUU5_BMF-01      -----------------tccaactcataggagaccagtttcatcgggaac
A0A3Q3VLX6_BMF-01      -----------------tccagctgataggagaccagtttcaccgggaac
A0A3Q2ZA20_BMF-01      -----------------tccagctgataggagaccagtttcaccgggaac
A0A667YNR9_BMF-01      -----------------tccagctgataggagaccagttccatcgggaac
A0A3Q3LME3_BMF-01      -----------------tccagctgataggagaccaatttcaccgagaac
A0A3Q3LME3_BMF-02      -----------------tccagctgataggagaccaatttcaccgagaac
A0A3Q3LME3_BMF-03      -----------------tccagctgataggagaccaatttcaccgagaac
A0A3Q1IPR4_BMF-01      -----------------tccagctaataggagaccagtttcacagagaac
A0A3Q3QZ16_BMF-01      -----------------tccagctgataggagatcagtttcatcgagaac
A0A3Q3QZ16_BMF-02      -----------------tccagctgataggagatcagtttcatcgagaac
A0A665VG08_BMF-01      -----------------tccagctgataggagaccagtttcaccgggaac
A0A673C8N3_BMF-01      -----------------tccagctgataggagaccagtttcaccgggaac
A0A3Q1FVH7_BMF-01      -----------------tccagctgataggagaccagtttcaccgggaac
A0A3Q1FVH7_BMF-02      -----------------tccagctgataggagaccagtttcaccgggaac
A0A3B5B8F6_BMF-01      -----------------tccagctgataggagaccagtttcaccgggaac
A0A3Q1D1K3_BMF-01      -----------------tccagctgataggagaccagtttcaccgggaac
A0A3P8RKY9_BMF-01      -----------------tccagctgataggagaccagtttcaccgggaac
A0A671X848_BMF-01      -----------------tccagctgataggagaccagtttcaccgcgaac
A0A0F8AD62_BMF-01      -----------------tccagctgataggagaccagtttcaccgggaac
A0A4W6DUL1_BMF-01      -----------------tccagctgataggagaccagtttcaccgggaac
A0A2U9CJH3_BMF-01      -----------------tccagctgataggagaccagtttcaccgggaac
A0A3B4U5H8_BMF-01      -----------------tccagctgataggagaccagtttcaccgggaac
A0A3B4WM88_BMF-01      -----------------tccagctgataggagaccagtttcaccgggaac
A0A3P8ZIE7_BMF-01      -----------------tccaactcattggtgaccagtttcatgaagaac
A0A4W5N3A7_BMF-01      -----------------tccaactcatcggagaccagttccaccaagaac
A0A6F9BGV6_BMF-01      -----------------tccaactcatcggagaccagttccaccaagaac
A0A1S3SNN2_BMF-01      -----------------tccaactcatcggagaccagttctaccaagaac
A0A674EF64_BMF-01      -----------------tccaactcatcggagaccagttctaccaagaac
A0A1S3P5K4_BMF-01      -----------------tccaactcatcggagaccagttccaccaagaac
A0A6F9B4C5_BMF-01      -----------------tccaactcatcggagaccagttcctccaacaac
A0A4W5N721_BMF-01      -----------------tccaactcatcggagaccagttccaccaagaac
A0A1S3P5K4_BMF-02      -----------------tccaactcatcggagaccagttccaccaagaac
A0A673YQV3_BMF-01      -----------------tccaactcatcggagaccagttccaccaagaac
A0A4W4DZH9_BMF-01      -----------------tccagatgattggcgaccagttctatcaagaac
A0A3B4CNJ8_BMF-01      -----------------tccagatgatcggagatcagttctatcaagagc
A0A3B1K1X5_BMF-01      -----------------tccagatgatcggagaccagttttatcaagagc
A0A3B4B6Y3_BMF-01      -----------------tgcagctcataggagaccagttcc---------
A0A6I8NF73_BMF-01      -----------------tgcagtgcatcgcggaccagtttcatcgtctcc
A0A5F8GKJ8_BMF-01      -----------------ttcaatgcatagcggaccagttccatagactcc
G3WDQ2_BMF-01          -----------------ttcagtgcatcgcggaccagttccacaggctcc
A0A4X2KLG2_BMF-01      -----------------ttcaatgcatagcagaccagttccacagactcc
Q8K589_BMF-01          -----------------ttcagtgcattgcagaccagttccatcggcttc
Q91ZE9_BMF-02          -----------------ttcagtgtattgcagaccagttccatcggcttc
Q91ZE9_BMF-01          -----------------ttcagtgtattgcagaccagttccatcggcttc
Q91ZE9_BMF-06          -----------------ttcagtgtattgcagaccagttccatcggcttc
A0A287CXH0_BMF-01      -----------------ttcagtgcattgcagaccagttccaccggcttc
A0A287CXH0_BMF-02      -----------------ttcagtgcattgcagaccagttccaccggcttc
A0A671DWL6_BMF-01      -----------------ttcagtgtattgcagaccagttccaccggcttc
A0A671DWL6_BMF-02      -----------------ttcagtgtattgcagaccagttccaccggcttc
A0A2K6FFN3_BMF-01      -----------------ttcagtgcattgcagaccagttccaccggcttc
A0A2K6FFN3_BMF-02      --------------------------------------------------
A0A673TA87_BMF-01      -----------------ttcagtgcattgcagaccagttccatcggcttc
L8IXF5_BMF-01          -----------------tccagtgcattgcagaccagttccatcggcttc
A0A4W2EII1_BMF-01      -----------------tccagtgcattgcagaccagttccatcggcttc
A0A4W2EII1_BMF-01      -----------------tccagtgcattgcagaccagttccatcggcttc
Q05KI3_BMF-01          -----------------tccagtgcattgcagaccagttccatcggcttc
Q05KI3_BMF-02          -----------------tccagtgcattgcagaccagttccatcggcttc
A0A4W2INA4_BMF-01      -----------------tccagtgcattgcagaccagttccatcggcttc
A0A4W2INA4_BMF-01      -----------------tccagtgcattgcagaccagttccatcggcttc
A0A452F2E0_BMF-01      -----------------tccagtgcattgcagaccagttccatcggcttc
A0A452F2E0_BMF-02      -----------------tccagtgcattgcagaccagttccatcggcttc
W5QFV1_BMF-01          -----------------tccagtgcattgcagaccagttccatcggcttc
H0WYH6_BMF-01          -----------------ttcagtgcattgcagaccagtttcaccggcttc
A0A337ST43_BMF-02      --------------------------------------------------
A0A337ST43_BMF-03      -----------------ttcagtgcattgcagaccagttccatcggcttc
A0A337ST43_BMF-05      -----------------ttcagtgcattgcagaccagttccatcggcttc
A0A337ST43_BMF-01      -----------------ttcagtgcattgcagaccagttccatcggcttc
A0A337ST43_BMF-04      -----------------ttcagtgcattgcagaccagttccatcggcttc
A0A667H967_BMF-01      -----------------ttcagtgcattgcagaccagttccatcggcttc
M3YAD5_BMF-01          -----------------ttcagtgcattgcagaccagttccatcgacttc
U6CSY8_BMF-01          -----------------ttcagtgcattgcagaccagttccatcgacttc
A0A452SED0_BMF-01      -----------------ttcagtgcattgcagaccagttccaccggcttc
A0A384D070_BMF-01      -----------------ttcagtgcattgcagaccagttccaccggcttc
A0A5F4CJ04_BMF-04      -----------------ttcagtgcattgcagaccagttccatcggcttc
A0A5F4CJ04_BMF-03      -----------------ttcagtgcattgcagaccagttccatcggcttc
A0A5F4CJ04_BMF-01      -----------------ttcagtgcattgcagaccagttccatcggcttc
A0A5F4CJ04_BMF-02      -----------------ttcagtgcattgcagaccagttccatcggcttc
A0A4X1UQ42_BMF-01      -----------------ttcagtgcattgcagaccagttccatcggcttc
A0A4X1UQ42_BMF-02      -----------------ttcagtgcattgcagaccagttccatcggcttc
A0A287AIU8_BMF-01      -----------------ttcagtgcattgcagaccagttccatcggcttc
A0A287AIU8_BMF-02      -----------------ttcagtgcattgcagaccagttccatcggcttc
A0A3Q2HR24_BMF-01      -----------------ttcagtgcattgcagaccagttccatcggcttc
A0A3Q2HR24_BMF-02      -----------------ttcagtgcattgcagaccagttccatcggcttc
G1SR62_BMF-01          -----------------ttcagtgcattgctgaccagttccaccggcttc
A0A286XXB0_BMF-03      -----------------ttcagtgcattgcagaccagttccaccgacttc
A0A286XXB0_BMF-01      -----------------ttcagtgcattgcagaccagttccaccgacttc
A0A286XXB0_BMF-02      -----------------ttcagtgcattgcagaccagttccaccgacttc
A0A2K5KGP2_BMF-01      --------------------------------------------------
A0A0D9R4R5_BMF-01      -----------------ttcagtgcattgcagaccagttccaccggctcc
A0A2K5VLE9_BMF-01      --------------------------------------------------
A0A2K5VLE9_BMF-02      -----------------ttcagtgcattgcagaccagttccaccggctcc
A0A096NTE9_BMF-02      -----------------ttcagtgcattgcagaccagttccaccggctcc
A0A096NTE9_BMF-01      -----------------ttcagtgcattgcagaccagttccaccggctcc
A0A096NTE9_BMF-03      --------------------------------------------------
A0A5F7ZML1_BMF-01      -----------------ttcagtgcattgcagaccagttccaccggctcc
A0A5F7ZML1_BMF-02      -----------------ttcagtgcattgcagaccagttccaccggctcc
A0A5F7ZML1_BMF-03      -----------------ttcagtgcattgcagaccagttccaccggctcc
A0A2K5MJW4_BMF-01      --------------------------------------------------
A0A2K6B5F6_BMF-03      --------------------------------------------------
A0A2K5Z4A9_BMF-02      --------------------------------------------------
A0A2K5MJW4_BMF-02      -----------------ttcagtgcattgcagaccagttccaccggctcc
A0A2K6B5F6_BMF-01      -----------------ttcagtgcattgcagaccagttccaccggctcc
A0A2K6B5F6_BMF-02      -----------------ttcagtgcattgcagaccagttccaccggctcc
A0A2K6B5F6_BMF-04      -----------------ttcagtgcattgcagaccagttccaccggctcc
A0A2K5Z4A9_BMF-01      -----------------ttcagtgcattgcagaccagttccaccggctcc
A0A2K5KGP2_BMF-02      -----------------ttcagtgcattgcagaccagttccaccggcttc
A0A2K6RAW1_BMF-02      --------------------------------------------------
A0A2K6RAW1_BMF-01      -----------------ttcagtgcattgcagaccagttccaccggcttc
A0A2K6L919_BMF-01      -----------------ttcagtgcattgcagaccagttccaccggcttc
A0A2K6L919_BMF-03      -----------------ttcagtgcattgcagaccagttccaccggcttc
A0A2K6L919_BMF-02      -----------------ttcagtgcattgcagaccagttccaccggcttc
A0A2U4BC98_BMF-01      -----------------ttcagcgcattgcagaccagttccatcggcttc
G1PAU1_BMF-01          -----------------ttcagagtattgccgaccaatttcatcggcttc
A0A2I3HD83_BMF-01      --------------------------------------------------
A0A2K6TW78_BMF-03      --------------------------------------------------
A0A2K6TW78_BMF-02      -----------------ttcagtgcattgcagaccagttccaccggcttc
A0A2K6TW78_BMF-01      -----------------ttcagtgcattgcagaccagttccaccggcttc
A0A2J8T301_BMF-01      -----------------ttcagtgcattgcagaccagttccaccggcttc
G3T7Z4_BMF-01          -----------------ttcagtgcattgcagaccacttccaccggcttc
A0A2K5RN49_BMF-02      --------------------------------------------------
A0A2K5RN49_BMF-01      -----------------ttcagtgcattgcagaccagttccaccagcttc
F7HZL0_BMF-01          -----------------ttcagtgcattgcagaccagttccaccggcttc
A0A2K5E1Q4_BMF-02      --------------------------------------------------
A0A2K5E1Q4_BMF-01      -----------------ttcagtgcattgcagaccagttccaccggcttc
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          -----------------ttcagtgcattgcagaccagttccaccggcttc
Q96LC9_BMF-02          -----------------ttcagtgcattgcagaccagttccaccggcttc
Q96LC9_BMF-03          -----------------ttcagtgcattgcagaccagttccaccggcttc
Q96LC9_BMF-04          -----------------ttcagtgcattgcagaccagttccaccggcttc
A0A2J8QDD5_BMF-01      --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
Q96LC9_BMF-06          --------------------------------------------------
A0A2I2Z168_BMF-02      --------------------------------------------------
A0A2I2Z168_BMF-01      -----------------ttcagtgcattgcagaccagttccaccggcttc
Q96LC9_BMF-08          --------------------------------------------------
A0A2R9BS98_BMF-01      -----------------ttcagtgcattgcagaccagttccaccggcttc
A0A2J8QDD5_BMF-02      -----------------ttcagtgcattgcagaccagttccaccggcttc
                                                                         

A0A672RK14_BMF-01      atcttcag------------------------------------------
A0A673JJ10_BMF-01      atcttcag------------------------------------------
A0A3B4UNJ0_BMF-01      atttcatg------------------------------------------
W5N4P7_BMF-01          atctcca-------------------------------------------
A3KND0_BMF-01          at------------------------------------------------
Q0GKC7_BMF-01          acatcatg------------------------------------------
A0A671M0H4_BMF-01      acatgatggtgagtcgggtcgggtcaggagatcctgtgaacgtgttttct
A0A671M0H4_BMF-02      acatgatggtgagtcgggtcgggtcaggagatcctgtgaacgtgttttct
A0A671MNR9_BMF-01      acatgatg------------------------------------------
A0A672JWL9_BMF-01      acatgatg------------------------------------------
A0A672JWL9_BMF-02      ----------ga--------------------------------------
A0A673HDR4_BMF-01      acatgatggtga--------------------------------------
A0A3B3RH63_BMF-01      aactccag------------------------------------------
K7FRX2_BMF-01          acatacag------------------------------------------
A0A452H3N6_BMF-01      acatacag------------------------------------------
A0A674IPL3_BMF-01      acatacag------------------------------------------
A0A493T7X1_BMF-01      ctgccctg------------------------------------------
A0A3Q2UCA0_BMF-01      acatacag------------------------------------------
A0A3Q2UCA0_BMF-02      acatacag------------------------------------------
A0A669PL85_BMF-02      acatacag------------------------------------------
A0A493T7X1_BMF-02      acatacag------------------------------------------
A0A3Q2UCA0_BMF-03      acatacag------------------------------------------
A0A3Q2UCA0_BMF-04      acatacag------------------------------------------
A9XRH0_BMF-01          acatacag------------------------------------------
G1NHG8_BMF-01          acatacag------------------------------------------
A0A669PL85_BMF-01      acatacag------------------------------------------
U3JS06_BMF-01          acatacag------------------------------------------
A0A674GIP8_BMF-03      acattcag------------------------------------------
A0A674GIP8_BMF-01      acattcag------------------------------------------
A0A674GIP8_BMF-02      acattcag------------------------------------------
A0A672V891_BMF-01      acatgcag------------------------------------------
A0A663DZQ4_BMF-01      acatacag------------------------------------------
A0A663MPI8_BMF-01      acatacag------------------------------------------
A0A670XMZ5_BMF-01      atctgcag------------------------------------------
H9GL49_BMF-01          acctacag------------------------------------------
A0A670JUU6_BMF-01      acctacag------------------------------------------
A0A670JUU6_BMF-05      acctacag------------------------------------------
A0A670JUU6_BMF-04      acctacag------------------------------------------
A0A670JUU6_BMF-02      acctacag------------------------------------------
A0A670JUU6_BMF-03      acctacag------------------------------------------
A0A4W3JXA1_BMF-01      gcatggag------------------------------------------
A0A3Q2CXC4_BMF-01      acttacaa------------------------------------------
A0A3Q2CXC4_BMF-02      acttacaa------------------------------------------
A0A3B5QK08_BMF-01      acttacaa------------------------------------------
A0A3B5QK08_BMF-02      acttacaa------------------------------------------
A0A096LRV0_BMF-01      acttacaa------------------------------------------
A0A3B3WU80_BMF-01      acttacaa------------------------------------------
A0A3P9Q8E2_BMF-01      acttacaa------------------------------------------
A0A3Q2PJX9_BMF-01      acttacaa------------------------------------------
A0A3Q2PJX9_BMF-03      acttacaa------------------------------------------
A0A3Q2PJX9_BMF-02      acttacaa------------------------------------------
A0A3Q2YCX7_BMF-01      acttacag------------------------------------------
A0A3Q2YCX7_BMF-02      acttacag------------------------------------------
A0A3B5KWG6_BMF-02      gcgttcaa------------------------------------------
A0A3B5KWG6_BMF-01      gcgttcaa------------------------------------------
A0A3B5KWG6_BMF-03      gcgttcaa------------------------------------------
A0A3B3CGR9_BMF-01      gcctacaa------------------------------------------
A0A3P9K487_BMF-01      gcctacaa------------------------------------------
A0A3P9K487_BMF-02      gcctacaa------------------------------------------
A0A3B3HAU1_BMF-01      gcctacaa------------------------------------------
A0A3B3HAU1_BMF-02      gcctacaa------------------------------------------
A0A3B3HAU1_BMF-03      gcctacaa------------------------------------------
A0A3B3HAU1_BMF-04      gcctacaa------------------------------------------
A0A3P9ICE1_BMF-04      gcctacaa------------------------------------------
A0A3P9ICE1_BMF-01      gcctacaa------------------------------------------
A0A3P9ICE1_BMF-02      gcctacaa------------------------------------------
A0A3P9ICE1_BMF-03      gcctacaa------------------------------------------
A0A3P9ICE1_BMF-05      gcctacaa------------------------------------------
A0A3P8NFE2_BMF-02      gcctgcaa------------------------------------------
A0A668TQU8_BMF-01      gcctgcaa------------------------------------------
I3K2D6_BMF-01          gcctgcaa------------------------------------------
A0A3Q4G1I4_BMF-01      gcctgcaa------------------------------------------
A0A3P8NFE2_BMF-01      gcctgcaa------------------------------------------
A0A3P9DPJ5_BMF-01      gcctgcaa------------------------------------------
A0A3P9DPJ5_BMF-02      gcctgcaa------------------------------------------
A0A3B4ETH0_BMF-01      gcctgcaa------------------------------------------
A0A3Q3C5V2_BMF-01      gcctgcaa------------------------------------------
A0A672HG10_BMF-01      acctgcaa------------------------------------------
A0A3P8UA78_BMF-02      atctgcag------------------------------------------
A0A3P8UA78_BMF-01      atctgcag------------------------------------------
A0A3P8UA78_BMF-03      atctgcag------------------------------------------
A0A3Q3GUU5_BMF-01      acttacaa------------------------------------------
A0A3Q3VLX6_BMF-01      acatgcaa------------------------------------------
A0A3Q2ZA20_BMF-01      acttgcag------------------------------------------
A0A667YNR9_BMF-01      atctacaa------------------------------------------
A0A3Q3LME3_BMF-01      acttgcaa------------------------------------------
A0A3Q3LME3_BMF-02      acttgcaa------------------------------------------
A0A3Q3LME3_BMF-03      acttgcaa------------------------------------------
A0A3Q1IPR4_BMF-01      acctacaa------------------------------------------
A0A3Q3QZ16_BMF-01      acctacag------------------------------------------
A0A3Q3QZ16_BMF-02      acctacag------------------------------------------
A0A665VG08_BMF-01      acctacaa------------------------------------------
A0A673C8N3_BMF-01      acctacaa------------------------------------------
A0A3Q1FVH7_BMF-01      acctacaa------------------------------------------
A0A3Q1FVH7_BMF-02      acctacaa------------------------------------------
A0A3B5B8F6_BMF-01      acctacaa------------------------------------------
A0A3Q1D1K3_BMF-01      acctacaa------------------------------------------
A0A3P8RKY9_BMF-01      acctacaa------------------------------------------
A0A671X848_BMF-01      acctacaa------------------------------------------
A0A0F8AD62_BMF-01      acctacaa------------------------------------------
A0A4W6DUL1_BMF-01      acctacaa------------------------------------------
A0A2U9CJH3_BMF-01      acctacaa------------------------------------------
A0A3B4U5H8_BMF-01      acctacaa------------------------------------------
A0A3B4WM88_BMF-01      acctacaa------------------------------------------
A0A3P8ZIE7_BMF-01      atctgcaa------------------------------------------
A0A4W5N3A7_BMF-01      accttcaa------------------------------------------
A0A6F9BGV6_BMF-01      accttcaa------------------------------------------
A0A1S3SNN2_BMF-01      accttcaa------------------------------------------
A0A674EF64_BMF-01      accttcaa------------------------------------------
A0A1S3P5K4_BMF-01      atgttcaa------------------------------------------
A0A6F9B4C5_BMF-01      accttcaa------------------------------------------
A0A4W5N721_BMF-01      accttcaa------------------------------------------
A0A1S3P5K4_BMF-02      atgttcaa------------------------------------------
A0A673YQV3_BMF-01      acgttcaa------------------------------------------
A0A4W4DZH9_BMF-01      acatgctg------------------------------------------
A0A3B4CNJ8_BMF-01      acatgctg------------------------------------------
A0A3B1K1X5_BMF-01      acatgctg------------------------------------------
A0A3B4B6Y3_BMF-01      --------------------------------------------------
A0A6I8NF73_BMF-01      atacccag------------------------------------------
A0A5F8GKJ8_BMF-01      acatgcag------------------------------------------
G3WDQ2_BMF-01          acatgcag------------------------------------------
A0A4X2KLG2_BMF-01      acatgcag------------------------------------------
Q8K589_BMF-01          atatgcaa------------------------------------------
Q91ZE9_BMF-02          atacgcaa------------------------------------------
Q91ZE9_BMF-01          atacgcaa------------------------------------------
Q91ZE9_BMF-06          atacgcaa------------------------------------------
A0A287CXH0_BMF-01      atatgcag------------------------------------------
A0A287CXH0_BMF-02      atatgcag------------------------------------------
A0A671DWL6_BMF-01      atatgcag------------------------------------------
A0A671DWL6_BMF-02      atatgcag------------------------------------------
A0A2K6FFN3_BMF-01      atgtgcag------------------------------------------
A0A2K6FFN3_BMF-02      --------------------------------------------------
A0A673TA87_BMF-01      atatgcag------------------------------------------
L8IXF5_BMF-01          atatgcag------------------------------------------
A0A4W2EII1_BMF-01      atatgcag------------------------------------------
A0A4W2EII1_BMF-01      atatgcag------------------------------------------
Q05KI3_BMF-01          atatgcag------------------------------------------
Q05KI3_BMF-02          atatgcag------------------------------------------
A0A4W2INA4_BMF-01      atatgcag------------------------------------------
A0A4W2INA4_BMF-01      atatgcag------------------------------------------
A0A452F2E0_BMF-01      atatgcag------------------------------------------
A0A452F2E0_BMF-02      atatgcag------------------------------------------
W5QFV1_BMF-01          atatgcag------------------------------------------
H0WYH6_BMF-01          atgtgcag------------------------------------------
A0A337ST43_BMF-02      --------------------------------------------------
A0A337ST43_BMF-03      atatgcag------------------------------------------
A0A337ST43_BMF-05      atatgcag------------------------------------------
A0A337ST43_BMF-01      atatgcag------------------------------------------
A0A337ST43_BMF-04      atatgcag------------------------------------------
A0A667H967_BMF-01      atatgcag------------------------------------------
M3YAD5_BMF-01          acatgcag------------------------------------------
U6CSY8_BMF-01          acatgcag------------------------------------------
A0A452SED0_BMF-01      acatgcag------------------------------------------
A0A384D070_BMF-01      acatgcag------------------------------------------
A0A5F4CJ04_BMF-04      acatgcag------------------------------------------
A0A5F4CJ04_BMF-03      acatgcag------------------------------------------
A0A5F4CJ04_BMF-01      acatgcag------------------------------------------
A0A5F4CJ04_BMF-02      acatgcag------------------------------------------
A0A4X1UQ42_BMF-01      atatgcag------------------------------------------
A0A4X1UQ42_BMF-02      atatgcag------------------------------------------
A0A287AIU8_BMF-01      atatgcag------------------------------------------
A0A287AIU8_BMF-02      atatgcag------------------------------------------
A0A3Q2HR24_BMF-01      atatgcag------------------------------------------
A0A3Q2HR24_BMF-02      atatgcag------------------------------------------
G1SR62_BMF-01          atttacag------------------------------------------
A0A286XXB0_BMF-03      acattcaa------------------------------------------
A0A286XXB0_BMF-01      acattcaa------------------------------------------
A0A286XXB0_BMF-02      acattcaa------------------------------------------
A0A2K5KGP2_BMF-01      --------------------------------------------------
A0A0D9R4R5_BMF-01      atgtgcag------------------------------------------
A0A2K5VLE9_BMF-01      --------------------------------------------------
A0A2K5VLE9_BMF-02      atgtgcag------------------------------------------
A0A096NTE9_BMF-02      atgtgcag------------------------------------------
A0A096NTE9_BMF-01      atgtgcag------------------------------------------
A0A096NTE9_BMF-03      --------------------------------------------------
A0A5F7ZML1_BMF-01      atgtgcag------------------------------------------
A0A5F7ZML1_BMF-02      atgtgcag------------------------------------------
A0A5F7ZML1_BMF-03      atgtgcag------------------------------------------
A0A2K5MJW4_BMF-01      --------------------------------------------------
A0A2K6B5F6_BMF-03      --------------------------------------------------
A0A2K5Z4A9_BMF-02      --------------------------------------------------
A0A2K5MJW4_BMF-02      atgtgcag------------------------------------------
A0A2K6B5F6_BMF-01      atgtgcag------------------------------------------
A0A2K6B5F6_BMF-02      atgtgcag------------------------------------------
A0A2K6B5F6_BMF-04      atgtgcag------------------------------------------
A0A2K5Z4A9_BMF-01      atgtgcag------------------------------------------
A0A2K5KGP2_BMF-02      atgtgcag------------------------------------------
A0A2K6RAW1_BMF-02      --------------------------------------------------
A0A2K6RAW1_BMF-01      atgtgcag------------------------------------------
A0A2K6L919_BMF-01      atgtgcag------------------------------------------
A0A2K6L919_BMF-03      atgtgcag------------------------------------------
A0A2K6L919_BMF-02      atgtgcag------------------------------------------
A0A2U4BC98_BMF-01      atatgcag------------------------------------------
G1PAU1_BMF-01          aaatgcag------------------------------------------
A0A2I3HD83_BMF-01      --------------------------------------------------
A0A2K6TW78_BMF-03      --------------------------------------------------
A0A2K6TW78_BMF-02      atgtgcag------------------------------------------
A0A2K6TW78_BMF-01      atgtgcag------------------------------------------
A0A2J8T301_BMF-01      atgtgcag------------------------------------------
G3T7Z4_BMF-01          atatgcag------------------------------------------
A0A2K5RN49_BMF-02      --------------------------------------------------
A0A2K5RN49_BMF-01      atgtgcag------------------------------------------
F7HZL0_BMF-01          atgtgcag------------------------------------------
A0A2K5E1Q4_BMF-02      --------------------------------------------------
A0A2K5E1Q4_BMF-01      atgtgcag------------------------------------------
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          atgtgcag------------------------------------------
Q96LC9_BMF-02          atgtgcag------------------------------------------
Q96LC9_BMF-03          atgtgcag------------------------------------------
Q96LC9_BMF-04          atgtgcag------------------------------------------
A0A2J8QDD5_BMF-01      --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
Q96LC9_BMF-06          --------------------------------------------------
A0A2I2Z168_BMF-02      --------------------------------------------------
A0A2I2Z168_BMF-01      atgtgcag------------------------------------------
Q96LC9_BMF-08          --------------------------------------------------
A0A2R9BS98_BMF-01      atgtgcag------------------------------------------
A0A2J8QDD5_BMF-02      atgtgcag------------------------------------------
                                                                         

A0A672RK14_BMF-01      ------------------------------------------ct------
A0A673JJ10_BMF-01      ------------------------------------------ct------
A0A3B4UNJ0_BMF-01      --------------------------------------------------
W5N4P7_BMF-01          ------------------------------------------ca------
A3KND0_BMF-01          --------------------------------------------------
Q0GKC7_BMF-01          ------------------------------------------ca------
A0A671M0H4_BMF-01      gtgcgctggatcataatcgcattatgtcttgctttagcgctcgt------
A0A671M0H4_BMF-02      gtgcgctggatcataatcgcattatgtcttgctttagcgctcgt------
A0A671MNR9_BMF-01      ------------------------------------------ca------
A0A672JWL9_BMF-01      ------------------------------------------ca------
A0A672JWL9_BMF-02      -------------------------------------cgctcct------
A0A673HDR4_BMF-01      -------------------------------------cgctcct------
A0A3B3RH63_BMF-01      ------------------------------------------tt------
K7FRX2_BMF-01          ------------------------------------------ag------
A0A452H3N6_BMF-01      ------------------------------------------ag------
A0A674IPL3_BMF-01      ------------------------------------------ag------
A0A493T7X1_BMF-01      ------------------------------------------cg------
A0A3Q2UCA0_BMF-01      ------------------------------------------cg------
A0A3Q2UCA0_BMF-02      ------------------------------------------cg------
A0A669PL85_BMF-02      ------------------------------------------cg------
A0A493T7X1_BMF-02      ------------------------------------------ag------
A0A3Q2UCA0_BMF-03      ------------------------------------------cg------
A0A3Q2UCA0_BMF-04      ------------------------------------------cg------
A9XRH0_BMF-01          ------------------------------------------cg------
G1NHG8_BMF-01          ------------------------------------------cg------
A0A669PL85_BMF-01      ------------------------------------------cg------
U3JS06_BMF-01          ------------------------------------------ag------
A0A674GIP8_BMF-03      ------------------------------------------ag------
A0A674GIP8_BMF-01      ------------------------------------------ag------
A0A674GIP8_BMF-02      ------------------------------------------ag------
A0A672V891_BMF-01      ------------------------------------------ag------
A0A663DZQ4_BMF-01      ------------------------------------------ag------
A0A663MPI8_BMF-01      ------------------------------------------ag------
A0A670XMZ5_BMF-01      ------------------------------------------ag------
H9GL49_BMF-01          ------------------------------------------ag------
A0A670JUU6_BMF-01      ------------------------------------------ag------
A0A670JUU6_BMF-05      ------------------------------------------ag------
A0A670JUU6_BMF-04      ------------------------------------------aggatttg
A0A670JUU6_BMF-02      ------------------------------------------aggatttg
A0A670JUU6_BMF-03      ------------------------------------------ag------
A0A4W3JXA1_BMF-01      ------------------------------------------ag------
A0A3Q2CXC4_BMF-01      ------------------------------------------ca------
A0A3Q2CXC4_BMF-02      ------------------------------------------ca------
A0A3B5QK08_BMF-01      ------------------------------------------ca------
A0A3B5QK08_BMF-02      ------------------------------------------ca------
A0A096LRV0_BMF-01      ------------------------------------------ca------
A0A3B3WU80_BMF-01      ------------------------------------------ca------
A0A3P9Q8E2_BMF-01      ------------------------------------------ca------
A0A3Q2PJX9_BMF-01      ------------------------------------------ca------
A0A3Q2PJX9_BMF-03      ------------------------------------------ca------
A0A3Q2PJX9_BMF-02      ------------------------------------------ca------
A0A3Q2YCX7_BMF-01      ------------------------------------------ct------
A0A3Q2YCX7_BMF-02      ------------------------------------------ct------
A0A3B5KWG6_BMF-02      ------------------------------------------tt------
A0A3B5KWG6_BMF-01      ------------------------------------------tt------
A0A3B5KWG6_BMF-03      ------------------------------------------tt------
A0A3B3CGR9_BMF-01      ------------------------------------------ct------
A0A3P9K487_BMF-01      ------------------------------------------ct------
A0A3P9K487_BMF-02      ------------------------------------------ct------
A0A3B3HAU1_BMF-01      ------------------------------------------ct------
A0A3B3HAU1_BMF-02      ------------------------------------------ct------
A0A3B3HAU1_BMF-03      ------------------------------------------ct------
A0A3B3HAU1_BMF-04      ------------------------------------------ct------
A0A3P9ICE1_BMF-04      ------------------------------------------ct------
A0A3P9ICE1_BMF-01      ------------------------------------------ct------
A0A3P9ICE1_BMF-02      ------------------------------------------ct------
A0A3P9ICE1_BMF-03      ------------------------------------------ct------
A0A3P9ICE1_BMF-05      ------------------------------------------ct------
A0A3P8NFE2_BMF-02      ------------------------------------------ct------
A0A668TQU8_BMF-01      ------------------------------------------ct------
I3K2D6_BMF-01          ------------------------------------------ct------
A0A3Q4G1I4_BMF-01      ------------------------------------------ct------
A0A3P8NFE2_BMF-01      ------------------------------------------ct------
A0A3P9DPJ5_BMF-01      ------------------------------------------ct------
A0A3P9DPJ5_BMF-02      ------------------------------------------ct------
A0A3B4ETH0_BMF-01      ------------------------------------------ct------
A0A3Q3C5V2_BMF-01      ------------------------------------------ct------
A0A672HG10_BMF-01      ------------------------------------------ct------
A0A3P8UA78_BMF-02      ------------------------------------------ct------
A0A3P8UA78_BMF-01      ------------------------------------------ct------
A0A3P8UA78_BMF-03      ------------------------------------------ct------
A0A3Q3GUU5_BMF-01      ------------------------------------------ct------
A0A3Q3VLX6_BMF-01      ------------------------------------------ct------
A0A3Q2ZA20_BMF-01      ------------------------------------------ca------
A0A667YNR9_BMF-01      ------------------------------------------ct------
A0A3Q3LME3_BMF-01      ------------------------------------------ct------
A0A3Q3LME3_BMF-02      ------------------------------------------ct------
A0A3Q3LME3_BMF-03      ------------------------------------------ct------
A0A3Q1IPR4_BMF-01      ------------------------------------------ct------
A0A3Q3QZ16_BMF-01      ------------------------------------------ct------
A0A3Q3QZ16_BMF-02      ------------------------------------------ct------
A0A665VG08_BMF-01      ------------------------------------------ct------
A0A673C8N3_BMF-01      ------------------------------------------ct------
A0A3Q1FVH7_BMF-01      ------------------------------------------ct------
A0A3Q1FVH7_BMF-02      ------------------------------------------ct------
A0A3B5B8F6_BMF-01      ------------------------------------------ct------
A0A3Q1D1K3_BMF-01      ------------------------------------------ct------
A0A3P8RKY9_BMF-01      ------------------------------------------ct------
A0A671X848_BMF-01      ------------------------------------------ct------
A0A0F8AD62_BMF-01      ------------------------------------------ct------
A0A4W6DUL1_BMF-01      ------------------------------------------ct------
A0A2U9CJH3_BMF-01      ------------------------------------------ct------
A0A3B4U5H8_BMF-01      ------------------------------------------ct------
A0A3B4WM88_BMF-01      ------------------------------------------ct------
A0A3P8ZIE7_BMF-01      ------------------------------------------ct------
A0A4W5N3A7_BMF-01      ------------------------------------------ct------
A0A6F9BGV6_BMF-01      ------------------------------------------ct------
A0A1S3SNN2_BMF-01      ------------------------------------------ct------
A0A674EF64_BMF-01      ------------------------------------------ct------
A0A1S3P5K4_BMF-01      ------------------------------------------gt------
A0A6F9B4C5_BMF-01      ------------------------------------------ct------
A0A4W5N721_BMF-01      ------------------------------------------gt------
A0A1S3P5K4_BMF-02      ------------------------------------------gt------
A0A673YQV3_BMF-01      ------------------------------------------gt------
A0A4W4DZH9_BMF-01      ------------------------------------------ca------
A0A3B4CNJ8_BMF-01      ------------------------------------------ca------
A0A3B1K1X5_BMF-01      ------------------------------------------ca------
A0A3B4B6Y3_BMF-01      --------------------------------------------------
A0A6I8NF73_BMF-01      ------------------------------------------cg------
A0A5F8GKJ8_BMF-01      ------------------------------------------cg------
G3WDQ2_BMF-01          ------------------------------------------cg------
A0A4X2KLG2_BMF-01      ------------------------------------------cg------
Q8K589_BMF-01          ------------------------------------------ca------
Q91ZE9_BMF-02          ------------------------------------------ca------
Q91ZE9_BMF-01          ------------------------------------------ca------
Q91ZE9_BMF-06          ------------------------------------------ca------
A0A287CXH0_BMF-01      ------------------------------------------ca------
A0A287CXH0_BMF-02      ------------------------------------------ca------
A0A671DWL6_BMF-01      ------------------------------------------ca------
A0A671DWL6_BMF-02      ------------------------------------------ca------
A0A2K6FFN3_BMF-01      ------------------------------------------ca------
A0A2K6FFN3_BMF-02      --------------------------------------------------
A0A673TA87_BMF-01      ------------------------------------------ca------
L8IXF5_BMF-01          ------------------------------------------ca------
A0A4W2EII1_BMF-01      ------------------------------------------ca------
A0A4W2EII1_BMF-01      ------------------------------------------ca------
Q05KI3_BMF-01          ------------------------------------------ca------
Q05KI3_BMF-02          ------------------------------------------ca------
A0A4W2INA4_BMF-01      ------------------------------------------ca------
A0A4W2INA4_BMF-01      ------------------------------------------ca------
A0A452F2E0_BMF-01      ------------------------------------------ca------
A0A452F2E0_BMF-02      ------------------------------------------ca------
W5QFV1_BMF-01          ------------------------------------------ca------
H0WYH6_BMF-01          ------------------------------------------ca------
A0A337ST43_BMF-02      --------------------------------------------------
A0A337ST43_BMF-03      ------------------------------------------ca------
A0A337ST43_BMF-05      ------------------------------------------ca------
A0A337ST43_BMF-01      ------------------------------------------ca------
A0A337ST43_BMF-04      ------------------------------------------ca------
A0A667H967_BMF-01      ------------------------------------------ca------
M3YAD5_BMF-01          ------------------------------------------ca------
U6CSY8_BMF-01          ------------------------------------------ca------
A0A452SED0_BMF-01      ------------------------------------------ca------
A0A384D070_BMF-01      ------------------------------------------ca------
A0A5F4CJ04_BMF-04      ------------------------------------------ca------
A0A5F4CJ04_BMF-03      ------------------------------------------ca------
A0A5F4CJ04_BMF-01      ------------------------------------------ca------
A0A5F4CJ04_BMF-02      ------------------------------------------ca------
A0A4X1UQ42_BMF-01      ------------------------------------------ca------
A0A4X1UQ42_BMF-02      ------------------------------------------ca------
A0A287AIU8_BMF-01      ------------------------------------------ca------
A0A287AIU8_BMF-02      ------------------------------------------ca------
A0A3Q2HR24_BMF-01      ------------------------------------------ca------
A0A3Q2HR24_BMF-02      ------------------------------------------ca------
G1SR62_BMF-01          ------------------------------------------ca------
A0A286XXB0_BMF-03      ------------------------------------------ca------
A0A286XXB0_BMF-01      ------------------------------------------ca------
A0A286XXB0_BMF-02      ------------------------------------------ca------
A0A2K5KGP2_BMF-01      --------------------------------------------------
A0A0D9R4R5_BMF-01      ------------------------------------------ca------
A0A2K5VLE9_BMF-01      --------------------------------------------------
A0A2K5VLE9_BMF-02      ------------------------------------------ca------
A0A096NTE9_BMF-02      ------------------------------------------ca------
A0A096NTE9_BMF-01      ------------------------------------------ca------
A0A096NTE9_BMF-03      --------------------------------------------------
A0A5F7ZML1_BMF-01      ------------------------------------------ca------
A0A5F7ZML1_BMF-02      ------------------------------------------ca------
A0A5F7ZML1_BMF-03      ------------------------------------------ca------
A0A2K5MJW4_BMF-01      --------------------------------------------------
A0A2K6B5F6_BMF-03      --------------------------------------------------
A0A2K5Z4A9_BMF-02      --------------------------------------------------
A0A2K5MJW4_BMF-02      ------------------------------------------ca------
A0A2K6B5F6_BMF-01      ------------------------------------------ca------
A0A2K6B5F6_BMF-02      ------------------------------------------ca------
A0A2K6B5F6_BMF-04      ------------------------------------------ca------
A0A2K5Z4A9_BMF-01      ------------------------------------------ca------
A0A2K5KGP2_BMF-02      ------------------------------------------ca------
A0A2K6RAW1_BMF-02      --------------------------------------------------
A0A2K6RAW1_BMF-01      ------------------------------------------ca------
A0A2K6L919_BMF-01      ------------------------------------------ca------
A0A2K6L919_BMF-03      ------------------------------------------ca------
A0A2K6L919_BMF-02      ------------------------------------------ca------
A0A2U4BC98_BMF-01      ------------------------------------------ca------
G1PAU1_BMF-01          ------------------------------------------ca------
A0A2I3HD83_BMF-01      --------------------------------------------------
A0A2K6TW78_BMF-03      --------------------------------------------------
A0A2K6TW78_BMF-02      ------------------------------------------ca------
A0A2K6TW78_BMF-01      ------------------------------------------ca------
A0A2J8T301_BMF-01      ------------------------------------------ca------
G3T7Z4_BMF-01          ------------------------------------------cg------
A0A2K5RN49_BMF-02      --------------------------------------------------
A0A2K5RN49_BMF-01      ------------------------------------------ca------
F7HZL0_BMF-01          ------------------------------------------ca------
A0A2K5E1Q4_BMF-02      --------------------------------------------------
A0A2K5E1Q4_BMF-01      ------------------------------------------ca------
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          ------------------------------------------ca------
Q96LC9_BMF-02          ------------------------------------------ca------
Q96LC9_BMF-03          ------------------------------------------ca------
Q96LC9_BMF-04          ------------------------------------------ca------
A0A2J8QDD5_BMF-01      --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
Q96LC9_BMF-06          --------------------------------------------------
A0A2I2Z168_BMF-02      --------------------------------------------------
A0A2I2Z168_BMF-01      ------------------------------------------ca------
Q96LC9_BMF-08          --------------------------------------------------
A0A2R9BS98_BMF-01      ------------------------------------------ca------
A0A2J8QDD5_BMF-02      ------------------------------------------ca------
                                                                         

A0A672RK14_BMF-01      --------------------------------------------------
A0A673JJ10_BMF-01      --------------------------------------------------
A0A3B4UNJ0_BMF-01      --------------------------------------------------
W5N4P7_BMF-01          --------------------------------------------------
A3KND0_BMF-01          --------------------------------------------------
Q0GKC7_BMF-01          --------------------------------------------------
A0A671M0H4_BMF-01      --------------------------------------------------
A0A671M0H4_BMF-02      --------------------------------------------------
A0A671MNR9_BMF-01      --------------------------------------------------
A0A672JWL9_BMF-01      --------------------------------------------------
A0A672JWL9_BMF-02      --------------------------------------------------
A0A673HDR4_BMF-01      --------------------------------------------------
A0A3B3RH63_BMF-01      --------------------------------------------------
K7FRX2_BMF-01          --------------------------------------------------
A0A452H3N6_BMF-01      --------------------------------------------------
A0A674IPL3_BMF-01      --------------------------------------------------
A0A493T7X1_BMF-01      --------------------------------------------------
A0A3Q2UCA0_BMF-01      --------------------------------------------------
A0A3Q2UCA0_BMF-02      --------------------------------------------------
A0A669PL85_BMF-02      --------------------------------------------------
A0A493T7X1_BMF-02      --------------------------------------------------
A0A3Q2UCA0_BMF-03      --------------------------------------------------
A0A3Q2UCA0_BMF-04      --------------------------------------------------
A9XRH0_BMF-01          --------------------------------------------------
G1NHG8_BMF-01          --------------------------------------------------
A0A669PL85_BMF-01      --------------------------------------------------
U3JS06_BMF-01          --------------------------------------------------
A0A674GIP8_BMF-03      --------------------------------------------------
A0A674GIP8_BMF-01      --------------------------------------------------
A0A674GIP8_BMF-02      --------------------------------------------------
A0A672V891_BMF-01      --------------------------------------------------
A0A663DZQ4_BMF-01      --------------------------------------------------
A0A663MPI8_BMF-01      --------------------------------------------------
A0A670XMZ5_BMF-01      --------------------------------------------------
H9GL49_BMF-01          --------------------------------------------------
A0A670JUU6_BMF-01      --------------------------------------------------
A0A670JUU6_BMF-05      --------------------------------------------------
A0A670JUU6_BMF-04      catgaaggatctgcattttccactgctgtctgtgaagattaaggtccgtt
A0A670JUU6_BMF-02      catgaaggatctgcattttccactgctgtctgtgaagattaaggtccgtt
A0A670JUU6_BMF-03      --------------------------------------------------
A0A4W3JXA1_BMF-01      ----------------------------------g---------------
A0A3Q2CXC4_BMF-01      ----------------------------------g---------------
A0A3Q2CXC4_BMF-02      ----------------------------------gatcccaggacagccc
A0A3B5QK08_BMF-01      ----------------------------------g---------------
A0A3B5QK08_BMF-02      ----------------------------------g---------------
A0A096LRV0_BMF-01      ----------------------------------g---------------
A0A3B3WU80_BMF-01      ----------------------------------g---------------
A0A3P9Q8E2_BMF-01      ----------------------------------g---------------
A0A3Q2PJX9_BMF-01      ----------------------------------g---------------
A0A3Q2PJX9_BMF-03      ----------------------------------g---------------
A0A3Q2PJX9_BMF-02      ----------------------------------g--------agaggct
A0A3Q2YCX7_BMF-01      ----------------------------------g---------------
A0A3Q2YCX7_BMF-02      ----------------------------------g---------------
A0A3B5KWG6_BMF-02      ----------------------------------g---------------
A0A3B5KWG6_BMF-01      ----------------------------------g---------------
A0A3B5KWG6_BMF-03      ----------------------------------g---------------
A0A3B3CGR9_BMF-01      ----------------------------------g---------------
A0A3P9K487_BMF-01      ----------------------------------g---------------
A0A3P9K487_BMF-02      ----------------------------------g---------------
A0A3B3HAU1_BMF-01      ----------------------------------g---------------
A0A3B3HAU1_BMF-02      ----------------------------------g---------------
A0A3B3HAU1_BMF-03      ----------------------------------g---------------
A0A3B3HAU1_BMF-04      ----------------------------------g---------------
A0A3P9ICE1_BMF-04      ----------------------------------g---------------
A0A3P9ICE1_BMF-01      ----------------------------------g---------------
A0A3P9ICE1_BMF-02      ----------------------------------g---------------
A0A3P9ICE1_BMF-03      ----------------------------------g---------------
A0A3P9ICE1_BMF-05      ----------------------------------g---------------
A0A3P8NFE2_BMF-02      ----------------------------------g---------------
A0A668TQU8_BMF-01      --------------------------------------------------
I3K2D6_BMF-01          ----------------------------------g---------------
A0A3Q4G1I4_BMF-01      ----------------------------------g---------------
A0A3P8NFE2_BMF-01      ----------------------------------g---------------
A0A3P9DPJ5_BMF-01      ----------------------------------g---------------
A0A3P9DPJ5_BMF-02      ----------------------------------g---------------
A0A3B4ETH0_BMF-01      ----------------------------------g---------------
A0A3Q3C5V2_BMF-01      ----------------------------------g---------------
A0A672HG10_BMF-01      ----------------------------------g---------------
A0A3P8UA78_BMF-02      ----------------------------------g---------------
A0A3P8UA78_BMF-01      ----------------------------------g---------------
A0A3P8UA78_BMF-03      ----------------------------------g---------------
A0A3Q3GUU5_BMF-01      ----------------------------------g---------------
A0A3Q3VLX6_BMF-01      ----------------------------------g---------------
A0A3Q2ZA20_BMF-01      ----------------------------------g---------------
A0A667YNR9_BMF-01      ----------------------------------g---------------
A0A3Q3LME3_BMF-01      ----------------------------------g---------------
A0A3Q3LME3_BMF-02      ----------------------------------g---------------
A0A3Q3LME3_BMF-03      ----------------------------------g---------------
A0A3Q1IPR4_BMF-01      ----------------------------------g---------------
A0A3Q3QZ16_BMF-01      ----------------------------------g---------------
A0A3Q3QZ16_BMF-02      ----------------------------------g---------------
A0A665VG08_BMF-01      ----------------------------------g---------------
A0A673C8N3_BMF-01      ----------------------------------g---------------
A0A3Q1FVH7_BMF-01      ----------------------------------g---------------
A0A3Q1FVH7_BMF-02      ----------------------------------g---------------
A0A3B5B8F6_BMF-01      ----------------------------------g---------------
A0A3Q1D1K3_BMF-01      ----------------------------------g---------------
A0A3P8RKY9_BMF-01      ----------------------------------g---------------
A0A671X848_BMF-01      ----------------------------------g---------------
A0A0F8AD62_BMF-01      ----------------------------------g---------------
A0A4W6DUL1_BMF-01      ----------------------------------g---------------
A0A2U9CJH3_BMF-01      ----------------------------------g---------------
A0A3B4U5H8_BMF-01      ----------------------------------g---------------
A0A3B4WM88_BMF-01      ----------------------------------g---------------
A0A3P8ZIE7_BMF-01      ----------------------------------g---------------
A0A4W5N3A7_BMF-01      ----------------------------------g---------------
A0A6F9BGV6_BMF-01      ----------------------------------g---------------
A0A1S3SNN2_BMF-01      ----------------------------------g---------------
A0A674EF64_BMF-01      ----------------------------------g---------------
A0A1S3P5K4_BMF-01      ---ggtgagaatacccaacgtgactgactgcacag---------------
A0A6F9B4C5_BMF-01      ----------------------------------g---------------
A0A4W5N721_BMF-01      ----------------------------------g---------------
A0A1S3P5K4_BMF-02      ----------------------------------g---------------
A0A673YQV3_BMF-01      ----------------------------------g---------------
A0A4W4DZH9_BMF-01      ----------------------------------a---------------
A0A3B4CNJ8_BMF-01      ----------------------------------a---------------
A0A3B1K1X5_BMF-01      ----------------------------------a---------------
A0A3B4B6Y3_BMF-01      --------------------------------------------------
A0A6I8NF73_BMF-01      ----------------------------------g---------------
A0A5F8GKJ8_BMF-01      ----------------------------------g---------------
G3WDQ2_BMF-01          ----------------------------------g---------------
A0A4X2KLG2_BMF-01      ----------------------------------g---------------
Q8K589_BMF-01          ----------------------------------a---------------
Q91ZE9_BMF-02          ----------------------------------a---------------
Q91ZE9_BMF-01          ----------------------------------a---------------
Q91ZE9_BMF-06          ----------------------------------a---------------
A0A287CXH0_BMF-01      ----------------------------------a---------------
A0A287CXH0_BMF-02      ----------------------------------a---------------
A0A671DWL6_BMF-01      ----------------------------------a---------------
A0A671DWL6_BMF-02      ----------------------------------a---------------
A0A2K6FFN3_BMF-01      ----------------------------------a---------------
A0A2K6FFN3_BMF-02      --------------------------------------------------
A0A673TA87_BMF-01      ----------------------------------a---------------
L8IXF5_BMF-01          ----------------------------------a---------------
A0A4W2EII1_BMF-01      ----------------------------------a---------------
A0A4W2EII1_BMF-01      ----------------------------------a---------------
Q05KI3_BMF-01          ----------------------------------a---------------
Q05KI3_BMF-02          ----------------------------------a---------------
A0A4W2INA4_BMF-01      ----------------------------------a---------------
A0A4W2INA4_BMF-01      ----------------------------------a---------------
A0A452F2E0_BMF-01      ----------------------------------a---------------
A0A452F2E0_BMF-02      ----------------------------------a---------------
W5QFV1_BMF-01          ----------------------------------a---------------
H0WYH6_BMF-01          ----------------------------------a---------------
A0A337ST43_BMF-02      --------------------------------------------------
A0A337ST43_BMF-03      --------------------------------------------------
A0A337ST43_BMF-05      --------------------------------------------------
A0A337ST43_BMF-01      ----------------------------------a---------------
A0A337ST43_BMF-04      ----------------------------------a---------------
A0A667H967_BMF-01      ----------------------------------a---------------
M3YAD5_BMF-01          ----------------------------------a---------------
U6CSY8_BMF-01          ----------------------------------a---------------
A0A452SED0_BMF-01      ----------------------------------a---------------
A0A384D070_BMF-01      ----------------------------------a---------------
A0A5F4CJ04_BMF-04      ----------------------------------a---------------
A0A5F4CJ04_BMF-03      ----------------------------------a---------------
A0A5F4CJ04_BMF-01      ----------------------------------a---------------
A0A5F4CJ04_BMF-02      ----------------------------------a---------------
A0A4X1UQ42_BMF-01      ----------------------------------g---------------
A0A4X1UQ42_BMF-02      ----------------------------------g---------------
A0A287AIU8_BMF-01      ----------------------------------g---------------
A0A287AIU8_BMF-02      ----------------------------------g---------------
A0A3Q2HR24_BMF-01      ----------------------------------a---------------
A0A3Q2HR24_BMF-02      ----------------------------------a---------------
G1SR62_BMF-01          ----------------------------------a---------------
A0A286XXB0_BMF-03      ----------------------------------a---------------
A0A286XXB0_BMF-01      ----------------------------------a---------------
A0A286XXB0_BMF-02      ----------------------------------a---------------
A0A2K5KGP2_BMF-01      --------------------------------------------------
A0A0D9R4R5_BMF-01      ----------------------------------a---------------
A0A2K5VLE9_BMF-01      --------------------------------------------------
A0A2K5VLE9_BMF-02      ----------------------------------a---------------
A0A096NTE9_BMF-02      ----------------------------------a---------------
A0A096NTE9_BMF-01      ----------------------------------a---------------
A0A096NTE9_BMF-03      --------------------------------------------------
A0A5F7ZML1_BMF-01      ----------------------------------a---------------
A0A5F7ZML1_BMF-02      ----------------------------------a---------------
A0A5F7ZML1_BMF-03      ----------------------------------a---------------
A0A2K5MJW4_BMF-01      --------------------------------------------------
A0A2K6B5F6_BMF-03      --------------------------------------------------
A0A2K5Z4A9_BMF-02      --------------------------------------------------
A0A2K5MJW4_BMF-02      ----------------------------------a---------------
A0A2K6B5F6_BMF-01      ----------------------------------a---------------
A0A2K6B5F6_BMF-02      ----------------------------------a---------------
A0A2K6B5F6_BMF-04      ----------------------------------a---------------
A0A2K5Z4A9_BMF-01      ----------------------------------a---------------
A0A2K5KGP2_BMF-02      ----------------------------------a---------------
A0A2K6RAW1_BMF-02      --------------------------------------------------
A0A2K6RAW1_BMF-01      ----------------------------------a---------------
A0A2K6L919_BMF-01      ----------------------------------a---------------
A0A2K6L919_BMF-03      ----------------------------------a---------------
A0A2K6L919_BMF-02      ----------------------------------a---------------
A0A2U4BC98_BMF-01      ----------------------------------a---------------
G1PAU1_BMF-01          ----------------------------------a---------------
A0A2I3HD83_BMF-01      --------------------------------------------------
A0A2K6TW78_BMF-03      --------------------------------------------------
A0A2K6TW78_BMF-02      ----------------------------------a---------------
A0A2K6TW78_BMF-01      ----------------------------------a---------------
A0A2J8T301_BMF-01      ----------------------------------a---------------
G3T7Z4_BMF-01          ----------------------------------g---------------
A0A2K5RN49_BMF-02      --------------------------------------------------
A0A2K5RN49_BMF-01      ----------------------------------a---------------
F7HZL0_BMF-01          ----------------------------------a---------------
A0A2K5E1Q4_BMF-02      --------------------------------------------------
A0A2K5E1Q4_BMF-01      ----------------------------------a---------------
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          ----------------------------------a---------------
Q96LC9_BMF-02          ----------------------------------a---------------
Q96LC9_BMF-03          ----------------------------------a---------------
Q96LC9_BMF-04          ----------------------------------a---------------
A0A2J8QDD5_BMF-01      --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
Q96LC9_BMF-06          --------------------------------------------------
A0A2I2Z168_BMF-02      --------------------------------------------------
A0A2I2Z168_BMF-01      ----------------------------------a---------------
Q96LC9_BMF-08          --------------------------------------------------
A0A2R9BS98_BMF-01      ----------------------------------a---------------
A0A2J8QDD5_BMF-02      ----------------------------------a---------------
                                                                         

A0A672RK14_BMF-01      ------------------ggtaagagtgatttcagatgaga----ct---
A0A673JJ10_BMF-01      ------------------ggtaatactgatttcagatgaga----ct---
A0A3B4UNJ0_BMF-01      ------------------aggcac--------cagagacaa--aacc---
W5N4P7_BMF-01          ----------tgtaccgcagaaac--------caaagga-a----cc---
A3KND0_BMF-01          ----------------------------------------a---------
Q0GKC7_BMF-01          --------------tcat--------------caaaggc-c----gc---
A0A671M0H4_BMF-01      --------------ttaca-------------caaaagc-gttttcc---
A0A671M0H4_BMF-02      --------------ttaca-------------caaaagc-gttttcc---
A0A671MNR9_BMF-01      --------------tcacagaaac--------caaagga-a----cc---
A0A672JWL9_BMF-01      --------------tcacagaaac--------caaagga-a----cc---
A0A672JWL9_BMF-02      --------------ttaca-------------caaaagt-g--ttcc---
A0A673HDR4_BMF-01      --------------ttaca-------------caaaagt-gttttcc---
A0A3B3RH63_BMF-01      -----------gtaccacagaaac--------caaagga-a----tc---
K7FRX2_BMF-01          ---------g-----------cat--------cagcaga-a----ca---
A0A452H3N6_BMF-01      ---------g-----------cat--------cagcaga-a----ca---
A0A674IPL3_BMF-01      ---------g-----------cat--------cagcaga-a----ca---
A0A493T7X1_BMF-01      ---------aggcagggagctcttgtccaacactgtcga-a----gg---
A0A3Q2UCA0_BMF-01      ---------ggtagggtgtttcca--------cagggga-a---------
A0A3Q2UCA0_BMF-02      ---------ggtagggtgtttcca--------cagggga-a---------
A0A669PL85_BMF-02      ---------ggtagggtgtttcct--------cagggga-a---------
A0A493T7X1_BMF-02      ---------g-----------cat--------cagcaga-a----ca---
A0A3Q2UCA0_BMF-03      ---------g-----------cat--------cagcaga-a----ca---
A0A3Q2UCA0_BMF-04      ---------g-----------cat--------cagcaga-a----ca---
A9XRH0_BMF-01          ---------g-----------cat--------cagcaga-a----ca---
G1NHG8_BMF-01          ---------g-----------cat--------cagcaga-a----ca---
A0A669PL85_BMF-01      ---------g-----------cat--------cagcaga-a----ca---
U3JS06_BMF-01          ---------g-----------cat--------cagcaga-a----ca---
A0A674GIP8_BMF-03      ---------g------------gt--------aggcaga-a----ca---
A0A674GIP8_BMF-01      ---------g-----------cat--------cagcaga-a----ca---
A0A674GIP8_BMF-02      ----------------------------------gcaga-a----ca---
A0A672V891_BMF-01      ---------g-----------cat--------cagcaga-a----ca---
A0A663DZQ4_BMF-01      ---------g-----------cat--------cagcaga-a----ca---
A0A663MPI8_BMF-01      ---------g-----------cat--------cagcaga-a----ca---
A0A670XMZ5_BMF-01      ---------g-----------cac--------cagcaga-a----ca---
H9GL49_BMF-01          ---------g-----------cac--------cagcaga-a----ca---
A0A670JUU6_BMF-01      ---------g-----------cac--------cagcaga-a----cc---
A0A670JUU6_BMF-05      ---------g-----------cac--------cagcaga-a----cc---
A0A670JUU6_BMF-04      ttcctccccg-----------tat--------cctcagc-a----cttgt
A0A670JUU6_BMF-02      ttcctccccg-----------tat--------cctcagc-a----cttgt
A0A670JUU6_BMF-03      --------------------------------------------------
A0A4W3JXA1_BMF-01      ------catcacaggatggaaaac--------cacgtgg-a----cc---
A0A3Q2CXC4_BMF-01      ----------ta--tcatcaaaac--------caaagga-a----tc---
A0A3Q2CXC4_BMF-02      ttcccccacctagttcaccaacac--------ca----------------
A0A3B5QK08_BMF-01      ----------ta--tcaacaaaac--------caaagga-a----tc---
A0A3B5QK08_BMF-02      ----------ta--tcaacaaaac--------caaagga-a----tc---
A0A096LRV0_BMF-01      ----------ta--ccaacaaaac--------caaagga-a----tc---
A0A3B3WU80_BMF-01      ----------ta--ccaacaaaac--------caaagga-a----tc---
A0A3P9Q8E2_BMF-01      ----------ta--tcaacaaaac--------caaagga-a----tc---
A0A3Q2PJX9_BMF-01      ----------ta--tcatcaaaac--------caaagga-a----tc---
A0A3Q2PJX9_BMF-03      ----------ta--tcatcaaaac--------caaagga-a----tc---
A0A3Q2PJX9_BMF-02      cttttcggtctt--ctcttgctgc--------aggagag-g----tt---
A0A3Q2YCX7_BMF-01      ----------gt--gagcaggaat--------caacaca-a----gc---
A0A3Q2YCX7_BMF-02      ----------gt--gagcaggaat--------caacaca-a----gc---
A0A3B5KWG6_BMF-02      ----------ta--tcagcgaaac--------caaagga-a----cc---
A0A3B5KWG6_BMF-01      ----------ta--tcagcgaaac--------caaagga-a----cc---
A0A3B5KWG6_BMF-03      ----------ta--tcagcgaaac--------caaagga-a----cc---
A0A3B3CGR9_BMF-01      ----------ta--tcatcaaaac--------caaagga-a----cc---
A0A3P9K487_BMF-01      ----------ta--tcatcgaaac--------caaagga-a----cc---
A0A3P9K487_BMF-02      ----------ta--tcatcgaaac--------caaagga-a----cc---
A0A3B3HAU1_BMF-01      ----------ta--tcatcgaaac--------caaagga-a----cc---
A0A3B3HAU1_BMF-02      ----------ta--tcatcgaaac--------caaagga-a----cc---
A0A3B3HAU1_BMF-03      ----------ta--tcatcgaaac--------caaagga-a----cc---
A0A3B3HAU1_BMF-04      ----------ta--tcatcgaaac--------caaagga-a----cc---
A0A3P9ICE1_BMF-04      ----------ta--tcatcgaaac--------caaagga-a----cc---
A0A3P9ICE1_BMF-01      ----------ta--tcatcgaaac--------caaagga-a----cc---
A0A3P9ICE1_BMF-02      ----------ta--tcatcgaaac--------caaagga-a----cc---
A0A3P9ICE1_BMF-03      ----------ta--tcatcgaaac--------caaagga-a----cc---
A0A3P9ICE1_BMF-05      ----------ta--tcatcgaaac--------caaagga-a----cc---
A0A3P8NFE2_BMF-02      -----------------gtgaaag--------caagtag-a----at---
A0A668TQU8_BMF-01      --------------------------------------------------
I3K2D6_BMF-01          ----------ta--tcaccgaaac--------caaagga-a----cc---
A0A3Q4G1I4_BMF-01      ----------ta--tcaacgaaac--------caaagga-a----cc---
A0A3P8NFE2_BMF-01      ----------ta--tcaccgaaac--------caaagga-a----cc---
A0A3P9DPJ5_BMF-01      ----------ta--tcaccgaaac--------caaagga-a----cc---
A0A3P9DPJ5_BMF-02      ----------ta--tcaccgaaac--------caaagga-a----cc---
A0A3B4ETH0_BMF-01      ----------ta--tcaccgaaac--------caaagga-a----cc---
A0A3Q3C5V2_BMF-01      ----------ta--tcaccgaaac--------caaagga-a----cc---
A0A672HG10_BMF-01      ----------ta--tcaccgaaac--------caaagga-a----cc---
A0A3P8UA78_BMF-02      ----------ta--tcatcgaaac--------caaagga-a----cc---
A0A3P8UA78_BMF-01      ----------ta--tcatcgaaac--------caaagga-a----cc---
A0A3P8UA78_BMF-03      ----------ta--tcatcgaaac--------caaagga-a----cc---
A0A3Q3GUU5_BMF-01      ----------ta--tcatcgaaac--------caaagga-a----cc---
A0A3Q3VLX6_BMF-01      ----------ta--tcatcgaaac--------caaagga-a----cc---
A0A3Q2ZA20_BMF-01      ----------ta--tcatcgaaac--------caaagga-a----cc---
A0A667YNR9_BMF-01      ----------ta--tcatcgaaac--------caaagga-a----cc---
A0A3Q3LME3_BMF-01      ----------caggttggctgggc--------gccagag-a----cg---
A0A3Q3LME3_BMF-02      ----------ta--tcatctaaac--------caaagga-a----cc---
A0A3Q3LME3_BMF-03      ----------ta--tcatctaaac--------caaagga-a----cc---
A0A3Q1IPR4_BMF-01      ----------ta--tcatcgaaac--------caaagga-a----cc---
A0A3Q3QZ16_BMF-01      ----------ta--tcatcgaaac--------caaagga-a----cc---
A0A3Q3QZ16_BMF-02      ----------ta--tcatcgaaac--------caaagga-a----cc---
A0A665VG08_BMF-01      ----------ta--tcatcaaaac--------caaagga-a----cc---
A0A673C8N3_BMF-01      ----------ta--tcatcgaaac--------caaagga-a----cc---
A0A3Q1FVH7_BMF-01      ----------ta--tcatcgaaac--------caaagga-a----cc---
A0A3Q1FVH7_BMF-02      ----------ta--tcatcgaaac--------caaagga-a----cc---
A0A3B5B8F6_BMF-01      ----------ta--tcatcgaaac--------caaagga-a----cc---
A0A3Q1D1K3_BMF-01      ----------ta--tcatcgaaac--------caaagga-a----cc---
A0A3P8RKY9_BMF-01      ----------ta--tcatcgaaac--------caaagga-a----cc---
A0A671X848_BMF-01      ----------ta--tcatcgaaac--------caaagga-a----cc---
A0A0F8AD62_BMF-01      ----------ta--tcatcgaaac--------caaagga-a----cc---
A0A4W6DUL1_BMF-01      ----------ta--tcatcgaaac--------caaagga-a----cc---
A0A2U9CJH3_BMF-01      ----------ta--tcatcgaaac--------caaagga-a----cc---
A0A3B4U5H8_BMF-01      ----------ta--tcatcaaaac--------caaagga-a----cc---
A0A3B4WM88_BMF-01      ----------ta--tcatcaaaac--------caaagga-a----cc---
A0A3P8ZIE7_BMF-01      ----------ta--tcacagaaac--------caaagga-a----cc---
A0A4W5N3A7_BMF-01      ----------ta--tcaccgaaac--------caaagga-a----ca---
A0A6F9BGV6_BMF-01      ----------ta--tcaccgaaac--------caaagga-a----ca---
A0A1S3SNN2_BMF-01      ----------ta--tcaccgaaac--------caaagga-a----ca---
A0A674EF64_BMF-01      ----------ta--tcaccgaaac--------caaagga-a----ca---
A0A1S3P5K4_BMF-01      ----------ca--cagctaaagc--------ccactga-a----ca---
A0A6F9B4C5_BMF-01      ----------ta--tcaccgaaac--------caaagga-a----ca---
A0A4W5N721_BMF-01      ----------ta--tcaccgaaac--------caaagga-a----ca---
A0A1S3P5K4_BMF-02      ----------ta--tcaccgaaac--------caaagaa-a----ca---
A0A673YQV3_BMF-01      ----------ta--tcaccgaaac--------caaagga-a----ca---
A0A4W4DZH9_BMF-01      ------caccgaaaccaaaggaac--------catcagcca----tt---
A0A3B4CNJ8_BMF-01      ------cacagaaaccaaaggaac--------cagcagccc----tt---
A0A3B1K1X5_BMF-01      ------cacagaaaccaaaggaac--------cagcagccg----ct---
A0A3B4B6Y3_BMF-01      ----------------------------------------a----cc---
A0A6I8NF73_BMF-01      ------c---------------ac--------caacgga-a----cc---
A0A5F8GKJ8_BMF-01      ------c---------------ac--------cagcaga-a----cc---
G3WDQ2_BMF-01          ------c---------------ac--------cagcaga-a----cc---
A0A4X2KLG2_BMF-01      ------c---------------ac--------cagcaga-a----cc---
Q8K589_BMF-01          ------c---------------ac--------cagcaga-a----cc---
Q91ZE9_BMF-02          ------c---------------ac--------cagcaga-a----cc---
Q91ZE9_BMF-01          ------c---------------ac--------cagcaga-a----cc---
Q91ZE9_BMF-06          ------c---------------ac--------cagcaga-a----cc---
A0A287CXH0_BMF-01      ------c---------------ac--------cagcaga-a----cc---
A0A287CXH0_BMF-02      ------c---------------ac--------cagcaga-a----cc---
A0A671DWL6_BMF-01      ------c---------------ac--------cagcaga-a----cc---
A0A671DWL6_BMF-02      ------c---------------ac--------cagcaga-a----cc---
A0A2K6FFN3_BMF-01      ------c---------------ac--------cagcaga-a----cc---
A0A2K6FFN3_BMF-02      ------c---------------ac--------cagcaga-a----cc---
A0A673TA87_BMF-01      ------c---------------ac--------cagcaaa-a----cc---
L8IXF5_BMF-01          ------t---------------ac--------cagcaga-a----cc---
A0A4W2EII1_BMF-01      ------t---------------ac--------cagcaga-a----cc---
A0A4W2EII1_BMF-01      ------t---------------ac--------cagcaga-a----cc---
Q05KI3_BMF-01          ------t---------------ac--------cagcaga-a----cc---
Q05KI3_BMF-02          ------t---------------ac--------cagcaga-a----cc---
A0A4W2INA4_BMF-01      ------t---------------ac--------cagcaga-a----cc---
A0A4W2INA4_BMF-01      ------t---------------ac--------cagcaga-a----cc---
A0A452F2E0_BMF-01      ------c---------------at--------cagcaga-a----cc---
A0A452F2E0_BMF-02      ------c---------------at--------cagcaga-a----cc---
W5QFV1_BMF-01          ------c---------------ac--------cagcaga-a----cc---
H0WYH6_BMF-01          ------c---------------ac--------cagcaga-a----cc---
A0A337ST43_BMF-02      ------c---------------ac--------cagcaaa-a----cc---
A0A337ST43_BMF-03      ---------------------------------agtaggca----tg---
A0A337ST43_BMF-05      ---------------------------------agtaggca----tg---
A0A337ST43_BMF-01      ------c---------------ac--------cagcaaa-a----cc---
A0A337ST43_BMF-04      ------c---------------ac--------cagcaaa-a----cc---
A0A667H967_BMF-01      ------c---------------ac--------cagcaaa-a----cc---
M3YAD5_BMF-01          ------c---------------ac--------cagcaaa-a----cc---
U6CSY8_BMF-01          ------c---------------ac--------cagcaaa-a----cc---
A0A452SED0_BMF-01      ------c---------------ac--------cagcaaa-a----cc---
A0A384D070_BMF-01      ------c---------------ac--------cagcaaa-a----cc---
A0A5F4CJ04_BMF-04      ------c---------------ac--------cagcaaa-a----cc---
A0A5F4CJ04_BMF-03      ------c---------------ac--------cagcaaa-a----cc---
A0A5F4CJ04_BMF-01      ------c---------------ac--------cagcaaa-a----cc---
A0A5F4CJ04_BMF-02      ------c---------------ac--------cagcaaa-a----cc---
A0A4X1UQ42_BMF-01      ------c---------------ac--------cagcaga-a----cc---
A0A4X1UQ42_BMF-02      ------c---------------ac--------cagcaga-a----cc---
A0A287AIU8_BMF-01      ------c---------------ac--------cagcaga-a----cc---
A0A287AIU8_BMF-02      ------c---------------ac--------cagcaga-a----cc---
A0A3Q2HR24_BMF-01      ------c---------------ac--------cagcaga-a----cc---
A0A3Q2HR24_BMF-02      ------c---------------ac--------cagcaga-a----cc---
G1SR62_BMF-01          ------c---------------ac--------cagcaga-a----cc---
A0A286XXB0_BMF-03      ------c---------------ac--------caacaga-a----cc---
A0A286XXB0_BMF-01      ------c---------------ac--------caacaga-a----cc---
A0A286XXB0_BMF-02      ------c---------------ac--------caacaga-a----cc---
A0A2K5KGP2_BMF-01      ------c---------------ac--------cagcaga-a----cc---
A0A0D9R4R5_BMF-01      ------c---------------ac--------cagcaga-a----cc---
A0A2K5VLE9_BMF-01      ------c---------------ac--------cagcaga-a----cc---
A0A2K5VLE9_BMF-02      ------c---------------ac--------cagcaga-a----cc---
A0A096NTE9_BMF-02      ------c---------------ac--------cagcaga-a----cc---
A0A096NTE9_BMF-01      ------c---------------ac--------cagcaga-a----cc---
A0A096NTE9_BMF-03      ------c---------------ac--------cagcaga-a----cc---
A0A5F7ZML1_BMF-01      ------c---------------ac--------cagcaga-a----cc---
A0A5F7ZML1_BMF-02      ------c---------------ac--------cagcaga-a----cc---
A0A5F7ZML1_BMF-03      ------c---------------ac--------cagcaga-a----cc---
A0A2K5MJW4_BMF-01      ------c---------------ac--------cagcaga-a----cc---
A0A2K6B5F6_BMF-03      ------c---------------ac--------cagcaga-a----cc---
A0A2K5Z4A9_BMF-02      ------c---------------ac--------cagcaga-a----cc---
A0A2K5MJW4_BMF-02      ------c---------------ac--------cagcaga-a----cc---
A0A2K6B5F6_BMF-01      ------c---------------ac--------cagcaga-a----cc---
A0A2K6B5F6_BMF-02      ------c---------------ac--------cagcaga-a----cc---
A0A2K6B5F6_BMF-04      ------c---------------ac--------cagcaga-a----cc---
A0A2K5Z4A9_BMF-01      ------c---------------ac--------cagcaga-a----cc---
A0A2K5KGP2_BMF-02      ------c---------------ac--------cagcaga-a----cc---
A0A2K6RAW1_BMF-02      ------c---------------ac--------cagcaga-a----cc---
A0A2K6RAW1_BMF-01      ------c---------------ac--------cagcaga-a----cc---
A0A2K6L919_BMF-01      ------c---------------ac--------cagcaga-a----cc---
A0A2K6L919_BMF-03      ------c---------------ac--------cagcaga-a----cc---
A0A2K6L919_BMF-02      ------c---------------ac--------cagcaga-a----cc---
A0A2U4BC98_BMF-01      ------c---------------ac--------cagcaga-a----cc---
G1PAU1_BMF-01          ------c---------------ac--------cagcaga-a----cc---
A0A2I3HD83_BMF-01      ------c---------------ac--------cagcaga-a----cc---
A0A2K6TW78_BMF-03      ------c---------------ac--------cagcaga-a----cc---
A0A2K6TW78_BMF-02      ------c---------------ac--------cagcaga-a----cc---
A0A2K6TW78_BMF-01      ------c---------------ac--------cagcaga-a----cc---
A0A2J8T301_BMF-01      ------c---------------ac--------cagcaga-a----cc---
G3T7Z4_BMF-01          ------c---------------ac--------cagcaga-a----cc---
A0A2K5RN49_BMF-02      ------c---------------ac--------cagcaga-a----cc---
A0A2K5RN49_BMF-01      ------c---------------ac--------cagcaga-a----cc---
F7HZL0_BMF-01          ------c---------------ac--------cagcaga-a----cc---
A0A2K5E1Q4_BMF-02      ------c---------------at--------cagcaga-a----cc---
A0A2K5E1Q4_BMF-01      ------c---------------at--------cagcaga-a----cc---
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          ------c---------------ac--------cagcaga-a----cc---
Q96LC9_BMF-07          ------c---------------ac--------cagcaga-a----cc---
Q96LC9_BMF-01          ------c---------------ac--------cagcaga-a----cc---
Q96LC9_BMF-02          ------c---------------ac--------cagcaga-a----cc---
Q96LC9_BMF-03          ------c---------------ac--------cagcaga-a----cc---
Q96LC9_BMF-04          ------c---------------ac--------cagcaga-a----cc---
A0A2J8QDD5_BMF-01      ------c---------------ac--------cagcaga-a----cc---
A0A2R9BS98_BMF-02      ------c---------------ac--------cagcaga-a----cc---
Q96LC9_BMF-06          ------c---------------ac--------cagcaga-a----cc---
A0A2I2Z168_BMF-02      ------c---------------ac--------cagcaga-a----cc---
A0A2I2Z168_BMF-01      ------c---------------ac--------cagcaga-a----cc---
Q96LC9_BMF-08          --------------------------------------------------
A0A2R9BS98_BMF-01      ------c---------------ac--------cagcaga-a----cc---
A0A2J8QDD5_BMF-02      ------c---------------ac--------cagcaga-a----cc---
                                                                         

A0A672RK14_BMF-01      --------------------------------------------------
A0A673JJ10_BMF-01      --------------------------------------------------
A0A3B4UNJ0_BMF-01      --------------------------------------------------
W5N4P7_BMF-01          --------------a-----------------------------------
A3KND0_BMF-01          --------------------------------------------------
Q0GKC7_BMF-01          --------------a-----------------------------------
A0A671M0H4_BMF-01      --------------a-----------------------------------
A0A671M0H4_BMF-02      --------------a-----------------------------------
A0A671MNR9_BMF-01      --------------g-----------------------------------
A0A672JWL9_BMF-01      --------------g-----------------------------------
A0A672JWL9_BMF-02      --------------a-----------------------------------
A0A673HDR4_BMF-01      --------------g-----------------------------------
A0A3B3RH63_BMF-01      --------------a-----------------------------------
K7FRX2_BMF-01          --------------g-----------------------------------
A0A452H3N6_BMF-01      --------------g-----------------------------------
A0A674IPL3_BMF-01      --------------g-----------------------------------
A0A493T7X1_BMF-01      --------------a-----------------------------------
A0A3Q2UCA0_BMF-01      --------------------------------------------------
A0A3Q2UCA0_BMF-02      --------------------------------------------------
A0A669PL85_BMF-02      --------------------------------------------------
A0A493T7X1_BMF-02      --------------g-----------------------------------
A0A3Q2UCA0_BMF-03      --------------g-----------------------------------
A0A3Q2UCA0_BMF-04      --------------g-----------------------------------
A9XRH0_BMF-01          --------------g-----------------------------------
G1NHG8_BMF-01          --------------g-----------------------------------
A0A669PL85_BMF-01      --------------g-----------------------------------
U3JS06_BMF-01          --------------g-----------------------------------
A0A674GIP8_BMF-03      --------------g-----------------------------------
A0A674GIP8_BMF-01      --------------g-----------------------------------
A0A674GIP8_BMF-02      --------------g-----------------------------------
A0A672V891_BMF-01      --------------g-----------------------------------
A0A663DZQ4_BMF-01      --------------g-----------------------------------
A0A663MPI8_BMF-01      --------------g-----------------------------------
A0A670XMZ5_BMF-01      --------------g-----------------------------------
H9GL49_BMF-01          --------------g-----------------------------------
A0A670JUU6_BMF-01      --------------g-----------------------------------
A0A670JUU6_BMF-05      --------------g-----------------------------------
A0A670JUU6_BMF-04      tcagctgttggtaag-----------------------------------
A0A670JUU6_BMF-02      tcagctgttggtaag-----------------------------------
A0A670JUU6_BMF-03      --------------------------------------------------
A0A4W3JXA1_BMF-01      --------------------------------------------------
A0A3Q2CXC4_BMF-01      --------------a-----------------------------------
A0A3Q2CXC4_BMF-02      --------------------------------------------------
A0A3B5QK08_BMF-01      --------------a-----------------------------------
A0A3B5QK08_BMF-02      --------------a-----------------------------------
A0A096LRV0_BMF-01      --------------a-----------------------------------
A0A3B3WU80_BMF-01      --------------a-----------------------------------
A0A3P9Q8E2_BMF-01      --------------a-----------------------------------
A0A3Q2PJX9_BMF-01      --------------a-----------------------------------
A0A3Q2PJX9_BMF-03      --------------a-----------------------------------
A0A3Q2PJX9_BMF-02      --------------g-----------------------------------
A0A3Q2YCX7_BMF-01      --------------------------------------------------
A0A3Q2YCX7_BMF-02      --------------------------------------------------
A0A3B5KWG6_BMF-02      --------------a-----------------------------------
A0A3B5KWG6_BMF-01      --------------a-----------------------------------
A0A3B5KWG6_BMF-03      --------------a-----------------------------------
A0A3B3CGR9_BMF-01      --------------a-----------------------------------
A0A3P9K487_BMF-01      --------------a-----------------------------------
A0A3P9K487_BMF-02      --------------a-----------------------------------
A0A3B3HAU1_BMF-01      --------------a-----------------------------------
A0A3B3HAU1_BMF-02      --------------a-----------------------------------
A0A3B3HAU1_BMF-03      --------------a-----------------------------------
A0A3B3HAU1_BMF-04      --------------a-----------------------------------
A0A3P9ICE1_BMF-04      --------------a-----------------------------------
A0A3P9ICE1_BMF-01      --------------a-----------------------------------
A0A3P9ICE1_BMF-02      --------------a-----------------------------------
A0A3P9ICE1_BMF-03      --------------a-----------------------------------
A0A3P9ICE1_BMF-05      --------------a-----------------------------------
A0A3P8NFE2_BMF-02      --------------a-----------------------------------
A0A668TQU8_BMF-01      --------------------------------------------------
I3K2D6_BMF-01          --------------a-----------------------------------
A0A3Q4G1I4_BMF-01      --------------a-----------------------------------
A0A3P8NFE2_BMF-01      --------------a-----------------------------------
A0A3P9DPJ5_BMF-01      --------------a-----------------------------------
A0A3P9DPJ5_BMF-02      --------------a-----------------------------------
A0A3B4ETH0_BMF-01      --------------a-----------------------------------
A0A3Q3C5V2_BMF-01      --------------a-----------------------------------
A0A672HG10_BMF-01      --------------a-----------------------------------
A0A3P8UA78_BMF-02      --------------a-----------------------------------
A0A3P8UA78_BMF-01      --------------a-----------------------------------
A0A3P8UA78_BMF-03      --------------a-----------------------------------
A0A3Q3GUU5_BMF-01      --------------a-----------------------------------
A0A3Q3VLX6_BMF-01      --------------a-----------------------------------
A0A3Q2ZA20_BMF-01      --------------a-----------------------------------
A0A667YNR9_BMF-01      --------------a-----------------------------------
A0A3Q3LME3_BMF-01      --------------t-----------------------------------
A0A3Q3LME3_BMF-02      --------------a-----------------------------------
A0A3Q3LME3_BMF-03      --------------a-----------------------------------
A0A3Q1IPR4_BMF-01      --------------a-----------------------------------
A0A3Q3QZ16_BMF-01      --------------a-----------------------------------
A0A3Q3QZ16_BMF-02      --------------a-----------------------------------
A0A665VG08_BMF-01      --------------a-----------------------------------
A0A673C8N3_BMF-01      --------------a-----------------------------------
A0A3Q1FVH7_BMF-01      --------------a-----------------------------------
A0A3Q1FVH7_BMF-02      --------------a-----------------------------------
A0A3B5B8F6_BMF-01      --------------a-----------------------------------
A0A3Q1D1K3_BMF-01      --------------a-----------------------------------
A0A3P8RKY9_BMF-01      --------------a-----------------------------------
A0A671X848_BMF-01      --------------a-----------------------------------
A0A0F8AD62_BMF-01      --------------a-----------------------------------
A0A4W6DUL1_BMF-01      --------------a-----------------------------------
A0A2U9CJH3_BMF-01      --------------a-----------------------------------
A0A3B4U5H8_BMF-01      --------------a-----------------------------------
A0A3B4WM88_BMF-01      --------------a-----------------------------------
A0A3P8ZIE7_BMF-01      --------------------------------------------------
A0A4W5N3A7_BMF-01      --------------------------------------------------
A0A6F9BGV6_BMF-01      --------------------------------------------------
A0A1S3SNN2_BMF-01      --------------------------------------------------
A0A674EF64_BMF-01      --------------------------------------------------
A0A1S3P5K4_BMF-01      --------------ggcctactgtactcagaggtctgctgagagagagac
A0A6F9B4C5_BMF-01      --------------------------------------------------
A0A4W5N721_BMF-01      --------------------------------------------------
A0A1S3P5K4_BMF-02      --------------------------------------------------
A0A673YQV3_BMF-01      --------------------------------------------------
A0A4W4DZH9_BMF-01      --------------t-----------------------------------
A0A3B4CNJ8_BMF-01      --------------t-----------------------------------
A0A3B1K1X5_BMF-01      --------------t-----------------------------------
A0A3B4B6Y3_BMF-01      --------------g-----------------------------------
A0A6I8NF73_BMF-01      --------------g-----------------------------------
A0A5F8GKJ8_BMF-01      --------------g-----------------------------------
G3WDQ2_BMF-01          --------------a-----------------------------------
A0A4X2KLG2_BMF-01      --------------g-----------------------------------
Q8K589_BMF-01          --------------g-----------------------------------
Q91ZE9_BMF-02          --------------g-----------------------------------
Q91ZE9_BMF-01          --------------g-----------------------------------
Q91ZE9_BMF-06          --------------g-----------------------------------
A0A287CXH0_BMF-01      --------------g-----------------------------------
A0A287CXH0_BMF-02      --------------g-----------------------------------
A0A671DWL6_BMF-01      --------------g-----------------------------------
A0A671DWL6_BMF-02      --------------g-----------------------------------
A0A2K6FFN3_BMF-01      --------------a-----------------------------------
A0A2K6FFN3_BMF-02      --------------a-----------------------------------
A0A673TA87_BMF-01      --------------g-----------------------------------
L8IXF5_BMF-01          --------------g-----------------------------------
A0A4W2EII1_BMF-01      --------------g-----------------------------------
A0A4W2EII1_BMF-01      --------------g-----------------------------------
Q05KI3_BMF-01          --------------g-----------------------------------
Q05KI3_BMF-02          --------------g-----------------------------------
A0A4W2INA4_BMF-01      --------------g-----------------------------------
A0A4W2INA4_BMF-01      --------------g-----------------------------------
A0A452F2E0_BMF-01      --------------g-----------------------------------
A0A452F2E0_BMF-02      --------------g-----------------------------------
W5QFV1_BMF-01          --------------g-----------------------------------
H0WYH6_BMF-01          --------------a-----------------------------------
A0A337ST43_BMF-02      --------------g-----------------------------------
A0A337ST43_BMF-03      --------------g-----------------------------------
A0A337ST43_BMF-05      --------------g-----------------------------------
A0A337ST43_BMF-01      --------------g-----------------------------------
A0A337ST43_BMF-04      --------------g-----------------------------------
A0A667H967_BMF-01      --------------g-----------------------------------
M3YAD5_BMF-01          --------------a-----------------------------------
U6CSY8_BMF-01          --------------a-----------------------------------
A0A452SED0_BMF-01      --------------a-----------------------------------
A0A384D070_BMF-01      --------------a-----------------------------------
A0A5F4CJ04_BMF-04      --------------a-----------------------------------
A0A5F4CJ04_BMF-03      --------------a-----------------------------------
A0A5F4CJ04_BMF-01      --------------a-----------------------------------
A0A5F4CJ04_BMF-02      --------------a-----------------------------------
A0A4X1UQ42_BMF-01      --------------a-----------------------------------
A0A4X1UQ42_BMF-02      --------------a-----------------------------------
A0A287AIU8_BMF-01      --------------a-----------------------------------
A0A287AIU8_BMF-02      --------------a-----------------------------------
A0A3Q2HR24_BMF-01      --------------g-----------------------------------
A0A3Q2HR24_BMF-02      --------------g-----------------------------------
G1SR62_BMF-01          --------------g-----------------------------------
A0A286XXB0_BMF-03      --------------g-----------------------------------
A0A286XXB0_BMF-01      --------------g-----------------------------------
A0A286XXB0_BMF-02      --------------g-----------------------------------
A0A2K5KGP2_BMF-01      --------------g-----------------------------------
A0A0D9R4R5_BMF-01      --------------g-----------------------------------
A0A2K5VLE9_BMF-01      --------------g-----------------------------------
A0A2K5VLE9_BMF-02      --------------g-----------------------------------
A0A096NTE9_BMF-02      --------------g-----------------------------------
A0A096NTE9_BMF-01      --------------g-----------------------------------
A0A096NTE9_BMF-03      --------------g-----------------------------------
A0A5F7ZML1_BMF-01      --------------g-----------------------------------
A0A5F7ZML1_BMF-02      --------------g-----------------------------------
A0A5F7ZML1_BMF-03      --------------g-----------------------------------
A0A2K5MJW4_BMF-01      --------------g-----------------------------------
A0A2K6B5F6_BMF-03      --------------g-----------------------------------
A0A2K5Z4A9_BMF-02      --------------g-----------------------------------
A0A2K5MJW4_BMF-02      --------------g-----------------------------------
A0A2K6B5F6_BMF-01      --------------g-----------------------------------
A0A2K6B5F6_BMF-02      --------------g-----------------------------------
A0A2K6B5F6_BMF-04      --------------g-----------------------------------
A0A2K5Z4A9_BMF-01      --------------g-----------------------------------
A0A2K5KGP2_BMF-02      --------------g-----------------------------------
A0A2K6RAW1_BMF-02      --------------g-----------------------------------
A0A2K6RAW1_BMF-01      --------------g-----------------------------------
A0A2K6L919_BMF-01      --------------g-----------------------------------
A0A2K6L919_BMF-03      --------------g-----------------------------------
A0A2K6L919_BMF-02      --------------g-----------------------------------
A0A2U4BC98_BMF-01      --------------g-----------------------------------
G1PAU1_BMF-01          --------------g-----------------------------------
A0A2I3HD83_BMF-01      --------------g-----------------------------------
A0A2K6TW78_BMF-03      --------------g-----------------------------------
A0A2K6TW78_BMF-02      --------------g-----------------------------------
A0A2K6TW78_BMF-01      --------------g-----------------------------------
A0A2J8T301_BMF-01      --------------g-----------------------------------
G3T7Z4_BMF-01          --------------g-----------------------------------
A0A2K5RN49_BMF-02      --------------g-----------------------------------
A0A2K5RN49_BMF-01      --------------g-----------------------------------
F7HZL0_BMF-01          --------------g-----------------------------------
A0A2K5E1Q4_BMF-02      --------------g-----------------------------------
A0A2K5E1Q4_BMF-01      --------------g-----------------------------------
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          --------------a-----------------------------------
Q96LC9_BMF-07          --------------a-----------------------------------
Q96LC9_BMF-01          --------------a-----------------------------------
Q96LC9_BMF-02          --------------a-----------------------------------
Q96LC9_BMF-03          --------------a-----------------------------------
Q96LC9_BMF-04          --------------a-----------------------------------
A0A2J8QDD5_BMF-01      --------------a-----------------------------------
A0A2R9BS98_BMF-02      --------------a-----------------------------------
Q96LC9_BMF-06          --------------a-----------------------------------
A0A2I2Z168_BMF-02      --------------a-----------------------------------
A0A2I2Z168_BMF-01      --------------a-----------------------------------
Q96LC9_BMF-08          --------------------------------------------------
A0A2R9BS98_BMF-01      --------------a-----------------------------------
A0A2J8QDD5_BMF-02      --------------a-----------------------------------
                                                                         

A0A672RK14_BMF-01      --------------agttc------------tctgtggttttcatt-g--
A0A673JJ10_BMF-01      --------------agtttcttttcctcaagtctgtggttttcact-g--
A0A3B4UNJ0_BMF-01      --------------tgcc-------------tgcctggatgcgcct-ta-
W5N4P7_BMF-01          cc------------agcc-------------catgtgg-------t-gg-
A3KND0_BMF-01          -----------------------------------------------ga-
Q0GKC7_BMF-01          gg------------atcc-------------gctgtggaggcgtgt-gg-
A0A671M0H4_BMF-01      tg------------tgcc-------------gtgtttgt----ttt-gg-
A0A671M0H4_BMF-02      tg------------tgcc-------------gtgtttgt----ttt-gg-
A0A671MNR9_BMF-01      gg------------agcc-------------gctgtggtggcgcgt-gg-
A0A672JWL9_BMF-01      gg------------agcc-------------gctgtggtggcgcgt-gg-
A0A672JWL9_BMF-02      tg------------tgcc-------------gtgtttgt----ttt-gg-
A0A673HDR4_BMF-01      tg------------tgcc-------------gtgtttgt----ttt-gg-
A0A3B3RH63_BMF-01      gc------------agcc-------------ggtgtgg-------t-gg-
K7FRX2_BMF-01          aa------------atca-------------agtgtgg-------t-gg-
A0A452H3N6_BMF-01      aa------------atca-------------agtgtgg-------t-gg-
A0A674IPL3_BMF-01      aa------------atca-------------agtgtgg-------t-gg-
A0A493T7X1_BMF-01      aa------------gccag------------aatgtgggtgtgttt-gg-
A0A3Q2UCA0_BMF-01      ------------------------------------gg-------t-gg-
A0A3Q2UCA0_BMF-02      ------------------------------------gg-------t-gg-
A0A669PL85_BMF-02      ------------------------------------gg-------t-gg-
A0A493T7X1_BMF-02      aa------------atca-------------agtgtgg-------t-gg-
A0A3Q2UCA0_BMF-03      aa------------atca-------------agtgtgg-------t-gg-
A0A3Q2UCA0_BMF-04      aa------------atca-------------agtgtgg-------t-gg-
A9XRH0_BMF-01          aa------------atca-------------agtgtgg-------t-gg-
G1NHG8_BMF-01          aa------------atca-------------agtgtgg-------t-gg-
A0A669PL85_BMF-01      aa------------atca-------------agtgtgg-------t-gg-
U3JS06_BMF-01          aa------------atca-------------agtgtgg-------t-gg-
A0A674GIP8_BMF-03      aa------------atca-------------agtgtgg-------t-gg-
A0A674GIP8_BMF-01      aa------------atca-------------agtgtgg-------t-gg-
A0A674GIP8_BMF-02      aa------------atca-------------agtgtgg-------t-gg-
A0A672V891_BMF-01      aa------------atca-------------agtgtgg-------t-gg-
A0A663DZQ4_BMF-01      aa------------atca-------------agtgtgg-------t-gg-
A0A663MPI8_BMF-01      aa------------atca-------------agtgtgg-------t-gg-
A0A670XMZ5_BMF-01      aa------------atca-------------ggtctgg-------t-gg-
H9GL49_BMF-01          aa------------acca-------------ggtctgg-------t-gg-
A0A670JUU6_BMF-01      aa------------acca-------------ggtctgg-------t-gg-
A0A670JUU6_BMF-05      aa------------acca-------------ggtctgg-------t-gg-
A0A670JUU6_BMF-04      aa------------aaaa-------------gggatgg-------t-gag
A0A670JUU6_BMF-02      aa------------aaaa-------------gggatgg-------t-gag
A0A670JUU6_BMF-03      --------------------------------------------------
A0A4W3JXA1_BMF-01      --------------agcc-------------attctgg-------t-gg-
A0A3Q2CXC4_BMF-01      gg------------ggcc-------------gctgtgg-------t-gg-
A0A3Q2CXC4_BMF-02      --------------ggcc-------------cttaccc-------t-gc-
A0A3B5QK08_BMF-01      gg------------ggcc-------------gctgtgg-------t-gg-
A0A3B5QK08_BMF-02      gg------------ggcc-------------gctgtgg-------t-gg-
A0A096LRV0_BMF-01      gg------------ggcc-------------gctgtgg-------t-gg-
A0A3B3WU80_BMF-01      gg------------ggcc-------------gctgtgg-------t-gg-
A0A3P9Q8E2_BMF-01      gg------------ggcc-------------gctgtgg-------t-gg-
A0A3Q2PJX9_BMF-01      gg------------ggcc-------------gctgtgg-------t-gg-
A0A3Q2PJX9_BMF-03      gg------------ggcc-------------gctgtgg-------t-gg-
A0A3Q2PJX9_BMF-02      gga-----------aacc-------------aatgtac-------t----
A0A3Q2YCX7_BMF-01      --------------------------------------------------
A0A3Q2YCX7_BMF-02      --------------------------------------------------
A0A3B5KWG6_BMF-02      gg------------gccc-------------gctgtgg-------t-gg-
A0A3B5KWG6_BMF-01      gg------------gccc-------------gctgtgg-------t-gg-
A0A3B5KWG6_BMF-03      gg------------gccc-------------gctgtgg-------tggg-
A0A3B3CGR9_BMF-01      gg------------ggcc-------------gctgtgg-------t-gg-
A0A3P9K487_BMF-01      gg------------ggcc-------------ggtgtgg-------t-gg-
A0A3P9K487_BMF-02      gg------------ggcc-------------ggtgtgg-------t-gg-
A0A3B3HAU1_BMF-01      gg------------ggcc-------------ggtgtgg-------t-gg-
A0A3B3HAU1_BMF-02      gg------------ggcc-------------ggtgtgg-------t-gg-
A0A3B3HAU1_BMF-03      gg------------ggcc-------------ggtgtgg-------t-gg-
A0A3B3HAU1_BMF-04      gg------------ggcc-------------ggtgtgg-------t-gg-
A0A3P9ICE1_BMF-04      gg------------ggcc-------------ggtgtgg-------t-gg-
A0A3P9ICE1_BMF-01      gg------------ggcc-------------ggtgtgg-------t-gg-
A0A3P9ICE1_BMF-02      gg------------ggcc-------------ggtgtgg-------t-gg-
A0A3P9ICE1_BMF-03      gg------------ggcc-------------ggtgtgg-------t-gg-
A0A3P9ICE1_BMF-05      gg------------ggcc-------------ggtgtgg-------t-gg-
A0A3P8NFE2_BMF-02      ----------------ca-------------aacatgc-------t-gg-
A0A668TQU8_BMF-01      --------------------------------------------------
I3K2D6_BMF-01          gg------------ggcc-------------aatgtgg-------t-gg-
A0A3Q4G1I4_BMF-01      gg------------ggcc-------------gatgtgg-------t-gg-
A0A3P8NFE2_BMF-01      gg------------ggcc-------------gatgtgg-------t-gg-
A0A3P9DPJ5_BMF-01      gg------------ggcc-------------gatgtgg-------t-gg-
A0A3P9DPJ5_BMF-02      gg------------ggcc-------------gatgtgg-------t-gg-
A0A3B4ETH0_BMF-01      gg------------ggcc-------------gatgtgg-------t-gg-
A0A3Q3C5V2_BMF-01      gg------------ggcc-------------gatgtgg-------t-gg-
A0A672HG10_BMF-01      gg------------ggcc-------------gctgtgg-------t-gg-
A0A3P8UA78_BMF-02      cg------------ggcc-------------gctgtgg-------t-gg-
A0A3P8UA78_BMF-01      cg------------ggcc-------------gctgtgg-------t-gg-
A0A3P8UA78_BMF-03      cg------------ggcc-------------gctgtgg-------t-gg-
A0A3Q3GUU5_BMF-01      gg------------ggcc-------------tctgtgg-------t-gg-
A0A3Q3VLX6_BMF-01      gg------------ggcc-------------gctctgg-------t-gg-
A0A3Q2ZA20_BMF-01      gg------------ggcc-------------gctgtgg-------t-gg-
A0A667YNR9_BMF-01      gg------------ggcc-------------gttgtgg-------t-gg-
A0A3Q3LME3_BMF-01      ca------------ggca-------------gtt----------------
A0A3Q3LME3_BMF-02      gg------------ggct-------------gctgtgg-------t-gg-
A0A3Q3LME3_BMF-03      gg------------ggct-------------gctgtgg-------t-gg-
A0A3Q1IPR4_BMF-01      gg------------gccc-------------gctgtgg-------t-gg-
A0A3Q3QZ16_BMF-01      gg------------ggcc-------------gctgtgg-------t-gg-
A0A3Q3QZ16_BMF-02      gg------------ggcc-------------gctgtgg-------t-gg-
A0A665VG08_BMF-01      gg------------ggcc-------------gctgtgg-------t-gg-
A0A673C8N3_BMF-01      gg------------ggcc-------------gctgtgg-------t-gg-
A0A3Q1FVH7_BMF-01      gg------------ggcc-------------gctgtgg-------t-gg-
A0A3Q1FVH7_BMF-02      gg------------ggcc-------------gctgtgg-------t-gg-
A0A3B5B8F6_BMF-01      gg------------ggcc-------------gctgtgg-------t-gg-
A0A3Q1D1K3_BMF-01      gg------------ggcc-------------gctgtgg-------t-gg-
A0A3P8RKY9_BMF-01      gg------------ggcc-------------gctgtgg-------t-gg-
A0A671X848_BMF-01      gg------------ggcc-------------gctgtgg-------t-gg-
A0A0F8AD62_BMF-01      gg------------ggcc-------------gctgtgg-------t-gg-
A0A4W6DUL1_BMF-01      gg------------ggcc-------------gctgtgg-------t-gg-
A0A2U9CJH3_BMF-01      gg------------ggcc-------------gctgtgg-------t-gg-
A0A3B4U5H8_BMF-01      gg------------ggcc-------------gctgtgg-------t-gg-
A0A3B4WM88_BMF-01      cg------------ggcc-------------gctgtgg-------t-gg-
A0A3P8ZIE7_BMF-01      tga-----------ggcc-------------cctgtgg-------t-gg-
A0A4W5N3A7_BMF-01      tga-----------ggcc-------------cttgtgg-------t-gg-
A0A6F9BGV6_BMF-01      tga-----------ggcc-------------cttgtgg-------t-gg-
A0A1S3SNN2_BMF-01      tga-----------ggcc-------------catgtgg-------t-gg-
A0A674EF64_BMF-01      tga-----------ggcc-------------cttgtgg-------t-gg-
A0A1S3P5K4_BMF-01      tgagcagcagaagtggct-------------tctttac-------g-gg-
A0A6F9B4C5_BMF-01      tga-----------ggcc-------------cttgtgg-------a-gg-
A0A4W5N721_BMF-01      tga-----------ggcc-------------cttgtgg-------a-gg-
A0A1S3P5K4_BMF-02      tga-----------ggcc-------------cttgtgg-------a-gg-
A0A673YQV3_BMF-01      tga-----------ggcc-------------cttgtgg-------a-gg-
A0A4W4DZH9_BMF-01      tg------------gttg-------------cgtttgg-------c-ct-
A0A3B4CNJ8_BMF-01      tg------------gttg-------------cgtttgg-------c-at-
A0A3B1K1X5_BMF-01      tg------------gttg-------------cgcttgg-------c-gt-
A0A3B4B6Y3_BMF-01      gg------------atca--------------------------------
A0A6I8NF73_BMF-01      ga------------acca-------------cgtttgg-------t-gg-
A0A5F8GKJ8_BMF-01      aa------------acca-------------tgtgtgg-------t-gg-
G3WDQ2_BMF-01          aa------------acca-------------tgtgtgg-------t-gg-
A0A4X2KLG2_BMF-01      aa------------acca-------------tgtgtgg-------t-gg-
Q8K589_BMF-01          ag------------accg-------------agcatgg-------c-gg-
Q91ZE9_BMF-02          ag------------accg-------------tgcgtgg-------t-gg-
Q91ZE9_BMF-01          ag------------accg-------------tgcgtgg-------t-gg-
Q91ZE9_BMF-06          ag------------accg-------------tgcgtgg-------t-gg-
A0A287CXH0_BMF-01      aa------------atcg-------------tgtgtgg-------t-gg-
A0A287CXH0_BMF-02      aa------------atcg-------------tgtgtgg-------t-gg-
A0A671DWL6_BMF-01      aa------------atcg-------------ggtgtgg-------t-gg-
A0A671DWL6_BMF-02      aa------------atcg-------------ggtgtgg-------t-gg-
A0A2K6FFN3_BMF-01      aa------------atcg-------------catgtgg-------t-gg-
A0A2K6FFN3_BMF-02      aa------------atcg-------------catgtgg-------t-gg-
A0A673TA87_BMF-01      aa------------atcg-------------agtgtgg-------t-gg-
L8IXF5_BMF-01          aa------------atcg-------------catgtgg-------t-gg-
A0A4W2EII1_BMF-01      aa------------atcg-------------catgtgg-------t-gg-
A0A4W2EII1_BMF-01      aa------------atcg-------------catgtgg-------t-gg-
Q05KI3_BMF-01          aa------------atcg-------------catgtgg-------t-gg-
Q05KI3_BMF-02          aa------------atcg-------------catgtgg-------t-gg-
A0A4W2INA4_BMF-01      aa------------atcg-------------catgtgg-------t-gg-
A0A4W2INA4_BMF-01      aa------------atcg-------------catgtgg-------t-gg-
A0A452F2E0_BMF-01      aa------------atcg-------------catgtgg-------t-gg-
A0A452F2E0_BMF-02      aa------------atcg-------------catgtgg-------t-gg-
W5QFV1_BMF-01          aa------------atcg-------------catgtgg-------t-gg-
H0WYH6_BMF-01          aa------------atcg-------------tgtgtgg-------t-gg-
A0A337ST43_BMF-02      cc------------gtcg-------------agtgtgg-------t-gg-
A0A337ST43_BMF-03      gg------------gctt-------------ggggcgg-------g-gg-
A0A337ST43_BMF-05      gg------------gctt-------------ggggcgg-------g-gg-
A0A337ST43_BMF-01      cc------------gtcg-------------agtgtgg-------t-gg-
A0A337ST43_BMF-04      cc------------gtcg-------------agtgtgg-------t-gg-
A0A667H967_BMF-01      cc------------gtcg-------------agtgtgg-------t-gg-
M3YAD5_BMF-01          aa------------atcg-------------ggtgtgg-------t-gg-
U6CSY8_BMF-01          aa------------atcg-------------ggtgtgg-------t-gg-
A0A452SED0_BMF-01      aa------------atcg-------------agtgtgg-------t-gg-
A0A384D070_BMF-01      aa------------atcg-------------agtgtgg-------t-gg-
A0A5F4CJ04_BMF-04      aa------------atcg-------------agtgtgg-------t-gg-
A0A5F4CJ04_BMF-03      aa------------atcg-------------agtgtgg-------t-gg-
A0A5F4CJ04_BMF-01      aa------------atcg-------------agtgtgg-------t-gg-
A0A5F4CJ04_BMF-02      aa------------atcg-------------agtgtgg-------t-gg-
A0A4X1UQ42_BMF-01      aa------------atcg-------------tgtgtgg-------t-gg-
A0A4X1UQ42_BMF-02      aa------------atcg-------------tgtgtgg-------t-gg-
A0A287AIU8_BMF-01      aa------------atcg-------------tgtgtgg-------t-gg-
A0A287AIU8_BMF-02      aa------------atcg-------------tgtgtgg-------t-gg-
A0A3Q2HR24_BMF-01      aa------------atcg-------------cgtgtgg-------t-gg-
A0A3Q2HR24_BMF-02      aa------------atcg-------------cgtgtgg-------t-gg-
G1SR62_BMF-01          aa------------atcg-------------cgtgtgg-------t-gg-
A0A286XXB0_BMF-03      ga------------atcg-------------cgcatgg-------t-gg-
A0A286XXB0_BMF-01      ga------------atcg-------------cgcatgg-------t-gg-
A0A286XXB0_BMF-02      ga------------atcg-------------cgcatgg-------t-gg-
A0A2K5KGP2_BMF-01      aa------------atcg-------------cgtgtgg-------t-gg-
A0A0D9R4R5_BMF-01      aa------------atcg-------------catgtgg-------t-gg-
A0A2K5VLE9_BMF-01      aa------------atcg-------------cgtgtgg-------t-gg-
A0A2K5VLE9_BMF-02      aa------------atcg-------------cgtgtgg-------t-gg-
A0A096NTE9_BMF-02      aa------------atcg-------------cgtgtgg-------t-gg-
A0A096NTE9_BMF-01      aa------------atcg-------------cgtgtgg-------t-gg-
A0A096NTE9_BMF-03      aa------------atcg-------------cgtgtgg-------t-gg-
A0A5F7ZML1_BMF-01      aa------------atcg-------------cgtgtgg-------t-gg-
A0A5F7ZML1_BMF-02      aa------------atcg-------------cgtgtgg-------t-gg-
A0A5F7ZML1_BMF-03      aa------------atcg-------------cgtgtgg-------t-gg-
A0A2K5MJW4_BMF-01      aa------------atcg-------------cgtgtgg-------t-gg-
A0A2K6B5F6_BMF-03      aa------------atcg-------------cgtgtgg-------t-gg-
A0A2K5Z4A9_BMF-02      aa------------atcg-------------cgtgtgg-------t-gg-
A0A2K5MJW4_BMF-02      aa------------atcg-------------cgtgtgg-------t-gg-
A0A2K6B5F6_BMF-01      aa------------atcg-------------cgtgtgg-------t-gg-
A0A2K6B5F6_BMF-02      aa------------atcg-------------cgtgtgg-------t-gg-
A0A2K6B5F6_BMF-04      aa------------atcg-------------cgtgtgg-------t-gg-
A0A2K5Z4A9_BMF-01      aa------------atcg-------------cgtgtgg-------t-gg-
A0A2K5KGP2_BMF-02      aa------------atcg-------------cgtgtgg-------t-gg-
A0A2K6RAW1_BMF-02      aa------------atcg-------------cgtgtgg-------t-gg-
A0A2K6RAW1_BMF-01      aa------------atcg-------------cgtgtgg-------t-gg-
A0A2K6L919_BMF-01      aa------------atcg-------------cgtgtgg-------t-gg-
A0A2K6L919_BMF-03      aa------------atcg-------------cgtgtgg-------t-gg-
A0A2K6L919_BMF-02      aa------------atcg-------------cgtgtgg-------t-gg-
A0A2U4BC98_BMF-01      aa------------atcg-------------cgtgtgg-------t-gg-
G1PAU1_BMF-01          aa------------atcg-------------catgtgg-------t-gg-
A0A2I3HD83_BMF-01      aa------------atcg-------------cgtgtgg-------t-gg-
A0A2K6TW78_BMF-03      aa------------atcg-------------tgtgtgg-------t-gg-
A0A2K6TW78_BMF-02      aa------------atcg-------------tgtgtgg-------t-gg-
A0A2K6TW78_BMF-01      aa------------atcg-------------tgtgtgg-------t-gg-
A0A2J8T301_BMF-01      aa------------atcg-------------cgtgtgg-------t-gg-
G3T7Z4_BMF-01          aa------------atcc-------------tgcgtgg-------a-gg-
A0A2K5RN49_BMF-02      aa------------atcg-------------cgtgtgg-------t-gg-
A0A2K5RN49_BMF-01      aa------------atcg-------------cgtgtgg-------t-gg-
F7HZL0_BMF-01          aa------------atcg-------------catgtgg-------t-gg-
A0A2K5E1Q4_BMF-02      aa------------atcg-------------cgtgtgg-------t-gg-
A0A2K5E1Q4_BMF-01      aa------------atcg-------------cgtgtgg-------t-gg-
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          aa------------atcg-------------tgtgtgg-------t-gg-
Q96LC9_BMF-07          aa------------atcg-------------tgtgtgg-------t-gg-
Q96LC9_BMF-01          aa------------atcg-------------tgtgtgg-------t-gg-
Q96LC9_BMF-02          aa------------atcg-------------tgtgtgg-------t-gg-
Q96LC9_BMF-03          aa------------atcg-------------tgtgtgg-------t-gg-
Q96LC9_BMF-04          aa------------atcg-------------tgtgtgg-------t-gg-
A0A2J8QDD5_BMF-01      aa------------atcg-------------tgtgtgg-------t-gg-
A0A2R9BS98_BMF-02      aa------------atcg-------------tgtgtgg-------t-gg-
Q96LC9_BMF-06          aa------------atcg-------------tgtgtgg-------t-gg-
A0A2I2Z168_BMF-02      aa------------atcg-------------tgtgtgg-------t-gg-
A0A2I2Z168_BMF-01      aa------------atcg-------------tgtgtgg-------t-gg-
Q96LC9_BMF-08          --------------------------------------------------
A0A2R9BS98_BMF-01      aa------------atcg-------------tgtgtgg-------t-gg-
A0A2J8QDD5_BMF-02      aa------------atcg-------------tgtgtgg-------t-gg-
                                                                         

A0A672RK14_BMF-01      --------------cagtggtttctgt-----------------------
A0A673JJ10_BMF-01      --------------cagtggtttctgt-----------------------
A0A3B4UNJ0_BMF-01      --------------cgat--------------------------------
W5N4P7_BMF-01          --------------aggc-----tggc-----------------------
A3KND0_BMF-01          --------------------------------------------------
Q0GKC7_BMF-01          --------------cgac--------------------------------
A0A671M0H4_BMF-01      --------------acgg--------------------------------
A0A671M0H4_BMF-02      --------------acgg--------------------------------
A0A671MNR9_BMF-01      --------------cggt--------------------------------
A0A672JWL9_BMF-01      --------------ccgt--------------------------------
A0A672JWL9_BMF-02      --------------ccgg--------------------------------
A0A673HDR4_BMF-01      --------------ccgg--------------------------------
A0A3B3RH63_BMF-01      --------------cggc-----ttgt-----------------------
K7FRX2_BMF-01          --------------caga-----tcct-----------------------
A0A452H3N6_BMF-01      --------------caga-----tcct-----------------------
A0A674IPL3_BMF-01      --------------caga-----tcct-----------------------
A0A493T7X1_BMF-01      --------------taaa-----gctt-----------------------
A0A3Q2UCA0_BMF-01      ----------------gg-----tctt-----------------------
A0A3Q2UCA0_BMF-02      ----------------gg-----tctt-----------------------
A0A669PL85_BMF-02      ----------------gg-----tatt-----------------------
A0A493T7X1_BMF-02      --------------cagc-----tttt-----------------------
A0A3Q2UCA0_BMF-03      --------------cagc-----tttt-----------------------
A0A3Q2UCA0_BMF-04      --------------cagc-----tttt-----------------------
A9XRH0_BMF-01          --------------cagc-----tttt-----------------------
G1NHG8_BMF-01          --------------cagc-----tttt-----------------------
A0A669PL85_BMF-01      --------------cagc-----tttt-----------------------
U3JS06_BMF-01          --------------cagc-----tttt-----------------------
A0A674GIP8_BMF-03      --------------cagc-----tttt-----------------------
A0A674GIP8_BMF-01      --------------cagc-----tttt-----------------------
A0A674GIP8_BMF-02      --------------cagc-----tttt-----------------------
A0A672V891_BMF-01      --------------cagc-----tttt-----------------------
A0A663DZQ4_BMF-01      --------------cagc-----tttt-----------------------
A0A663MPI8_BMF-01      --------------cagc-----tttt-----------------------
A0A670XMZ5_BMF-01      --------------caga-----tcct-----------------------
H9GL49_BMF-01          --------------caga-----tctt-----------------------
A0A670JUU6_BMF-01      --------------caga-----tcct-----------------------
A0A670JUU6_BMF-05      --------------caga-----tcct-----------------------
A0A670JUU6_BMF-04      gtttgaaagagctctgga-----tcctcaaagagagggtacatacactca
A0A670JUU6_BMF-02      gtttgaaagagctctgga-----tcctcaaagagagggtacatacactca
A0A670JUU6_BMF-03      --------------------------------------------------
A0A4W3JXA1_BMF-01      --------------agac-----ttct-----------------------
A0A3Q2CXC4_BMF-01      --------------cgca-----tgac-----------------------
A0A3Q2CXC4_BMF-02      --------------ctcc-----t-ct-----------------------
A0A3B5QK08_BMF-01      --------------cgca-----tgac-----------------------
A0A3B5QK08_BMF-02      --------------cgca-----tgac-----------------------
A0A096LRV0_BMF-01      --------------cgca-----tgac-----------------------
A0A3B3WU80_BMF-01      --------------cgca-----tgac-----------------------
A0A3P9Q8E2_BMF-01      --------------cgta-----tgac-----------------------
A0A3Q2PJX9_BMF-01      --------------cgca-----tgac-----------------------
A0A3Q2PJX9_BMF-03      --------------cgca-----tgac-----------------------
A0A3Q2PJX9_BMF-02      ---------------aca-----caa------------------------
A0A3Q2YCX7_BMF-01      --------------------------------------------------
A0A3Q2YCX7_BMF-02      --------------------------------------------------
A0A3B5KWG6_BMF-02      --------------cgcc-----tggg-----------------------
A0A3B5KWG6_BMF-01      --------------cgcc-----tggg-----------------------
A0A3B5KWG6_BMF-03      --------------cgcc-----tggg-----------------------
A0A3B3CGR9_BMF-01      --------------cgcc-----tcac-----------------------
A0A3P9K487_BMF-01      --------------cgcc-----tcgc-----------------------
A0A3P9K487_BMF-02      --------------cgcc-----tcgc-----------------------
A0A3B3HAU1_BMF-01      --------------cgcc-----tcgc-----------------------
A0A3B3HAU1_BMF-02      --------------cgcc-----tcgc-----------------------
A0A3B3HAU1_BMF-03      --------------cgcc-----tcgc-----------------------
A0A3B3HAU1_BMF-04      --------------cgcc-----tcgc-----------------------
A0A3P9ICE1_BMF-04      --------------cgcc-----tcgc-----------------------
A0A3P9ICE1_BMF-01      --------------cgcc-----tcgc-----------------------
A0A3P9ICE1_BMF-02      --------------cgcc-----tcgc-----------------------
A0A3P9ICE1_BMF-03      --------------cgcc-----tcgc-----------------------
A0A3P9ICE1_BMF-05      --------------cgcc-----tcgc-----------------------
A0A3P8NFE2_BMF-02      --------------ctgg-----aaac-----------------------
A0A668TQU8_BMF-01      --------------------------------------------------
I3K2D6_BMF-01          --------------cgcc-----tggc-----------------------
A0A3Q4G1I4_BMF-01      --------------cgcc-----tggc-----------------------
A0A3P8NFE2_BMF-01      --------------cgcc-----tggc-----------------------
A0A3P9DPJ5_BMF-01      --------------cgcc-----tggc-----------------------
A0A3P9DPJ5_BMF-02      --------------cgcc-----tggc-----------------------
A0A3B4ETH0_BMF-01      --------------cgcc-----tggc-----------------------
A0A3Q3C5V2_BMF-01      --------------cgcc-----tggc-----------------------
A0A672HG10_BMF-01      --------------cgcc-----tggc-----------------------
A0A3P8UA78_BMF-02      --------------cgcc-----tgac-----------------------
A0A3P8UA78_BMF-01      --------------cgcc-----tgac-----------------------
A0A3P8UA78_BMF-03      --------------cgcc-----tgac-----------------------
A0A3Q3GUU5_BMF-01      --------------cgtc-----tggg-----------------------
A0A3Q3VLX6_BMF-01      --------------cgct-----tggg-----------------------
A0A3Q2ZA20_BMF-01      --------------cgcc-----tgac-----------------------
A0A667YNR9_BMF-01      --------------cgcc-----tggc-----------------------
A0A3Q3LME3_BMF-01      --------------tgcc-----tg-------------------------
A0A3Q3LME3_BMF-02      --------------cgcc-----tggc-----------------------
A0A3Q3LME3_BMF-03      --------------cgcc-----tggc-----------------------
A0A3Q1IPR4_BMF-01      --------------cgcc-----tggc-----------------------
A0A3Q3QZ16_BMF-01      --------------cgcc-----tggc-----------------------
A0A3Q3QZ16_BMF-02      --------------cgcc-----tggc-----------------------
A0A665VG08_BMF-01      --------------cgac-----tggc-----------------------
A0A673C8N3_BMF-01      --------------cgcc-----tggc-----------------------
A0A3Q1FVH7_BMF-01      --------------cgcc-----tggt-----------------------
A0A3Q1FVH7_BMF-02      --------------cgcc-----tggt-----------------------
A0A3B5B8F6_BMF-01      --------------cgcc-----tggc-----------------------
A0A3Q1D1K3_BMF-01      --------------cgcc-----tggc-----------------------
A0A3P8RKY9_BMF-01      --------------cgcc-----tggc-----------------------
A0A671X848_BMF-01      --------------cgcc-----ttgg-----------------------
A0A0F8AD62_BMF-01      --------------cgcc-----tggg-----------------------
A0A4W6DUL1_BMF-01      --------------cgcc-----tggc-----------------------
A0A2U9CJH3_BMF-01      --------------cgcc-----tggc-----------------------
A0A3B4U5H8_BMF-01      --------------cgcc-----tggc-----------------------
A0A3B4WM88_BMF-01      --------------cgcc-----tggc-----------------------
A0A3P8ZIE7_BMF-01      --------------cgcc-----tggc-----------------------
A0A4W5N3A7_BMF-01      --------------cgtg-----tggc-----------------------
A0A6F9BGV6_BMF-01      --------------cgcc-----tggc-----------------------
A0A1S3SNN2_BMF-01      --------------cgcc-----tggc-----------------------
A0A674EF64_BMF-01      --------------cgcc-----tggc-----------------------
A0A1S3P5K4_BMF-01      --------------catccattgtgtt-----------------------
A0A6F9B4C5_BMF-01      --------------cgcc-----tggc-----------------------
A0A4W5N721_BMF-01      --------------cgtc-----tggc-----------------------
A0A1S3P5K4_BMF-02      --------------cgcc-----tggc-----------------------
A0A673YQV3_BMF-01      --------------cgcc-----tggc-----------------------
A0A4W4DZH9_BMF-01      --------------ctg---------------------------------
A0A3B4CNJ8_BMF-01      --------------cag---------------------------------
A0A3B1K1X5_BMF-01      --------------cgg---------------------------------
A0A3B4B6Y3_BMF-01      --------------------------------------------------
A0A6I8NF73_BMF-01      --------------cggg-----tcct-----------------------
A0A5F8GKJ8_BMF-01      --------------caaa-----tcct-----------------------
G3WDQ2_BMF-01          --------------caga-----tcct-----------------------
A0A4X2KLG2_BMF-01      --------------caga-----tcct-----------------------
Q8K589_BMF-01          --------------cagg-----tctt-----------------------
Q91ZE9_BMF-02          --------------cagg-----tctt-----------------------
Q91ZE9_BMF-01          --------------cagg-----tctt-----------------------
Q91ZE9_BMF-06          --------------cagg-----tctt-----------------------
A0A287CXH0_BMF-01      --------------caga-----ttct-----------------------
A0A287CXH0_BMF-02      --------------caga-----ttct-----------------------
A0A671DWL6_BMF-01      --------------caga-----tcct-----------------------
A0A671DWL6_BMF-02      --------------caga-----tcct-----------------------
A0A2K6FFN3_BMF-01      --------------caga-----tcct-----------------------
A0A2K6FFN3_BMF-02      --------------caga-----tcct-----------------------
A0A673TA87_BMF-01      --------------caac-----tcct-----------------------
L8IXF5_BMF-01          --------------caga-----tcct-----------------------
A0A4W2EII1_BMF-01      --------------caga-----tcct-----------------------
A0A4W2EII1_BMF-01      --------------caga-----tcct-----------------------
Q05KI3_BMF-01          --------------caga-----tcct-----------------------
Q05KI3_BMF-02          --------------caga-----tcct-----------------------
A0A4W2INA4_BMF-01      --------------caga-----tcct-----------------------
A0A4W2INA4_BMF-01      --------------caga-----tcct-----------------------
A0A452F2E0_BMF-01      --------------caga-----tcct-----------------------
A0A452F2E0_BMF-02      --------------caga-----tcct-----------------------
W5QFV1_BMF-01          --------------caga-----tcct-----------------------
H0WYH6_BMF-01          --------------cagg-----tcct-----------------------
A0A337ST43_BMF-02      --------------caga-----ttct-----------------------
A0A337ST43_BMF-03      --------------gaga-----gtct-----------------------
A0A337ST43_BMF-05      --------------gaga-----gtct-----------------------
A0A337ST43_BMF-01      --------------caga-----ttct-----------------------
A0A337ST43_BMF-04      --------------caga-----ttct-----------------------
A0A667H967_BMF-01      --------------caga-----ttct-----------------------
M3YAD5_BMF-01          --------------caga-----tcct-----------------------
U6CSY8_BMF-01          --------------caga-----tcct-----------------------
A0A452SED0_BMF-01      --------------caga-----tcct-----------------------
A0A384D070_BMF-01      --------------caga-----tcct-----------------------
A0A5F4CJ04_BMF-04      --------------caga-----ttct-----------------------
A0A5F4CJ04_BMF-03      --------------caga-----ttct-----------------------
A0A5F4CJ04_BMF-01      --------------caga-----ttct-----------------------
A0A5F4CJ04_BMF-02      --------------caga-----ttct-----------------------
A0A4X1UQ42_BMF-01      --------------caaa-----tcct-----------------------
A0A4X1UQ42_BMF-02      --------------caaa-----tcct-----------------------
A0A287AIU8_BMF-01      --------------caaa-----tcct-----------------------
A0A287AIU8_BMF-02      --------------caaa-----tcct-----------------------
A0A3Q2HR24_BMF-01      --------------caga-----ccct-----------------------
A0A3Q2HR24_BMF-02      --------------caga-----ccct-----------------------
G1SR62_BMF-01          --------------caga-----tcct-----------------------
A0A286XXB0_BMF-03      --------------cagg-----tctt-----------------------
A0A286XXB0_BMF-01      --------------cagg-----tctt-----------------------
A0A286XXB0_BMF-02      --------------cagg-----tctt-----------------------
A0A2K5KGP2_BMF-01      --------------caga-----tcct-----------------------
A0A0D9R4R5_BMF-01      --------------caga-----tcct-----------------------
A0A2K5VLE9_BMF-01      --------------caga-----tcct-----------------------
A0A2K5VLE9_BMF-02      --------------caga-----tcct-----------------------
A0A096NTE9_BMF-02      --------------caga-----tcct-----------------------
A0A096NTE9_BMF-01      --------------caga-----tcct-----------------------
A0A096NTE9_BMF-03      --------------caga-----tcct-----------------------
A0A5F7ZML1_BMF-01      --------------caga-----tcct-----------------------
A0A5F7ZML1_BMF-02      --------------caga-----tcct-----------------------
A0A5F7ZML1_BMF-03      --------------caga-----tcct-----------------------
A0A2K5MJW4_BMF-01      --------------caga-----tcct-----------------------
A0A2K6B5F6_BMF-03      --------------caga-----tcct-----------------------
A0A2K5Z4A9_BMF-02      --------------caga-----tcct-----------------------
A0A2K5MJW4_BMF-02      --------------caga-----tcct-----------------------
A0A2K6B5F6_BMF-01      --------------caga-----tcct-----------------------
A0A2K6B5F6_BMF-02      --------------caga-----tcct-----------------------
A0A2K6B5F6_BMF-04      --------------caga-----tcct-----------------------
A0A2K5Z4A9_BMF-01      --------------caga-----tcct-----------------------
A0A2K5KGP2_BMF-02      --------------caga-----tcct-----------------------
A0A2K6RAW1_BMF-02      --------------caga-----tcct-----------------------
A0A2K6RAW1_BMF-01      --------------caga-----tcct-----------------------
A0A2K6L919_BMF-01      --------------caga-----tcct-----------------------
A0A2K6L919_BMF-03      --------------caga-----tcct-----------------------
A0A2K6L919_BMF-02      --------------caga-----tcct-----------------------
A0A2U4BC98_BMF-01      --------------caga-----tcct-----------------------
G1PAU1_BMF-01          --------------cagt-----tcct-----------------------
A0A2I3HD83_BMF-01      --------------caga-----tcct-----------------------
A0A2K6TW78_BMF-03      --------------cagg-----tcct-----------------------
A0A2K6TW78_BMF-02      --------------cagg-----tcct-----------------------
A0A2K6TW78_BMF-01      --------------cagg-----tcct-----------------------
A0A2J8T301_BMF-01      --------------caga-----tcct-----------------------
G3T7Z4_BMF-01          --------------caga-----ttct-----------------------
A0A2K5RN49_BMF-02      --------------cagg-----tcct-----------------------
A0A2K5RN49_BMF-01      --------------cagg-----tcct-----------------------
F7HZL0_BMF-01          --------------cagg-----tcct-----------------------
A0A2K5E1Q4_BMF-02      --------------cagg-----tcct-----------------------
A0A2K5E1Q4_BMF-01      --------------cagg-----tcct-----------------------
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          --------------caga-----tcct-----------------------
Q96LC9_BMF-07          --------------caga-----tcct-----------------------
Q96LC9_BMF-01          --------------caga-----tcct-----------------------
Q96LC9_BMF-02          --------------caga-----tcct-----------------------
Q96LC9_BMF-03          --------------caga-----tcct-----------------------
Q96LC9_BMF-04          --------------caga-----tcct-----------------------
A0A2J8QDD5_BMF-01      --------------caga-----tcct-----------------------
A0A2R9BS98_BMF-02      --------------caga-----tcct-----------------------
Q96LC9_BMF-06          --------------caga-----tcct-----------------------
A0A2I2Z168_BMF-02      --------------caga-----tcct-----------------------
A0A2I2Z168_BMF-01      --------------caga-----tcct-----------------------
Q96LC9_BMF-08          --------------------------------------------------
A0A2R9BS98_BMF-01      --------------caga-----tcct-----------------------
A0A2J8QDD5_BMF-02      --------------caga-----tcct-----------------------
                                                                         

A0A672RK14_BMF-01      -----------------------------cacgatgtgcaatgacatcat
A0A673JJ10_BMF-01      -----------------------------cacgatgtgcaatgacatcat
A0A3B4UNJ0_BMF-01      -----------------------------ggcc-----------ctgttt
W5N4P7_BMF-01          -------ttt-------------------ggct-----------ttgttc
A3KND0_BMF-01          --------------------------------------------------
Q0GKC7_BMF-01          -----------------------------ggcc-----------gtcctc
A0A671M0H4_BMF-01      -----------------------------actg-----------ttt---
A0A671M0H4_BMF-02      -----------------------------actg-----------ttt---
A0A671MNR9_BMF-01      -----------------------------ggcg-----------ttctac
A0A672JWL9_BMF-01      -----------------------------ggcg-----------ttctac
A0A672JWL9_BMF-02      -----------------------------actg-----------ttt---
A0A673HDR4_BMF-01      -----------------------------actg-----------ttt---
A0A3B3RH63_BMF-01      -------gat-------------------ggcg-----------ctgtgt
K7FRX2_BMF-01          -------tct-------------------tttc-----------ctacat
A0A452H3N6_BMF-01      -------tct-------------------cttt-----------atacat
A0A674IPL3_BMF-01      -------tct-------------------cttc-----------ctacat
A0A493T7X1_BMF-01      -------gct-------------------gctg--------ggtccccgc
A0A3Q2UCA0_BMF-01      -------tct-------------------tatctaagagtggtgctccag
A0A3Q2UCA0_BMF-02      -------tct-------------------tatctaagagtggtgctccag
A0A669PL85_BMF-02      -------tct-------------------tatccaagagtggtgctccag
A0A493T7X1_BMF-02      -------tct-------------------cttt-----------ctacac
A0A3Q2UCA0_BMF-03      -------tct-------------------cttt-----------ctacac
A0A3Q2UCA0_BMF-04      -------tct-------------------cttt-----------ctacac
A9XRH0_BMF-01          -------tct-------------------cttt-----------ctacac
G1NHG8_BMF-01          -------tct-------------------cttt-----------ctacac
A0A669PL85_BMF-01      -------tct-------------------cttt-----------ctacac
U3JS06_BMF-01          -------tct-------------------cttc-----------ctacac
A0A674GIP8_BMF-03      -------tct-------------------cttc-----------ctacac
A0A674GIP8_BMF-01      -------tct-------------------cttc-----------ctacac
A0A674GIP8_BMF-02      -------tct-------------------cttc-----------ctacac
A0A672V891_BMF-01      -------tct-------------------cttc-----------ctacac
A0A663DZQ4_BMF-01      -------tct-------------------cttc-----------ctacac
A0A663MPI8_BMF-01      -------tct-------------------cttc-----------ctacac
A0A670XMZ5_BMF-01      -------cct-------------------cttc-----------ctccat
H9GL49_BMF-01          -------ctt-------------------cttc-----------ctccat
A0A670JUU6_BMF-01      -------cct-------------------tttc-----------ctccat
A0A670JUU6_BMF-05      -------cct-------------------tttc-----------ctccat
A0A670JUU6_BMF-04      ggcaaacc------------------------c-----------cactac
A0A670JUU6_BMF-02      gctttatcca-------------------tggc-----------cact-c
A0A670JUU6_BMF-03      gctttatcca-------------------tggc-----------cact-c
A0A4W3JXA1_BMF-01      -------tgt-------------------cctc-----------ctcttt
A0A3Q2CXC4_BMF-01      -------tgc-------------------agct-----------cttctc
A0A3Q2CXC4_BMF-02      -------tcc-------------------tgtt-----------tatttc
A0A3B5QK08_BMF-01      -------tgc-------------------agct-----------cttctc
A0A3B5QK08_BMF-02      -------tgc-------------------agct-----------cttctc
A0A096LRV0_BMF-01      -------tgc-------------------agct-----------cttctc
A0A3B3WU80_BMF-01      -------tgc-------------------agct-----------cttctc
A0A3P9Q8E2_BMF-01      -------tgc-------------------agct-----------cttctc
A0A3Q2PJX9_BMF-01      -------tgc-------------------agct-----------cttctc
A0A3Q2PJX9_BMF-03      -------tgc-------------------agct-----------cttctc
A0A3Q2PJX9_BMF-02      --------ac-------------------gtct-----------actcac
A0A3Q2YCX7_BMF-01      --------------------------------------------------
A0A3Q2YCX7_BMF-02      --------------------------------------------------
A0A3B5KWG6_BMF-02      -------cac-------------------cgct-----------ctgctc
A0A3B5KWG6_BMF-01      -------cac-------------------cgct-----------ctgctc
A0A3B5KWG6_BMF-03      -------cac-------------------cgct-----------ctgctc
A0A3B3CGR9_BMF-01      -------cac-------------------ggcc-----------ctcgtc
A0A3P9K487_BMF-01      -------cac-------------------ggct-----------ctcgtc
A0A3P9K487_BMF-02      -------cac-------------------ggct-----------ctcgtc
A0A3B3HAU1_BMF-01      -------cac-------------------ggct-----------ctcgtc
A0A3B3HAU1_BMF-02      -------cac-------------------ggct-----------ctcgtc
A0A3B3HAU1_BMF-03      -------cac-------------------ggct-----------ctcgtc
A0A3B3HAU1_BMF-04      -------cac-------------------ggct-----------ctcgtc
A0A3P9ICE1_BMF-04      -------cac-------------------ggct-----------ctcgtc
A0A3P9ICE1_BMF-01      -------cac-------------------ggct-----------ctcgtc
A0A3P9ICE1_BMF-02      -------cac-------------------ggct-----------ctcgtc
A0A3P9ICE1_BMF-03      -------cac-------------------ggct-----------ctcgtc
A0A3P9ICE1_BMF-05      -------cac-------------------ggct-----------ctcgtc
A0A3P8NFE2_BMF-02      -------tgc-------------------tg-------------aagctt
A0A668TQU8_BMF-01      --------------------------------------------------
I3K2D6_BMF-01          -------cgc-------------------ggcc-----------cttctc
A0A3Q4G1I4_BMF-01      -------cgc-------------------ggcc-----------attctc
A0A3P8NFE2_BMF-01      -------cgc-------------------ggcc-----------attctc
A0A3P9DPJ5_BMF-01      -------cgc-------------------ggcc-----------attctc
A0A3P9DPJ5_BMF-02      -------cgc-------------------ggcc-----------attctc
A0A3B4ETH0_BMF-01      -------cgc-------------------ggcc-----------attctc
A0A3Q3C5V2_BMF-01      -------cgc-------------------ggcc-----------attctc
A0A672HG10_BMF-01      -------cac-------------------aacc-----------ctcctc
A0A3P8UA78_BMF-02      -------cac-------------------aact-----------ctgctc
A0A3P8UA78_BMF-01      -------cac-------------------aact-----------ctgctc
A0A3P8UA78_BMF-03      -------cac-------------------aact-----------ctgctc
A0A3Q3GUU5_BMF-01      -------tgc-------------------agct-----------ttgctg
A0A3Q3VLX6_BMF-01      -------ttc-------------------agct-----------ctgctc
A0A3Q2ZA20_BMF-01      -------tgc-------------------agct-----------ctcctc
A0A667YNR9_BMF-01      -------ctc-------------------ggct-----------ctgctc
A0A3Q3LME3_BMF-01      --------------------------------t-----------cttgtt
A0A3Q3LME3_BMF-02      -------cac-------------------agct-----------ctgctc
A0A3Q3LME3_BMF-03      -------cac-------------------agct-----------ctgctc
A0A3Q1IPR4_BMF-01      -------cgc-------------------agct-----------atgctc
A0A3Q3QZ16_BMF-01      -------cac-------------------aact-----------ctgctc
A0A3Q3QZ16_BMF-02      -------cac-------------------aact-----------ctgctc
A0A665VG08_BMF-01      -------cac-------------------ggcc-----------ctgctc
A0A673C8N3_BMF-01      -------tgc-------------------agct-----------ctgctc
A0A3Q1FVH7_BMF-01      -------cgc-------------------agcc-----------attctc
A0A3Q1FVH7_BMF-02      -------cgc-------------------agcc-----------attctc
A0A3B5B8F6_BMF-01      -------cgc-------------------agcc-----------ctactc
A0A3Q1D1K3_BMF-01      -------cgc-------------------agcc-----------gttctc
A0A3P8RKY9_BMF-01      -------cgc-------------------agcc-----------gttctc
A0A671X848_BMF-01      -------cgc-------------------agct-----------ctgatc
A0A0F8AD62_BMF-01      -------cgc-------------------agct-----------ctgctc
A0A4W6DUL1_BMF-01      -------tgc-------------------agct-----------ctgctg
A0A2U9CJH3_BMF-01      -------cgc-------------------agct-----------ctgctc
A0A3B4U5H8_BMF-01      -------cgt-------------------agct-----------ctgctc
A0A3B4WM88_BMF-01      -------cgc-------------------agct-----------ctgctc
A0A3P8ZIE7_BMF-01      -------ctc-------------------ggct-----------ctgctc
A0A4W5N3A7_BMF-01      -------ctc-------------------agct-----------ctgctc
A0A6F9BGV6_BMF-01      -------ctc-------------------agct-----------ctgctc
A0A1S3SNN2_BMF-01      -------ctc-------------------agct-----------ctgttc
A0A674EF64_BMF-01      -------ctc-------------------agct-----------ctgttc
A0A1S3P5K4_BMF-01      -------cac-------------------gtct-----------cagtgt
A0A6F9B4C5_BMF-01      -------ctc-------------------ggct-----------ctgctc
A0A4W5N721_BMF-01      -------ctc-------------------ggct-----------ctgctc
A0A1S3P5K4_BMF-02      -------ctc-------------------ggct-----------ctgctc
A0A673YQV3_BMF-01      -------ctc-------------------ggct-----------ctgctc
A0A4W4DZH9_BMF-01      -----------------------------catt-----------gtatgt
A0A3B4CNJ8_BMF-01      -----------------------------cgtt-----------gtacac
A0A3B1K1X5_BMF-01      -----------------------------cgct-----------ctacac
A0A3B4B6Y3_BMF-01      -----------------------------ctt----------------ac
A0A6I8NF73_BMF-01      -------gcc-------------------tctc-----------ctgcac
A0A5F8GKJ8_BMF-01      -------cct-------------------cttc-----------cttcac
G3WDQ2_BMF-01          -------cct-------------------cttc-----------cttcac
A0A4X2KLG2_BMF-01      -------cct-------------------cttt-----------cttcac
Q8K589_BMF-01          -------cct-------------------cttc-----------cttcaa
Q91ZE9_BMF-02          -------cct-------------------tttc-----------cttcaa
Q91ZE9_BMF-01          -------cct-------------------tttc-----------cttcaa
Q91ZE9_BMF-06          -------cct-------------------tttc-----------cttcaa
A0A287CXH0_BMF-01      -------cct-------------------cttc-----------ctgcac
A0A287CXH0_BMF-02      -------cct-------------------cttc-----------ctgcac
A0A671DWL6_BMF-01      -------cct-------------------gttc-----------ctacac
A0A671DWL6_BMF-02      -------cct-------------------gttc-----------ctacac
A0A2K6FFN3_BMF-01      -------cct-------------------cttc-----------ctacac
A0A2K6FFN3_BMF-02      -------cct-------------------cttc-----------ctacac
A0A673TA87_BMF-01      -------cct-------------------cttc-----------ctacac
L8IXF5_BMF-01          -------cct-------------------cttc-----------ctacac
A0A4W2EII1_BMF-01      -------cct-------------------cttc-----------ctacac
A0A4W2EII1_BMF-01      -------cct-------------------cttc-----------ctacac
Q05KI3_BMF-01          -------cct-------------------cttc-----------ctacac
Q05KI3_BMF-02          -------cct-------------------cttc-----------ctacac
A0A4W2INA4_BMF-01      -------cct-------------------cttc-----------ctacac
A0A4W2INA4_BMF-01      -------cct-------------------cttc-----------ctacac
A0A452F2E0_BMF-01      -------cct-------------------cttc-----------ctgcac
A0A452F2E0_BMF-02      -------cct-------------------cttc-----------ctgcac
W5QFV1_BMF-01          -------cct-------------------cttc-----------ctacac
H0WYH6_BMF-01          -------ctt-------------------tttc-----------ctacac
A0A337ST43_BMF-02      -------cct-------------------cttc-----------ctacac
A0A337ST43_BMF-03      -------gctggggctggggggccaggacctgc-----------ctcagc
A0A337ST43_BMF-05      -------gctggggctggggggccaggacctgc-----------ctcagc
A0A337ST43_BMF-01      -------cct-------------------cttc-----------ctacac
A0A337ST43_BMF-04      -------cct-------------------cttc-----------ctacac
A0A667H967_BMF-01      -------cct-------------------cttc-----------ctacac
M3YAD5_BMF-01          -------tct-------------------cttc-----------ctacac
U6CSY8_BMF-01          -------tct-------------------cttc-----------ctacac
A0A452SED0_BMF-01      -------gct-------------------cttc-----------ttacac
A0A384D070_BMF-01      -------gct-------------------cttc-----------ttacac
A0A5F4CJ04_BMF-04      -------cct-------------------cttc-----------ctgcac
A0A5F4CJ04_BMF-03      -------cct-------------------cttc-----------ctgcac
A0A5F4CJ04_BMF-01      -------cct-------------------cttc-----------ctgcac
A0A5F4CJ04_BMF-02      -------cct-------------------cttc-----------ctgcac
A0A4X1UQ42_BMF-01      -------cct-------------------gttt-----------ctacac
A0A4X1UQ42_BMF-02      -------cct-------------------gttt-----------ctacac
A0A287AIU8_BMF-01      -------cct-------------------gttt-----------ctacac
A0A287AIU8_BMF-02      -------cct-------------------gttt-----------ctacac
A0A3Q2HR24_BMF-01      -------gct-------------------cttt-----------ctccac
A0A3Q2HR24_BMF-02      -------gct-------------------cttt-----------ctccac
G1SR62_BMF-01          -------cct-------------------cttc-----------ctgcac
A0A286XXB0_BMF-03      -------act-------------------cttc-----------atgcac
A0A286XXB0_BMF-01      -------act-------------------cttc-----------atgcac
A0A286XXB0_BMF-02      -------act-------------------cttc-----------atgcac
A0A2K5KGP2_BMF-01      -------cct-------------------cttc-----------ctgcac
A0A0D9R4R5_BMF-01      -------cct-------------------cttc-----------ctgcac
A0A2K5VLE9_BMF-01      -------cct-------------------cttc-----------ctgcac
A0A2K5VLE9_BMF-02      -------cct-------------------cttc-----------ctgcac
A0A096NTE9_BMF-02      -------cct-------------------cttc-----------ctgcac
A0A096NTE9_BMF-01      -------cct-------------------cttc-----------ctgcac
A0A096NTE9_BMF-03      -------cct-------------------cttc-----------ctgcac
A0A5F7ZML1_BMF-01      -------cct-------------------cttc-----------ctgcac
A0A5F7ZML1_BMF-02      -------cct-------------------cttc-----------ctgcac
A0A5F7ZML1_BMF-03      -------cct-------------------cttc-----------ctgcac
A0A2K5MJW4_BMF-01      -------cct-------------------cttc-----------ctgcac
A0A2K6B5F6_BMF-03      -------cct-------------------cttc-----------ctgcac
A0A2K5Z4A9_BMF-02      -------cct-------------------cttc-----------ctgcac
A0A2K5MJW4_BMF-02      -------cct-------------------cttc-----------ctgcac
A0A2K6B5F6_BMF-01      -------cct-------------------cttc-----------ctgcac
A0A2K6B5F6_BMF-02      -------cct-------------------cttc-----------ctgcac
A0A2K6B5F6_BMF-04      -------cct-------------------cttc-----------ctgcac
A0A2K5Z4A9_BMF-01      -------cct-------------------cttc-----------ctgcac
A0A2K5KGP2_BMF-02      -------cct-------------------cttc-----------ctgcac
A0A2K6RAW1_BMF-02      -------cct-------------------cttc-----------ctgcac
A0A2K6RAW1_BMF-01      -------cct-------------------cttc-----------ctgcac
A0A2K6L919_BMF-01      -------cct-------------------cttc-----------ctgcac
A0A2K6L919_BMF-03      -------cct-------------------cttc-----------ctgcac
A0A2K6L919_BMF-02      -------cct-------------------cttc-----------ctgcac
A0A2U4BC98_BMF-01      -------cct-------------------cttt-----------ctgcac
G1PAU1_BMF-01          -------cct-------------------cttc-----------ctacat
A0A2I3HD83_BMF-01      -------cct-------------------cttc-----------ctgcac
A0A2K6TW78_BMF-03      -------cct-------------------cttc-----------ctgcac
A0A2K6TW78_BMF-02      -------cct-------------------cttc-----------ctgcac
A0A2K6TW78_BMF-01      -------cct-------------------cttc-----------ctgcac
A0A2J8T301_BMF-01      -------cct-------------------cttc-----------ctgcac
G3T7Z4_BMF-01          -------cca-------------------attc-----------ctgcac
A0A2K5RN49_BMF-02      -------cct-------------------cttc-----------ctgcac
A0A2K5RN49_BMF-01      -------cct-------------------cttc-----------ctgcac
F7HZL0_BMF-01          -------cct-------------------cttc-----------ctgcac
A0A2K5E1Q4_BMF-02      -------cct-------------------cttt-----------ctgcac
A0A2K5E1Q4_BMF-01      -------cct-------------------cttt-----------ctgcac
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          -------cct-------------------cttc-----------ctgcac
Q96LC9_BMF-07          -------cct-------------------cttc-----------ctgcac
Q96LC9_BMF-01          -------cct-------------------cttc-----------ctgcac
Q96LC9_BMF-02          -------cct-------------------cttc-----------ctgcac
Q96LC9_BMF-03          -------cct-------------------cttc-----------ctgcac
Q96LC9_BMF-04          -------cct-------------------cttc-----------ctgcac
A0A2J8QDD5_BMF-01      -------cct-------------------cttc-----------ctgcac
A0A2R9BS98_BMF-02      -------cct-------------------cttc-----------ctgcac
Q96LC9_BMF-06          -------cct-------------------cttc-----------ctgcac
A0A2I2Z168_BMF-02      -------cct-------------------cttc-----------ctgcac
A0A2I2Z168_BMF-01      -------cct-------------------cttc-----------ctgcac
Q96LC9_BMF-08          --------------------------------------------------
A0A2R9BS98_BMF-01      -------cct-------------------cttc-----------ctgcac
A0A2J8QDD5_BMF-02      -------cct-------------------cttc-----------ctgcac
                                                                         

A0A672RK14_BMF-01      cgtctg-ttattt------------------caatgctgcatatgcaaa-
A0A673JJ10_BMF-01      cgtctg-ttattt------------------caatgctgcatatgcaaa-
A0A3B4UNJ0_BMF-01      ggcttt-ctgtttccaagacaggctctcgtcccccgcctgagagg-----
W5N4P7_BMF-01          acattc-ctgttt----gagagacaaggga-----acaggaaccaactt-
A3KND0_BMF-01          -------cttttt----caa------------------------------
Q0GKC7_BMF-01          acgctg-ctg----------------ttcggcgccagagagaacc-----
A0A671M0H4_BMF-01      --------------------------cctga-------------------
A0A671M0H4_BMF-02      --------------------------cctga-------------------
A0A671MNR9_BMF-01      acgctt-ttattt----ggaagagagcccaacgcaagagcaaatc-----
A0A672JWL9_BMF-01      acgctt-ttattt----ggaagagagcccaacgcaagagcaaatc-----
A0A672JWL9_BMF-02      --------------------------cctgactctggtctagttg-----
A0A673HDR4_BMF-01      --------------------------cctga-------------------
A0A3B3RH63_BMF-01      ggcctc-ctcttc----gagaggcgccaa---------------------
K7FRX2_BMF-01          aactt--ggcctt----aaatgtggaggcga----acagga-accacat-
A0A452H3N6_BMF-01      aactt--ggcctt----aaatgtggaggtga----acagga-accacgt-
A0A674IPL3_BMF-01      aactt--ggcctt----aaatgtggaggcga----acagga-acaacgt-
A0A493T7X1_BMF-01      accgg--taacct----ctgtgcaggag-ag----gcaggt------at-
A0A3Q2UCA0_BMF-01      aagac--tggctc----caggcttcggctaa----gcaggctgttgcct-
A0A3Q2UCA0_BMF-02      aagac--tggctc----caggcttcggctaa----gcaggctgttgcct-
A0A669PL85_BMF-02      aagac--tggctc----caggcttcagctaa----gca----atggcct-
A0A493T7X1_BMF-02      aactt--ggcctt----aaacgtggaggcga----acagga-accacac-
A0A3Q2UCA0_BMF-03      aactt--ggcctt----aaacgtggaggcga----acagga-accgcac-
A0A3Q2UCA0_BMF-04      aactt--ggcctt----aaacgtggaggcga----acagga-accgcac-
A9XRH0_BMF-01          aactt--ggcctt----aaacgtggaggcga----acagga-accgcac-
G1NHG8_BMF-01          aactt--ggcctt----aaatgtggaggcga----acagga-accgcac-
A0A669PL85_BMF-01      aactt--ggcctt----aaatgtggaggcga----acagga-accgcac-
U3JS06_BMF-01          aactt--ggcctt----aaacacggaggtga----acagga-accacac-
A0A674GIP8_BMF-03      aactt--ggcctt----aa-------------------------------
A0A674GIP8_BMF-01      aactt--ggcctt----aaacacggaggtga----acagga-accacac-
A0A674GIP8_BMF-02      aactt--ggcctt----aaacacggaggtga----acagga-accacac-
A0A672V891_BMF-01      aactt--ggcctt----aaacgcggaggtga----acagga-accacac-
A0A663DZQ4_BMF-01      aactt--ggcctt----aaacgcggaggtga----acagga-accacac-
A0A663MPI8_BMF-01      aactt--ggcctt----aaatgcggaggcga----acagga-accacac-
A0A670XMZ5_BMF-01      aactt--ggcctt----gaacgtggaagcca----atagac-agcgtgt-
H9GL49_BMF-01          aacgt--ggcctt----gaacatggaggcaa----acagac-atcgtgct
A0A670JUU6_BMF-01      aacgt--ggcgtt----gaacatgg-------------------------
A0A670JUU6_BMF-05      aacgt--ggcgtt----gaacatgg-------------------------
A0A670JUU6_BMF-04      gggaa--gtgaag----gaactctgtggaga----aagaga-atgttgca
A0A670JUU6_BMF-02      agcct--gaaacg----ggactctgctggg--------------------
A0A670JUU6_BMF-03      agcct--gaaacg----ggactctgctggg--------------------
A0A4W3JXA1_BMF-01      gctatg-atcttt----gacccagaagagaatagggcaatg---------
A0A3Q2CXC4_BMF-01      agcctc-ctgttt----gatagggg---gttgattg-----------gt-
A0A3Q2CXC4_BMF-02      tctctc-ctttcc----cctgtggtcccgttgtgct-----------gt-
A0A3B5QK08_BMF-01      agcctc-ctgttt----gatagggg---gtttattgctggaggag--gt-
A0A3B5QK08_BMF-02      agcctc-ctgttt----gatagggg---gtttattgctggaggag--gt-
A0A096LRV0_BMF-01      agcctc-ctgttt----catagggg---gtttattgctggaggag--gt-
A0A3B3WU80_BMF-01      agcctc-ctgttt----catagggg---gtttattgctggaggag--gt-
A0A3P9Q8E2_BMF-01      agcctc-ctgttt----gatagggg---gtttattgctggaggag--gt-
A0A3Q2PJX9_BMF-01      agcctc-ctgctt----gatagggg---gtttgttgctggaagag--gt-
A0A3Q2PJX9_BMF-03      agcctc-ctgctt----gatagggg---gtttgttgctggaagag--gt-
A0A3Q2PJX9_BMF-02      agtgtc-caacct----gctggctc---gcaaattgcctgagtcgcctt-
A0A3Q2YCX7_BMF-01      --------------------------------------------------
A0A3Q2YCX7_BMF-02      --------------------------------------------------
A0A3B5KWG6_BMF-02      agcctt-ctgttt----gacagggg---cttcgtcgctggaggag--ga-
A0A3B5KWG6_BMF-01      agcctt-ctgttt----gacagggg---cttcgtcgctggaggag--ga-
A0A3B5KWG6_BMF-03      agcctt-ctgttt----ga-------------------------------
A0A3B3CGR9_BMF-01      agcctt-ctattg----gatagagg---ctttattgctggagggg--gg-
A0A3P9K487_BMF-01      agcctt-ctattc----gatagagg---ctttattgctggagcag--gg-
A0A3P9K487_BMF-02      agcctt-ctattc----gatagagg---ctttattgctggagcag--gg-
A0A3B3HAU1_BMF-01      agcctt-ctattc----gatagagg---ctttattgctggagcag--gg-
A0A3B3HAU1_BMF-02      agcctt-ctattc----gatagagg---ctttattgctggagcag--gg-
A0A3B3HAU1_BMF-03      agcctt-ctattc----gatagagg---ctttattgctggagcag--gg-
A0A3B3HAU1_BMF-04      agcctt-ctattc----gatagagg---ctttattgctggagcag--gg-
A0A3P9ICE1_BMF-04      agcctt-ctattc----gatagagg---ctttattgctggagcag--gg-
A0A3P9ICE1_BMF-01      agcctt-ctattc----gatagagg---ctttattgctggagcag--gg-
A0A3P9ICE1_BMF-02      agcctt-ctattc----gatagagg---ctttattgctggagcag--gg-
A0A3P9ICE1_BMF-03      agcctt-ctattc----gatagagg---ctttattgctggagcag--gg-
A0A3P9ICE1_BMF-05      agcctt-ctattc----gatagagg---ctttattgctggagcag--gg-
A0A3P8NFE2_BMF-02      atgcaa-caccct----gcaaagtt---caccacagtgtgataac--gg-
A0A668TQU8_BMF-01      -----------------------------------------------gg-
I3K2D6_BMF-01          agcctt-ctgttt----gacagggg---gttcatagccggaggag--gg-
A0A3Q4G1I4_BMF-01      agcctt-ctgttt----gatagggg---gttcatagccggaggag--gg-
A0A3P8NFE2_BMF-01      agcctt-ctgttt----gatagggg---gttcatagccggaggag--gg-
A0A3P9DPJ5_BMF-01      agcctt-ctgttt----gatagggg---gttcatagccggaggag--gg-
A0A3P9DPJ5_BMF-02      agcctt-ctgttt----gatagggg---gttcatagccggaggag--gg-
A0A3B4ETH0_BMF-01      agcctt-ctgttt----gatagggg---gttcatagccggaggag--gg-
A0A3Q3C5V2_BMF-01      agcctt-ctgttt----gatagggg---gttcatagccggcggag--gg-
A0A672HG10_BMF-01      agcctt-ctgttt----gatcgggg---cgtcatcgccggaggag--ga-
A0A3P8UA78_BMF-02      agcctt-ctgttc----aacagagg---gttctttgctgggggag--gc-
A0A3P8UA78_BMF-01      agcctt-ctgttc----aacagagg---gttctttgctgggggag--gc-
A0A3P8UA78_BMF-03      agcctt-ctgttc----aacagagg---gttctttgctgggggag--gc-
A0A3Q3GUU5_BMF-01      agcctt-ctgttt----gacagggg---cttcatcgctgga---------
A0A3Q3VLX6_BMF-01      agcctt-ctgttt----gacagggg---gttctttgctggaggag--gt-
A0A3Q2ZA20_BMF-01      agcctt-ctgttt----gatagggg---gttcattgcgggaggag--gg-
A0A667YNR9_BMF-01      aacctt-cttttt----gacagagg---ggctttcgccggaggag--gt-
A0A3Q3LME3_BMF-01      agc----atgcct----cacc--------ttgataacaggagtgt--gg-
A0A3Q3LME3_BMF-02      agccta-ctgttt----gacagagg---gttcattgctggaggag--gc-
A0A3Q3LME3_BMF-03      agccta-ctgttt----gacagagg---gttcattgctggaggag--gc-
A0A3Q1IPR4_BMF-01      agcctc-ctgttt----gacagggg---attaattgctggaggag--gc-
A0A3Q3QZ16_BMF-01      agcctt-ctgttt----gatagggg---gttcattgctggaggag--gc-
A0A3Q3QZ16_BMF-02      agcctt-ctgttt----gatagggg---gttcattgctggaggag--gc-
A0A665VG08_BMF-01      agcctc-ctgttt----gacagagg---tttaattgctgggggag--gt-
A0A673C8N3_BMF-01      agtctt-ctgttt----gacagagg---gttcattgctggaagag--gt-
A0A3Q1FVH7_BMF-01      agcctt-ctgttt----gacggggg---gttcattgctggaggag--gt-
A0A3Q1FVH7_BMF-02      agcctt-ctgttt----gacggggg---gttcattgctggaggag--gt-
A0A3B5B8F6_BMF-01      agcctt-ctgttt----gacagggg---gttcattgctggaggag--gt-
A0A3Q1D1K3_BMF-01      agcctt-ctgttt----gacagggg---gttcattgctggaggag--gt-
A0A3P8RKY9_BMF-01      agcctt-ctgttt----gacagggg---gttcattgctggaggag--gt-
A0A671X848_BMF-01      aacctt-ctgttt----gacaggag---gttcatcgctggaggag--gt-
A0A0F8AD62_BMF-01      agcctt-ctgttt----gacagggg---gttcattgctggaggag--gt-
A0A4W6DUL1_BMF-01      agcctc-ctgttt----gacagggg---cttcatcgctggaggag--gt-
A0A2U9CJH3_BMF-01      agcctt-ctgttt----gacagggg---gttccttgctggaggag--gt-
A0A3B4U5H8_BMF-01      agcctt-ctgttt----gacagggg---gttaattgctggaggag--gt-
A0A3B4WM88_BMF-01      agcctt-ctgttt----gacagggg---gttaattgctggaggag--gt-
A0A3P8ZIE7_BMF-01      actctg-ctgtgg----gagcagga---ggccgtggctggaggcg--gg-
A0A4W5N3A7_BMF-01      accctg-ctgttt----gagcagga---ggccatcgctggagggg--gg-
A0A6F9BGV6_BMF-01      accctg-ctgttt----gagcagga---ggccatcgctggaaggg-----
A0A1S3SNN2_BMF-01      accctg-ctgttt----gagcagga---ggccattgctggaaggg--gg-
A0A674EF64_BMF-01      accctg-ctgttt----gagcagga---ggccatcgctggaaggg--gg-
A0A1S3P5K4_BMF-01      cccttgtttgttt----tggctag---------tcagtgagcatg--ca-
A0A6F9B4C5_BMF-01      accctg-ctgttt----gagcagga---ggccgtcgctggagggg--gg-
A0A4W5N721_BMF-01      accctg-ctgttt----gagcagga---ggccatcgctggagggg--gg-
A0A1S3P5K4_BMF-02      accctg-ctgttt----gagcagga---ggccatcgctggagggg--ag-
A0A673YQV3_BMF-01      accctg-ctgttt----gagcagga---ggccatcgctggagggg--ag-
A0A4W4DZH9_BMF-01      gct-cc-tgtttg----agagggagcctgcagctcgctgga------gg-
A0A3B4CNJ8_BMF-01      gct-cc-tgtttg----agagagagccggtggctaatggga------gg-
A0A3B1K1X5_BMF-01      gct-cc-tgttcg----agagggagccggcggctcacggga------gg-
A0A3B4B6Y3_BMF-01      aac------------------gggtgagaga----gcac-----------
A0A6I8NF73_BMF-01      aat-ct-ggctct----gggcatggaggaaa----atgggc------ag-
A0A5F8GKJ8_BMF-01      aac-tt-ggcctt----gaacagagaggaga----acagga------at-
G3WDQ2_BMF-01          aat-tt-ggcctt----gaacagagaggaga----acagga------at-
A0A4X2KLG2_BMF-01      aat-tt-ggcctt----gaacagagaggaga----acagga------at-
Q8K589_BMF-01          aac-ct-ggcctt----gaacagacgagaaa----acaggg------aa-
Q91ZE9_BMF-02          aac-ct-cgccct----gaacagacaagaaa----acaggg------aa-
Q91ZE9_BMF-01          aac-ct-cgccct----gaacagacaagaaa----acaggg------aa-
Q91ZE9_BMF-06          aac-ct-cgccct----gaacagacaagaaa----acaggg------aa-
A0A287CXH0_BMF-01      aac-ct-ggcatt----aaatggagatgaga----acaggg------ac-
A0A287CXH0_BMF-02      aac-ct-ggcatt----aaatggagatgaga----acaggg------ac-
A0A671DWL6_BMF-01      aac-ct-cgcttt----gaatggagatgaga----accgga------ac-
A0A671DWL6_BMF-02      aac-ct-cgcttt----gaatggagatgaga----accgga------ac-
A0A2K6FFN3_BMF-01      aac-ct-tgcttt----gaacggagaagaga----acagga------ac-
A0A2K6FFN3_BMF-02      aac-ct-tgcttt----gaacggagaagaga----acagga------ac-
A0A673TA87_BMF-01      aac-ct-ggcctt----gaatgcagaagaga----acagga------at-
L8IXF5_BMF-01          aac-gt-ggcttt----gaatggagatgaga----acagga------ac-
A0A4W2EII1_BMF-01      aac-gt-ggcttt----gaatggagatgaga----acagga------ac-
A0A4W2EII1_BMF-01      aac-gt-ggcttt----gaatggagatgaga----acagga------ac-
Q05KI3_BMF-01          aac-gt-ggcttt----gaatggagatgaga----acagga------ac-
Q05KI3_BMF-02          aac-gt-ggcttt----gaatggagatgaga----acagga------ac-
A0A4W2INA4_BMF-01      aac-gt-ggcttt----gaatggagatgaga----acagga------ac-
A0A4W2INA4_BMF-01      aac-gt-ggcttt----gaatggagatgaga----acagga------ac-
A0A452F2E0_BMF-01      aac-gt-ggcttt----gaatggagatgaga----acagga------at-
A0A452F2E0_BMF-02      aac-gt-ggcttt----gaatggagatgaga----acagga------at-
W5QFV1_BMF-01          aac-gt-ggcttt----gaatggagatgaga----acagga------at-
H0WYH6_BMF-01          aac-ct-ggcttt----gaacggagaagaga----acagga------at-
A0A337ST43_BMF-02      aac-ct-ggcttt----gaatgcagaagaga----acagga------at-
A0A337ST43_BMF-03      aactct-gtctct----gc---caggctata----ccaggat-----at-
A0A337ST43_BMF-05      aactct-gtctct----gc---caggctata----ccaggat-----at-
A0A337ST43_BMF-01      aac-ct-ggcttt----gaatgcagaagaga----acagga------at-
A0A337ST43_BMF-04      aac-ct-ggcttt----gaatgcagaagaga----acagga------at-
A0A667H967_BMF-01      aac-ct-ggcttt----gaatgcagaagaga----acagga------at-
M3YAD5_BMF-01          aac-ct-tgcttt----gaacgcagacgaga----acagga------at-
U6CSY8_BMF-01          aac-ct-tgcttt----gaacgcagatggga----acagga------at-
A0A452SED0_BMF-01      aac-ct-cgcttt----gaacgcagatgaga----acaggg------at-
A0A384D070_BMF-01      aac-ct-cgcttt----gaacgcagatgaga----acaggg------at-
A0A5F4CJ04_BMF-04      aac-ct-ggcttt----gaatgcagatgaga----acagga------at-
A0A5F4CJ04_BMF-03      aac-ct-ggcttt----gaatgcagatgaga----acagga------at-
A0A5F4CJ04_BMF-01      aac-ct-ggcttt----gaatgcagatgaga----acagga------at-
A0A5F4CJ04_BMF-02      aac-ct-ggcttt----gaatgcagatgaga----acagga------at-
A0A4X1UQ42_BMF-01      aac-ct-cgcttt----gcatggagatgaga----acagga------at-
A0A4X1UQ42_BMF-02      aac-ct-cgcttt----gcatggagatgaga----acagga------at-
A0A287AIU8_BMF-01      aac-ct-cgcttt----gcatggagatgaga----acagga------at-
A0A287AIU8_BMF-02      aac-ct-cgcttt----gcatggagatgaga----acagga------at-
A0A3Q2HR24_BMF-01      aac-ct-cgcttt----gaacggagacgaga----acagga------ac-
A0A3Q2HR24_BMF-02      aac-ct-cgcttt----gaacggagacgaga----acagga------ac-
G1SR62_BMF-01          aac-ct-ggctct----gaatggtgacgaga----acaggg------at-
A0A286XXB0_BMF-03      aac-ct-gggtct----gaacggagaagaga----acaggg------aa-
A0A286XXB0_BMF-01      aac-ct-gggtct----gaacggagaagaga----acaggg------aa-
A0A286XXB0_BMF-02      aac-ct-gggtct----gaacggagaagaga----acaggg------aa-
A0A2K5KGP2_BMF-01      aac-ct-tgcttt----gaatggagaagaga----acagga------ac-
A0A0D9R4R5_BMF-01      aac-ct-tgcttt----gaatggagaagaga----acagga------ac-
A0A2K5VLE9_BMF-01      aac-ct-tgcttt----gaatggagaagaga----acagga------ac-
A0A2K5VLE9_BMF-02      aac-ct-tgcttt----gaatggagaagaga----acagga------ac-
A0A096NTE9_BMF-02      aac-ct-tgcttt----gaatggagaagaga----acagga------ac-
A0A096NTE9_BMF-01      aac-ct-tgcttt----gaatggagaagaga----acagga------ac-
A0A096NTE9_BMF-03      aac-ct-tgcttt----gaatggagaagaga----acagga------ac-
A0A5F7ZML1_BMF-01      aac-ct-tgcttt----gaatggagaacaga----acagga------ac-
A0A5F7ZML1_BMF-02      aac-ct-tgcttt----gaatggagaacaga----acagga------ac-
A0A5F7ZML1_BMF-03      aac-ct-tgcttt----gaatggagaacaga----acagga------ac-
A0A2K5MJW4_BMF-01      aac-ct-tgcttt----gaatggagaagaga----acagga------ac-
A0A2K6B5F6_BMF-03      aac-ct-tgcttt----gaatggagaagaga----acagga------ac-
A0A2K5Z4A9_BMF-02      aac-ct-tgcttt----gaatggagaagaga----acagga------ac-
A0A2K5MJW4_BMF-02      aac-ct-tgcttt----gaatggagaagaga----acagga------ac-
A0A2K6B5F6_BMF-01      aac-ct-tgcttt----gaatggagaagaga----acagga------ac-
A0A2K6B5F6_BMF-02      aac-ct-tgcttt----gaatggagaagaga----acagga------ac-
A0A2K6B5F6_BMF-04      aac-ct-tgcttt----gaatggagaagaga----acagga------ac-
A0A2K5Z4A9_BMF-01      aac-ct-tgcttt----gaatggagaagaga----acagga------ac-
A0A2K5KGP2_BMF-02      aac-ct-tgcttt----gaatggagaagaga----acagga------ac-
A0A2K6RAW1_BMF-02      aac-ct-tgcttt----gaatggagaagaga----atag-----------
A0A2K6RAW1_BMF-01      aac-ct-tgcttt----gaatggagaagaga----atagga------ac-
A0A2K6L919_BMF-01      aac-ct-tgcttt----gaatggagaagaga----atagga------ac-
A0A2K6L919_BMF-03      aac-ct-tgcttt----gaatggagaagaga----atagga------ac-
A0A2K6L919_BMF-02      aac-ct-tgcttt----gaatggagaagaga----atagga------ac-
A0A2U4BC98_BMF-01      aac-ct-cgcttt----gaatggagacgaga----acagga------at-
G1PAU1_BMF-01          aac-ct-cgcctt----gaatggagatgaga----acagga------ac-
A0A2I3HD83_BMF-01      aac-ct-tgcttt----gaatggagaagaga----acagga------at-
A0A2K6TW78_BMF-03      aac-ct-ggcttt----gaatggagaagaaa----acagga------at-
A0A2K6TW78_BMF-02      aac-ct-ggcttt----gaatggagaagaaa----acagga------at-
A0A2K6TW78_BMF-01      aac-ct-ggcttt----gaatggagaagaaa----acagga------at-
A0A2J8T301_BMF-01      aac-ct-tgcttt----gaatggagaagaga----acagga------ac-
G3T7Z4_BMF-01          cac-ct-tgctgt----gaacggggaggaga----acagga------at-
A0A2K5RN49_BMF-02      aac-ct-ggcttt----gaatggagaagaga----acagga------at-
A0A2K5RN49_BMF-01      aac-ct-ggcttt----gaatggagaagaga----acagga------at-
F7HZL0_BMF-01          aac-ct-ggcttt----gaatggagaagaga----acagga------at-
A0A2K5E1Q4_BMF-02      aac-ct-ggcttt----gaatggagaagaga----acagga------at-
A0A2K5E1Q4_BMF-01      aac-ct-ggcttt----gaatggagaagaga----acagga------at-
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          aac-ct-tgcttt----gaatggagaagaga----acagga------ac-
Q96LC9_BMF-07          aac-ct-tgcttt----gaatggagaagaga----acagga------ac-
Q96LC9_BMF-01          aac-ct-tgcttt----gaatggagaagaga----acagga------ac-
Q96LC9_BMF-02          aac-ct-tgcttt----gaatggagaagaga----acagga------ac-
Q96LC9_BMF-03          aac-ct-tgcttt----gaatggagaagaga----acagga------ac-
Q96LC9_BMF-04          aac-ct-tgcttt----gaatggagaagaga----acagga------ac-
A0A2J8QDD5_BMF-01      aac-ct-tgcttt----gaatggagaagaga----acagga------ac-
A0A2R9BS98_BMF-02      aac-ct-tgcttt----gaatggagaagaga----acagga------ac-
Q96LC9_BMF-06          aac-ct-tgcttt----gaatggagaagaga----acagga------ac-
A0A2I2Z168_BMF-02      aac-ct-tgcttt----gaatggagaagaga----acagga------ac-
A0A2I2Z168_BMF-01      aac-ct-tgcttt----gaatggagaagaga----acagga------ac-
Q96LC9_BMF-08          --------------------------------------------------
A0A2R9BS98_BMF-01      aac-ct-tgcttt----gaatggagaagaga----acagga------ac-
A0A2J8QDD5_BMF-02      aac-ct-tgcttt----gaatggagaagaga----acagga------ac-
                                                                         

A0A672RK14_BMF-01      --------------------------------------------------
A0A673JJ10_BMF-01      --------------------------------------------------
A0A3B4UNJ0_BMF-01      --------------------------------------------------
W5N4P7_BMF-01          --------------------------------------------------
A3KND0_BMF-01          --------------------------------------------------
Q0GKC7_BMF-01          --------------------------------------------------
A0A671M0H4_BMF-01      --------------------------------------------------
A0A671M0H4_BMF-02      --------------------------------------------------
A0A671MNR9_BMF-01      --------------------------------------------------
A0A672JWL9_BMF-01      --------------------------------------------------
A0A672JWL9_BMF-02      --------------------------------------------------
A0A673HDR4_BMF-01      --------------------------------------------------
A0A3B3RH63_BMF-01      --------------------------------------------------
K7FRX2_BMF-01          --------------------------------------------------
A0A452H3N6_BMF-01      --------------------------------------------------
A0A674IPL3_BMF-01      --------------------------------------------------
A0A493T7X1_BMF-01      --------------------------------------------------
A0A3Q2UCA0_BMF-01      --------------------------------------------------
A0A3Q2UCA0_BMF-02      --------------------------------------------------
A0A669PL85_BMF-02      --------------------------------------------------
A0A493T7X1_BMF-02      --------------------------------------------------
A0A3Q2UCA0_BMF-03      --------------------------------------------------
A0A3Q2UCA0_BMF-04      --------------------------------------------------
A9XRH0_BMF-01          --------------------------------------------------
G1NHG8_BMF-01          --------------------------------------------------
A0A669PL85_BMF-01      --------------------------------------------------
U3JS06_BMF-01          --------------------------------------------------
A0A674GIP8_BMF-03      --------------------------------------------------
A0A674GIP8_BMF-01      --------------------------------------------------
A0A674GIP8_BMF-02      --------------------------------------------------
A0A672V891_BMF-01      --------------------------------------------------
A0A663DZQ4_BMF-01      --------------------------------------------------
A0A663MPI8_BMF-01      --------------------------------------------------
A0A670XMZ5_BMF-01      --------------------------------------------------
H9GL49_BMF-01          ggccgtagttgtaccacaacctattttccttttactgagcctccggtgtg
A0A670JUU6_BMF-01      ------aggccaa-----------------------cagacacca-cgc-
A0A670JUU6_BMF-05      ------aggccaa-----------------------cagacacca-cgc-
A0A670JUU6_BMF-04      aacaacagatgga-----------------------ggagttttggagca
A0A670JUU6_BMF-02      -----cggccgaa-----------------------aaggctccagtgc-
A0A670JUU6_BMF-03      -----cggccgaa-----------------------aaggctccagtgc-
A0A4W3JXA1_BMF-01      --------------------------------------------------
A0A3Q2CXC4_BMF-01      --------------------------------------------------
A0A3Q2CXC4_BMF-02      --------------------------------------------------
A0A3B5QK08_BMF-01      --------------------------------------------------
A0A3B5QK08_BMF-02      --------------------------------------------------
A0A096LRV0_BMF-01      --------------------------------------------------
A0A3B3WU80_BMF-01      --------------------------------------------------
A0A3P9Q8E2_BMF-01      --------------------------------------------------
A0A3Q2PJX9_BMF-01      --------------------------------------------------
A0A3Q2PJX9_BMF-03      --------------------------------------------------
A0A3Q2PJX9_BMF-02      --------------------------------------------------
A0A3Q2YCX7_BMF-01      --------------------------------------------------
A0A3Q2YCX7_BMF-02      --------------------------------------------------
A0A3B5KWG6_BMF-02      --------------------------------------------------
A0A3B5KWG6_BMF-01      --------------------------------------------------
A0A3B5KWG6_BMF-03      --------------------------------------------------
A0A3B3CGR9_BMF-01      --------------------------------------------------
A0A3P9K487_BMF-01      --------------------------------------------------
A0A3P9K487_BMF-02      --------------------------------------------------
A0A3B3HAU1_BMF-01      --------------------------------------------------
A0A3B3HAU1_BMF-02      --------------------------------------------------
A0A3B3HAU1_BMF-03      --------------------------------------------------
A0A3B3HAU1_BMF-04      --------------------------------------------------
A0A3P9ICE1_BMF-04      --------------------------------------------------
A0A3P9ICE1_BMF-01      --------------------------------------------------
A0A3P9ICE1_BMF-02      --------------------------------------------------
A0A3P9ICE1_BMF-03      --------------------------------------------------
A0A3P9ICE1_BMF-05      --------------------------------------------------
A0A3P8NFE2_BMF-02      --------------------------------------------------
A0A668TQU8_BMF-01      --------------------------------------------------
I3K2D6_BMF-01          --------------------------------------------------
A0A3Q4G1I4_BMF-01      --------------------------------------------------
A0A3P8NFE2_BMF-01      --------------------------------------------------
A0A3P9DPJ5_BMF-01      --------------------------------------------------
A0A3P9DPJ5_BMF-02      --------------------------------------------------
A0A3B4ETH0_BMF-01      --------------------------------------------------
A0A3Q3C5V2_BMF-01      --------------------------------------------------
A0A672HG10_BMF-01      --------------------------------------------------
A0A3P8UA78_BMF-02      --------------------------------------------------
A0A3P8UA78_BMF-01      --------------------------------------------------
A0A3P8UA78_BMF-03      --------------------------------------------------
A0A3Q3GUU5_BMF-01      --------------------------------------------------
A0A3Q3VLX6_BMF-01      --------------------------------------------------
A0A3Q2ZA20_BMF-01      --------------------------------------------------
A0A667YNR9_BMF-01      --------------------------------------------------
A0A3Q3LME3_BMF-01      --------------------------------------------------
A0A3Q3LME3_BMF-02      --------------------------------------------------
A0A3Q3LME3_BMF-03      --------------------------------------------------
A0A3Q1IPR4_BMF-01      --------------------------------------------------
A0A3Q3QZ16_BMF-01      --------------------------------------------------
A0A3Q3QZ16_BMF-02      --------------------------------------------------
A0A665VG08_BMF-01      --------------------------------------------------
A0A673C8N3_BMF-01      --------------------------------------------------
A0A3Q1FVH7_BMF-01      --------------------------------------------------
A0A3Q1FVH7_BMF-02      --------------------------------------------------
A0A3B5B8F6_BMF-01      --------------------------------------------------
A0A3Q1D1K3_BMF-01      --------------------------------------------------
A0A3P8RKY9_BMF-01      --------------------------------------------------
A0A671X848_BMF-01      --------------------------------------------------
A0A0F8AD62_BMF-01      --------------------------------------------------
A0A4W6DUL1_BMF-01      --------------------------------------------------
A0A2U9CJH3_BMF-01      --------------------------------------------------
A0A3B4U5H8_BMF-01      --------------------------------------------------
A0A3B4WM88_BMF-01      --------------------------------------------------
A0A3P8ZIE7_BMF-01      --------------------------------------------------
A0A4W5N3A7_BMF-01      --------------------------------------------------
A0A6F9BGV6_BMF-01      --------------------------------------------------
A0A1S3SNN2_BMF-01      --------------------------------------------------
A0A674EF64_BMF-01      --------------------------------------------------
A0A1S3P5K4_BMF-01      --------------------------------------------------
A0A6F9B4C5_BMF-01      --------------------------------------------------
A0A4W5N721_BMF-01      --------------------------------------------------
A0A1S3P5K4_BMF-02      --------------------------------------------------
A0A673YQV3_BMF-01      --------------------------------------------------
A0A4W4DZH9_BMF-01      --------------------------------------------------
A0A3B4CNJ8_BMF-01      --------------------------------------------------
A0A3B1K1X5_BMF-01      --------------------------------------------------
A0A3B4B6Y3_BMF-01      --------------------------------------------------
A0A6I8NF73_BMF-01      --------------------------------------------------
A0A5F8GKJ8_BMF-01      --------------------------------------------------
G3WDQ2_BMF-01          --------------------------------------------------
A0A4X2KLG2_BMF-01      --------------------------------------------------
Q8K589_BMF-01          --------------------------------------------------
Q91ZE9_BMF-02          --------------------------------------------------
Q91ZE9_BMF-01          --------------------------------------------------
Q91ZE9_BMF-06          --------------------------------------------------
A0A287CXH0_BMF-01      --------------------------------------------------
A0A287CXH0_BMF-02      --------------------------------------------------
A0A671DWL6_BMF-01      --------------------------------------------------
A0A671DWL6_BMF-02      --------------------------------------------------
A0A2K6FFN3_BMF-01      --------------------------------------------------
A0A2K6FFN3_BMF-02      --------------------------------------------------
A0A673TA87_BMF-01      --------------------------------------------------
L8IXF5_BMF-01          --------------------------------------------------
A0A4W2EII1_BMF-01      --------------------------------------------------
A0A4W2EII1_BMF-01      --------------------------------------------------
Q05KI3_BMF-01          --------------------------------------------------
Q05KI3_BMF-02          --------------------------------------------------
A0A4W2INA4_BMF-01      --------------------------------------------------
A0A4W2INA4_BMF-01      --------------------------------------------------
A0A452F2E0_BMF-01      --------------------------------------------------
A0A452F2E0_BMF-02      --------------------------------------------------
W5QFV1_BMF-01          --------------------------------------------------
H0WYH6_BMF-01          --------------------------------------------------
A0A337ST43_BMF-02      --------------------------------------------------
A0A337ST43_BMF-03      --------------------------------------------------
A0A337ST43_BMF-05      --------------------------------------------------
A0A337ST43_BMF-01      --------------------------------------------------
A0A337ST43_BMF-04      --------------------------------------------------
A0A667H967_BMF-01      --------------------------------------------------
M3YAD5_BMF-01          --------------------------------------------------
U6CSY8_BMF-01          --------------------------------------------------
A0A452SED0_BMF-01      --------------------------------------------------
A0A384D070_BMF-01      --------------------------------------------------
A0A5F4CJ04_BMF-04      --------------------------------------------------
A0A5F4CJ04_BMF-03      --------------------------------------------------
A0A5F4CJ04_BMF-01      --------------------------------------------------
A0A5F4CJ04_BMF-02      --------------------------------------------------
A0A4X1UQ42_BMF-01      --------------------------------------------------
A0A4X1UQ42_BMF-02      --------------------------------------------------
A0A287AIU8_BMF-01      --------------------------------------------------
A0A287AIU8_BMF-02      --------------------------------------------------
A0A3Q2HR24_BMF-01      --------------------------------------------------
A0A3Q2HR24_BMF-02      --------------------------------------------------
G1SR62_BMF-01          --------------------------------------------------
A0A286XXB0_BMF-03      --------------------------------------------------
A0A286XXB0_BMF-01      --------------------------------------------------
A0A286XXB0_BMF-02      --------------------------------------------------
A0A2K5KGP2_BMF-01      --------------------------------------------------
A0A0D9R4R5_BMF-01      --------------------------------------------------
A0A2K5VLE9_BMF-01      --------------------------------------------------
A0A2K5VLE9_BMF-02      --------------------------------------------------
A0A096NTE9_BMF-02      --------------------------------------------------
A0A096NTE9_BMF-01      --------------------------------------------------
A0A096NTE9_BMF-03      --------------------------------------------------
A0A5F7ZML1_BMF-01      --------------------------------------------------
A0A5F7ZML1_BMF-02      --------------------------------------------------
A0A5F7ZML1_BMF-03      --------------------------------------------------
A0A2K5MJW4_BMF-01      --------------------------------------------------
A0A2K6B5F6_BMF-03      --------------------------------------------------
A0A2K5Z4A9_BMF-02      --------------------------------------------------
A0A2K5MJW4_BMF-02      --------------------------------------------------
A0A2K6B5F6_BMF-01      --------------------------------------------------
A0A2K6B5F6_BMF-02      --------------------------------------------------
A0A2K6B5F6_BMF-04      --------------------------------------------------
A0A2K5Z4A9_BMF-01      --------------------------------------------------
A0A2K5KGP2_BMF-02      --------------------------------------------------
A0A2K6RAW1_BMF-02      --------------------------------------------------
A0A2K6RAW1_BMF-01      --------------------------------------------------
A0A2K6L919_BMF-01      --------------------------------------------------
A0A2K6L919_BMF-03      --------------------------------------------------
A0A2K6L919_BMF-02      --------------------------------------------------
A0A2U4BC98_BMF-01      --------------------------------------------------
G1PAU1_BMF-01          --------------------------------------------------
A0A2I3HD83_BMF-01      --------------------------------------------------
A0A2K6TW78_BMF-03      --------------------------------------------------
A0A2K6TW78_BMF-02      --------------------------------------------------
A0A2K6TW78_BMF-01      --------------------------------------------------
A0A2J8T301_BMF-01      --------------------------------------------------
G3T7Z4_BMF-01          --------------------------------------------------
A0A2K5RN49_BMF-02      --------------------------------------------------
A0A2K5RN49_BMF-01      --------------------------------------------------
F7HZL0_BMF-01          --------------------------------------------------
A0A2K5E1Q4_BMF-02      --------------------------------------------------
A0A2K5E1Q4_BMF-01      --------------------------------------------------
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          --------------------------------------------------
Q96LC9_BMF-02          --------------------------------------------------
Q96LC9_BMF-03          --------------------------------------------------
Q96LC9_BMF-04          --------------------------------------------------
A0A2J8QDD5_BMF-01      --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
Q96LC9_BMF-06          --------------------------------------------------
A0A2I2Z168_BMF-02      --------------------------------------------------
A0A2I2Z168_BMF-01      --------------------------------------------------
Q96LC9_BMF-08          --------------------------------------------------
A0A2R9BS98_BMF-01      --------------------------------------------------
A0A2J8QDD5_BMF-02      --------------------------------------------------
                                                                         

A0A672RK14_BMF-01      -----------------t--------------------------------
A0A673JJ10_BMF-01      -----------------tgctcagtgggaga-------------------
A0A3B4UNJ0_BMF-01      -----------------aga------gcaga-------------------
W5N4P7_BMF-01          -----------------cgt------ggtga--------------cca--
A3KND0_BMF-01          -----------------gta------------------------------
Q0GKC7_BMF-01          --------------------------gcagg-------------------
A0A671M0H4_BMF-01      --------------------------------------------------
A0A671M0H4_BMF-02      --------------------------------------------------
A0A671MNR9_BMF-01      --------------------------gcagg-------------------
A0A672JWL9_BMF-01      --------------------------gtagg-------------------
A0A672JWL9_BMF-02      --------------------------tttga-------------------
A0A673HDR4_BMF-01      --------------------------------------------------
A0A3B3RH63_BMF-01      -----------------aga------gcaga--------------gca--
K7FRX2_BMF-01          -----------------aggtcag----ag--------------------
A0A452H3N6_BMF-01      -----------------aggtcag----ag--------------------
A0A674IPL3_BMF-01      -----------------aggtcag----ag--------------------
A0A493T7X1_BMF-01      -----------------taggc----------------------------
A0A3Q2UCA0_BMF-01      -----------------aaggcagccgcag-----------gctaccg--
A0A3Q2UCA0_BMF-02      -----------------aaggcagccgcag-----------gctaccg--
A0A669PL85_BMF-02      -----------------agggcagccatag--------------------
A0A493T7X1_BMF-02      -----------------tgggcag----ag--------------------
A0A3Q2UCA0_BMF-03      -----------------tgggcag----ag--------------------
A0A3Q2UCA0_BMF-04      -----------------tgggcag----ag--------------------
A9XRH0_BMF-01          -----------------tgggcag----ag--------------------
G1NHG8_BMF-01          -----------------tgggcag----ag--------------------
A0A669PL85_BMF-01      -----------------tgggcag----ag--------------------
U3JS06_BMF-01          -----------------tgggcag----ag--------------------
A0A674GIP8_BMF-03      --------------------------------------------------
A0A674GIP8_BMF-01      -----------------tgggcag----agaaatcactggctttgttt--
A0A674GIP8_BMF-02      -----------------tgggcag----ag--------------------
A0A672V891_BMF-01      -----------------tgggcag----ag--------------------
A0A663DZQ4_BMF-01      -----------------tgggcag----ag--------------------
A0A663MPI8_BMF-01      -----------------tgggcag----ag--------------------
A0A670XMZ5_BMF-01      -----------------gggtcag----agg-------------------
H9GL49_BMF-01          ttttccattctctgaaatgctgcc----aagattctgtctagagg--c--
A0A670JUU6_BMF-01      -----------------gggtcgg----agctttatccatggccactc--
A0A670JUU6_BMF-05      -----------------gggtcgg----ag--------------------
A0A670JUU6_BMF-04      ggaggtgcaccctaggaagcccac----ggaacac-gtaatac----c--
A0A670JUU6_BMF-02      ----ttgtctcc-----agctcag----aggacactgtggtgcatctc--
A0A670JUU6_BMF-03      ----ttgtctcc-----agctcag----aggacactgtggtgcatctc--
A0A4W3JXA1_BMF-01      --------------------------ccagg--------------tca--
A0A3Q2CXC4_BMF-01      -----------------gga------gcagg--------------atg--
A0A3Q2CXC4_BMF-02      -----------------gga------ggcaa--------------gtg--
A0A3B5QK08_BMF-01      -----------------gga------gcagg--------------acg--
A0A3B5QK08_BMF-02      -----------------gga------gcagg--------------acg--
A0A096LRV0_BMF-01      -----------------gga------gcagg--------------acg--
A0A3B3WU80_BMF-01      -----------------gga------gcagg--------------acg--
A0A3P9Q8E2_BMF-01      -----------------gga------gcagg--------------acg--
A0A3Q2PJX9_BMF-01      -----------------gga------gccgg--------------acg--
A0A3Q2PJX9_BMF-03      -----------------gga------gccgg--------------acg--
A0A3Q2PJX9_BMF-02      -----------------gct------gccga--------------act--
A0A3Q2YCX7_BMF-01      ---------------------------------------------aca--
A0A3Q2YCX7_BMF-02      ---------------------------------------------aca--
A0A3B5KWG6_BMF-02      -----------------gga------gcggg--------------gcg--
A0A3B5KWG6_BMF-01      -----------------gga------gcggg--------------gcg--
A0A3B5KWG6_BMF-03      --------------------------------------------------
A0A3B3CGR9_BMF-01      -----------------ggt------gcagg--------------aca--
A0A3P9K487_BMF-01      -----------------ggt------gcagg--------------aca--
A0A3P9K487_BMF-02      -----------------ggt------gcagg--------------aca--
A0A3B3HAU1_BMF-01      -----------------ggt------gcagg--------------aca--
A0A3B3HAU1_BMF-02      -----------------ggt------gcagg--------------aca--
A0A3B3HAU1_BMF-03      -----------------ggt------gcagg--------------aca--
A0A3B3HAU1_BMF-04      -----------------ggt------gcagg--------------aca--
A0A3P9ICE1_BMF-04      -----------------ggt------gcagg--------------aca--
A0A3P9ICE1_BMF-01      -----------------ggt------gcagg--------------aca--
A0A3P9ICE1_BMF-02      -----------------ggt------gcagg--------------aca--
A0A3P9ICE1_BMF-03      -----------------ggt------gcagg--------------aca--
A0A3P9ICE1_BMF-05      -----------------ggt------gcagg--------------aca--
A0A3P8NFE2_BMF-02      -----------------tat------ggaaacccagaggcttatcaca--
A0A668TQU8_BMF-01      -----------------tga------ggagg--------------atg--
I3K2D6_BMF-01          -----------------ggt------ggagg--------------acg--
A0A3Q4G1I4_BMF-01      -----------------ggt------ggagg--------------acg--
A0A3P8NFE2_BMF-01      -----------------ggt------ggagg--------------acg--
A0A3P9DPJ5_BMF-01      -----------------ggt------ggagg--------------acg--
A0A3P9DPJ5_BMF-02      -----------------ggt------ggagg--------------acg--
A0A3B4ETH0_BMF-01      -----------------ggt------ggagg--------------acg--
A0A3Q3C5V2_BMF-01      -----------------ggt------ggagg--------------acg--
A0A672HG10_BMF-01      -----------------ggaggcggtgcggg--------------acg--
A0A3P8UA78_BMF-02      -----------------gca------gcggg--------------acg--
A0A3P8UA78_BMF-01      -----------------gca------gcggg--------------acg--
A0A3P8UA78_BMF-03      -----------------gca------gcggg--------------acg--
A0A3Q3GUU5_BMF-01      --------------------------gcagg--------------acg--
A0A3Q3VLX6_BMF-01      -----------------gga------gcggg--------------acg--
A0A3Q2ZA20_BMF-01      -----------------ggt------gcagg--------------acg--
A0A667YNR9_BMF-01      -----------------gga------gcagg--------------acg--
A0A3Q3LME3_BMF-01      -----------------aga------gaggg--------------a----
A0A3Q3LME3_BMF-02      -----------------aga------gcagg--------------acg--
A0A3Q3LME3_BMF-03      -----------------aga------gcagg--------------acg--
A0A3Q1IPR4_BMF-01      -----------------gga------gcagg--------------acg--
A0A3Q3QZ16_BMF-01      -----------------gga------gcggg--------------acg--
A0A3Q3QZ16_BMF-02      -----------------gga------gcggg--------------acg--
A0A665VG08_BMF-01      -----------------gga------gcagg--------------acg--
A0A673C8N3_BMF-01      -----------------gga------gcagg--------------aca--
A0A3Q1FVH7_BMF-01      -----------------ggt------gcagg--------------acg--
A0A3Q1FVH7_BMF-02      -----------------ggt------gcagg--------------acg--
A0A3B5B8F6_BMF-01      -----------------ggt------gcagg--------------acg--
A0A3Q1D1K3_BMF-01      -----------------ggt------gcagg--------------acg--
A0A3P8RKY9_BMF-01      -----------------ggt------gcagg--------------acg--
A0A671X848_BMF-01      -----------------gga------gcggg--------------acg--
A0A0F8AD62_BMF-01      -----------------gga------gcggg--------------acg--
A0A4W6DUL1_BMF-01      -----------------gga------gcagg--------------acg--
A0A2U9CJH3_BMF-01      -----------------gga------gcggg--------------acg--
A0A3B4U5H8_BMF-01      -----------------gga------gcagg--------------acg--
A0A3B4WM88_BMF-01      -----------------gga------gcagg--------------acg--
A0A3P8ZIE7_BMF-01      -----------------aga------gccgg--------------gtg--
A0A4W5N3A7_BMF-01      -----------------aga------gcagg--------------gtg--
A0A6F9BGV6_BMF-01      -----------------------------------------------g--
A0A1S3SNN2_BMF-01      -----------------aga------gcagg--------------gtg--
A0A674EF64_BMF-01      -----------------aga------gcagg--------------gtg--
A0A1S3P5K4_BMF-01      -----------------tta------gccca--------------gtgtt
A0A6F9B4C5_BMF-01      -----------------aga------gcagg--------------gtg--
A0A4W5N721_BMF-01      -----------------aga------gcagg--------------gtg--
A0A1S3P5K4_BMF-02      -----------------aga------gcagg--------------gtg--
A0A673YQV3_BMF-01      -----------------aga------gcagg--------------gtg--
A0A4W4DZH9_BMF-01      -----------------ggg------gtgga--------------cca--
A0A3B4CNJ8_BMF-01      -----------------aga------gtgga--------------cca--
A0A3B1K1X5_BMF-01      -----------------cga------gagga--------------ccg--
A0A3B4B6Y3_BMF-01      --------------------------------------------------
A0A6I8NF73_BMF-01      -----------------gga------ggggg--------------ccc--
A0A5F8GKJ8_BMF-01      -----------------ggg------gcagg--------------ccc--
G3WDQ2_BMF-01          -----------------ggg------gcagg--------------ccc--
A0A4X2KLG2_BMF-01      -----------------ggg------gcagg--------------ccc--
Q8K589_BMF-01          -----------------ggg------gtggg--------------tcc--
Q91ZE9_BMF-02          -----------------ggg------gtggg--------------gcc--
Q91ZE9_BMF-01          -----------------ggg------gtggg--------------gcc--
Q91ZE9_BMF-06          -----------------ggg------gtggg--------------gcc--
A0A287CXH0_BMF-01      -----------------cgg------gcagg--------------tcc--
A0A287CXH0_BMF-02      -----------------cgg------gcagg--------------tcc--
A0A671DWL6_BMF-01      -----------------ggg------gcagg--------------tcc--
A0A671DWL6_BMF-02      -----------------ggg------gcagg--------------tcc--
A0A2K6FFN3_BMF-01      -----------------ggg------gcagg--------------tcc--
A0A2K6FFN3_BMF-02      -----------------ggg------gcagg--------------tcc--
A0A673TA87_BMF-01      -----------------ggg------gcagg--------------tcc--
L8IXF5_BMF-01          -----------------ggg------gcagg--------------ccc--
A0A4W2EII1_BMF-01      -----------------ggg------gcagg--------------ccc--
A0A4W2EII1_BMF-01      -----------------ggg------gcagg--------------ccc--
Q05KI3_BMF-01          -----------------ggg------gcagg--------------ccc--
Q05KI3_BMF-02          -----------------ggg------gcagg--------------ccc--
A0A4W2INA4_BMF-01      -----------------ggg------gcagg--------------ccc--
A0A4W2INA4_BMF-01      -----------------ggg------gcagg--------------ccc--
A0A452F2E0_BMF-01      -----------------ggg------gcagg--------------ccc--
A0A452F2E0_BMF-02      -----------------ggg------gcagg--------------ccc--
W5QFV1_BMF-01          -----------------ggg------gcagg--------------ccc--
H0WYH6_BMF-01          -----------------ggg------gcagg--------------tcc--
A0A337ST43_BMF-02      -----------------ggg------gcagg--------------tcc--
A0A337ST43_BMF-03      -----------------------------gg--------------tcc--
A0A337ST43_BMF-05      -----------------------------gg--------------tcc--
A0A337ST43_BMF-01      -----------------ggg------gcagg--------------tcc--
A0A337ST43_BMF-04      -----------------ggg------gcagg--------------tcc--
A0A667H967_BMF-01      -----------------ggg------gcagg--------------tcc--
M3YAD5_BMF-01          -----------------ggg------gcggg--------------tcc--
U6CSY8_BMF-01          -----------------ggg------gcggg--------------tcc--
A0A452SED0_BMF-01      -----------------ggg------gcagg--------------tcc--
A0A384D070_BMF-01      -----------------ggg------gcagg--------------tcc--
A0A5F4CJ04_BMF-04      -----------------ggg------gcagg--------------tcc--
A0A5F4CJ04_BMF-03      -----------------ggg------gcagg--------------tcc--
A0A5F4CJ04_BMF-01      -----------------ggg------gcagg--------------tcc--
A0A5F4CJ04_BMF-02      -----------------ggg------gcagg--------------tcc--
A0A4X1UQ42_BMF-01      -----------------ggg------gcagg--------------tcc--
A0A4X1UQ42_BMF-02      -----------------ggg------gcagg--------------tcc--
A0A287AIU8_BMF-01      -----------------ggg------gcagg--------------tcc--
A0A287AIU8_BMF-02      -----------------ggg------gcagg--------------tcc--
A0A3Q2HR24_BMF-01      -----------------ggg------gcagg--------------tcc--
A0A3Q2HR24_BMF-02      -----------------ggg------gcagg--------------tcc--
G1SR62_BMF-01          -----------------ggg------gcagg--------------tcc--
A0A286XXB0_BMF-03      -----------------ggg------gcagg--------------tcc--
A0A286XXB0_BMF-01      -----------------ggg------gcagg--------------tcc--
A0A286XXB0_BMF-02      -----------------ggg------gcagg--------------tcc--
A0A2K5KGP2_BMF-01      -----------------ggg------gcggg--------------ccc--
A0A0D9R4R5_BMF-01      -----------------ggg------gcggg--------------ccc--
A0A2K5VLE9_BMF-01      -----------------ggg------gcggg--------------ccc--
A0A2K5VLE9_BMF-02      -----------------ggg------gcggg--------------ccc--
A0A096NTE9_BMF-02      -----------------ggg------gtgga--------------ccc--
A0A096NTE9_BMF-01      -----------------ggg------gtgga--------------ccc--
A0A096NTE9_BMF-03      -----------------ggg------gtgga--------------ccc--
A0A5F7ZML1_BMF-01      -----------------ggg------gcggg--------------ccc--
A0A5F7ZML1_BMF-02      -----------------ggg------gcggg--------------ccc--
A0A5F7ZML1_BMF-03      -----------------ggg------gcggg--------------ccc--
A0A2K5MJW4_BMF-01      -----------------ggg------gcggg--------------ccc--
A0A2K6B5F6_BMF-03      -----------------ggg------gcggg--------------ccc--
A0A2K5Z4A9_BMF-02      -----------------ggg------gcggg--------------ccc--
A0A2K5MJW4_BMF-02      -----------------ggg------gcggg--------------ccc--
A0A2K6B5F6_BMF-01      -----------------ggg------gcggg--------------ccc--
A0A2K6B5F6_BMF-02      -----------------ggg------gcggg--------------ccc--
A0A2K6B5F6_BMF-04      -----------------ggg------gcggg--------------ccc--
A0A2K5Z4A9_BMF-01      -----------------ggg------gcggg--------------ccc--
A0A2K5KGP2_BMF-02      -----------------ggg------gcggg--------------ccc--
A0A2K6RAW1_BMF-02      --------------------------------------------------
A0A2K6RAW1_BMF-01      -----------------ggg------gcggg--------------ccc--
A0A2K6L919_BMF-01      -----------------ggg------gcggg--------------ccc--
A0A2K6L919_BMF-03      -----------------ggg------gcggg--------------ccc--
A0A2K6L919_BMF-02      -----------------ggg------gcggg--------------ccc--
A0A2U4BC98_BMF-01      -----------------ggg------gcggg--------------tcc--
G1PAU1_BMF-01          -----------------ggg------gccgg--------------tcc--
A0A2I3HD83_BMF-01      -----------------ggg------gcagg--------------ccc--
A0A2K6TW78_BMF-03      -----------------ggg------gcagg--------------tcc--
A0A2K6TW78_BMF-02      -----------------ggg------gcagg--------------tcc--
A0A2K6TW78_BMF-01      -----------------ggg------gcagg--------------tcc--
A0A2J8T301_BMF-01      -----------------ggg------gcagg--------------ccc--
G3T7Z4_BMF-01          -----------------ggg------gcagg--------------tcc--
A0A2K5RN49_BMF-02      -----------------ggg------gcagg--------------cct--
A0A2K5RN49_BMF-01      -----------------ggg------gcagg--------------cct--
F7HZL0_BMF-01          -----------------ggg------gcagg--------------ccc--
A0A2K5E1Q4_BMF-02      -----------------ggg------gcagg--------------ccc--
A0A2K5E1Q4_BMF-01      -----------------ggg------gcagg--------------ccc--
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          -----------------ggg------gcagg--------------ccc--
Q96LC9_BMF-07          -----------------ggg------gcagg--------------ccc--
Q96LC9_BMF-01          -----------------ggg------gcagg--------------ccc--
Q96LC9_BMF-02          -----------------ggg------gcagg--------------ccc--
Q96LC9_BMF-03          -----------------ggg------gcagg--------------ccc--
Q96LC9_BMF-04          -----------------ggg------gcagg--------------ccc--
A0A2J8QDD5_BMF-01      -----------------ggg------gcagg--------------ccc--
A0A2R9BS98_BMF-02      -----------------ggg------gcagg--------------ccc--
Q96LC9_BMF-06          -----------------ggg------gcagg--------------ccc--
A0A2I2Z168_BMF-02      -----------------ggg------gcagg--------------ccc--
A0A2I2Z168_BMF-01      -----------------ggg------gcagg--------------ccc--
Q96LC9_BMF-08          --------------------------------------------------
A0A2R9BS98_BMF-01      -----------------ggg------gcagg--------------ccc--
A0A2J8QDD5_BMF-02      -----------------ggg------gcagg--------------ccc--
                                                                         

A0A672RK14_BMF-01      --------------------------a-----------------------
A0A673JJ10_BMF-01      -------------------------ga-----------------------
A0A3B4UNJ0_BMF-01      -------------------------ga-----------------------
W5N4P7_BMF-01          -------------------------gag----------------------
A3KND0_BMF-01          --------------------------------------------------
Q0GKC7_BMF-01          --------------------------------------------------
A0A671M0H4_BMF-01      --------------------------------------------------
A0A671M0H4_BMF-02      --------------------------------------------------
A0A671MNR9_BMF-01      --------------------------------------------------
A0A672JWL9_BMF-01      --------------------------------------------------
A0A672JWL9_BMF-02      --------------------------------------------------
A0A673HDR4_BMF-01      --------------------------------------------------
A0A3B3RH63_BMF-01      -------------------------gag----------------------
K7FRX2_BMF-01          --------------------------------------------------
A0A452H3N6_BMF-01      --------------------------------------------------
A0A674IPL3_BMF-01      --------------------------------------------------
A0A493T7X1_BMF-01      --------------------------------------------------
A0A3Q2UCA0_BMF-01      -------------------------gca----------------------
A0A3Q2UCA0_BMF-02      -------------------------gca----------------------
A0A669PL85_BMF-02      --------------------------------------------------
A0A493T7X1_BMF-02      --------------------------------------------------
A0A3Q2UCA0_BMF-03      --------------------------------------------------
A0A3Q2UCA0_BMF-04      --------------------------------------------------
A9XRH0_BMF-01          --------------------------------------------------
G1NHG8_BMF-01          --------------------------------------------------
A0A669PL85_BMF-01      --------------------------------------------------
U3JS06_BMF-01          --------------------------------------------------
A0A674GIP8_BMF-03      --------------------------------------------------
A0A674GIP8_BMF-01      -------------------------aaa----------------------
A0A674GIP8_BMF-02      --------------------------------------------------
A0A672V891_BMF-01      --------------------------------------------------
A0A663DZQ4_BMF-01      --------------------------------------------------
A0A663MPI8_BMF-01      --------------------------------------------------
A0A670XMZ5_BMF-01      --------------------------------------------------
H9GL49_BMF-01          -------------------------tat----------------------
A0A670JUU6_BMF-01      -------------------------agc----------------------
A0A670JUU6_BMF-05      --------------------------------------------------
A0A670JUU6_BMF-04      -------------------------aaa----------------------
A0A670JUU6_BMF-02      -------------------------tga----------------------
A0A670JUU6_BMF-03      -------------------------tga----------------------
A0A4W3JXA1_BMF-01      -------------------------aag----------------------
A0A3Q2CXC4_BMF-01      -------------------------gag----------------------
A0A3Q2CXC4_BMF-02      -------------------------gca----------------------
A0A3B5QK08_BMF-01      -------------------------gag----------------------
A0A3B5QK08_BMF-02      -------------------------gag----------------------
A0A096LRV0_BMF-01      -------------------------gag----------------------
A0A3B3WU80_BMF-01      -------------------------gag----------------------
A0A3P9Q8E2_BMF-01      -------------------------gag----------------------
A0A3Q2PJX9_BMF-01      -------------------------gag----------------------
A0A3Q2PJX9_BMF-03      -------------------------gag----------------------
A0A3Q2PJX9_BMF-02      -------------------------gct----------------------
A0A3Q2YCX7_BMF-01      -------------------------aa-----------------------
A0A3Q2YCX7_BMF-02      -------------------------aa-----------------------
A0A3B5KWG6_BMF-02      -------------------------gag----------------------
A0A3B5KWG6_BMF-01      -------------------------gag----------------------
A0A3B5KWG6_BMF-03      --------------------------------------------------
A0A3B3CGR9_BMF-01      -------------------------aag----------------------
A0A3P9K487_BMF-01      -------------------------aag----------------------
A0A3P9K487_BMF-02      -------------------------aag----------------------
A0A3B3HAU1_BMF-01      -------------------------aag----------------------
A0A3B3HAU1_BMF-02      -------------------------aag----------------------
A0A3B3HAU1_BMF-03      -------------------------aag----------------------
A0A3B3HAU1_BMF-04      -------------------------aag----------------------
A0A3P9ICE1_BMF-04      -------------------------aag----------------------
A0A3P9ICE1_BMF-01      -------------------------aag----------------------
A0A3P9ICE1_BMF-02      -------------------------aag----------------------
A0A3P9ICE1_BMF-03      -------------------------aag----------------------
A0A3P9ICE1_BMF-05      -------------------------aag----------------------
A0A3P8NFE2_BMF-02      -------------------------gtg----------------------
A0A668TQU8_BMF-01      -------------------------gat----------------------
I3K2D6_BMF-01          -------------------------gag----------------------
A0A3Q4G1I4_BMF-01      -------------------------gag----------------------
A0A3P8NFE2_BMF-01      -------------------------gag----------------------
A0A3P9DPJ5_BMF-01      -------------------------gag----------------------
A0A3P9DPJ5_BMF-02      -------------------------gag----------------------
A0A3B4ETH0_BMF-01      -------------------------gag----------------------
A0A3Q3C5V2_BMF-01      -------------------------gag----------------------
A0A672HG10_BMF-01      -------------------------gag----------------------
A0A3P8UA78_BMF-02      -------------------------gag----------------------
A0A3P8UA78_BMF-01      -------------------------gag----------------------
A0A3P8UA78_BMF-03      -------------------------gag----------------------
A0A3Q3GUU5_BMF-01      -------------------------gag----------------------
A0A3Q3VLX6_BMF-01      -------------------------gag----------------------
A0A3Q2ZA20_BMF-01      -------------------------gag----------------------
A0A667YNR9_BMF-01      -------------------------gag----------------------
A0A3Q3LME3_BMF-01      --------------------------------------------------
A0A3Q3LME3_BMF-02      -------------------------gag----------------------
A0A3Q3LME3_BMF-03      -------------------------gag----------------------
A0A3Q1IPR4_BMF-01      -------------------------gag----------------------
A0A3Q3QZ16_BMF-01      -------------------------gag----------------------
A0A3Q3QZ16_BMF-02      -------------------------gag----------------------
A0A665VG08_BMF-01      -------------------------gag----------------------
A0A673C8N3_BMF-01      -------------------------gag----------------------
A0A3Q1FVH7_BMF-01      -------------------------gag----------------------
A0A3Q1FVH7_BMF-02      -------------------------gag----------------------
A0A3B5B8F6_BMF-01      -------------------------gag----------------------
A0A3Q1D1K3_BMF-01      -------------------------gag----------------------
A0A3P8RKY9_BMF-01      -------------------------gag----------------------
A0A671X848_BMF-01      -------------------------gag----------------------
A0A0F8AD62_BMF-01      -------------------------gag----------------------
A0A4W6DUL1_BMF-01      -------------------------gag----------------------
A0A2U9CJH3_BMF-01      -------------------------gag----------------------
A0A3B4U5H8_BMF-01      -------------------------gag----------------------
A0A3B4WM88_BMF-01      -------------------------gag----------------------
A0A3P8ZIE7_BMF-01      -------------------------gag----------------------
A0A4W5N3A7_BMF-01      -------------------------gag----------------------
A0A6F9BGV6_BMF-01      -------------------------gag----------------------
A0A1S3SNN2_BMF-01      -------------------------gag----------------------
A0A674EF64_BMF-01      -------------------------gag----------------------
A0A1S3P5K4_BMF-01      ctgacctctcattctacccccccaagac----------------------
A0A6F9B4C5_BMF-01      -------------------------gag----------------------
A0A4W5N721_BMF-01      -------------------------gag----------------------
A0A1S3P5K4_BMF-02      -------------------------gag----------------------
A0A673YQV3_BMF-01      -------------------------gag----------------------
A0A4W4DZH9_BMF-01      -------------------------gag----------------------
A0A3B4CNJ8_BMF-01      -------------------------gag----------------------
A0A3B1K1X5_BMF-01      -------------------------gag----------------------
A0A3B4B6Y3_BMF-01      --------------------------------------------------
A0A6I8NF73_BMF-01      -------------------------cag----------------------
A0A5F8GKJ8_BMF-01      -------------------------tag----------------------
G3WDQ2_BMF-01          -------------------------tag----------------------
A0A4X2KLG2_BMF-01      -------------------------tag----------------------
Q8K589_BMF-01          -------------------------ctg----------------------
Q91ZE9_BMF-02          -------------------------ctg----------------------
Q91ZE9_BMF-01          -------------------------ctg----------------------
Q91ZE9_BMF-06          -------------------------ctg----------------------
A0A287CXH0_BMF-01      -------------------------tag----------------------
A0A287CXH0_BMF-02      -------------------------tag----------------------
A0A671DWL6_BMF-01      -------------------------cag----------------------
A0A671DWL6_BMF-02      -------------------------cag----------------------
A0A2K6FFN3_BMF-01      -------------------------cag----------------------
A0A2K6FFN3_BMF-02      -------------------------cag----------------------
A0A673TA87_BMF-01      -------------------------cag----------------------
L8IXF5_BMF-01          -------------------------cag----------------------
A0A4W2EII1_BMF-01      -------------------------cag----------------------
A0A4W2EII1_BMF-01      -------------------------cag----------------------
Q05KI3_BMF-01          -------------------------cag----------------------
Q05KI3_BMF-02          -------------------------cag----------------------
A0A4W2INA4_BMF-01      -------------------------cag----------------------
A0A4W2INA4_BMF-01      -------------------------cag----------------------
A0A452F2E0_BMF-01      -------------------------cag----------------------
A0A452F2E0_BMF-02      -------------------------cag----------------------
W5QFV1_BMF-01          -------------------------cag----------------------
H0WYH6_BMF-01          -------------------------cag----------------------
A0A337ST43_BMF-02      -------------------------cag----------------------
A0A337ST43_BMF-03      -------------------------cag----------------------
A0A337ST43_BMF-05      -------------------------cag----------------------
A0A337ST43_BMF-01      -------------------------cag----------------------
A0A337ST43_BMF-04      -------------------------cag----------------------
A0A667H967_BMF-01      -------------------------cag----------------------
M3YAD5_BMF-01          -------------------------cag----------------------
U6CSY8_BMF-01          -------------------------cag----------------------
A0A452SED0_BMF-01      -------------------------cag----------------------
A0A384D070_BMF-01      -------------------------cag----------------------
A0A5F4CJ04_BMF-04      -------------------------cag----------------------
A0A5F4CJ04_BMF-03      -------------------------cag----------------------
A0A5F4CJ04_BMF-01      -------------------------cag----------------------
A0A5F4CJ04_BMF-02      -------------------------cag----------------------
A0A4X1UQ42_BMF-01      -------------------------cag----------------------
A0A4X1UQ42_BMF-02      -------------------------cag----------------------
A0A287AIU8_BMF-01      -------------------------cag----------------------
A0A287AIU8_BMF-02      -------------------------cag----------------------
A0A3Q2HR24_BMF-01      -------------------------cagcttccagccaggccaggagggt
A0A3Q2HR24_BMF-02      -------------------------cag-gtgtggtaaaaatgtgagggg
G1SR62_BMF-01          -------------------------tag----------------------
A0A286XXB0_BMF-03      -------------------------cag----------------------
A0A286XXB0_BMF-01      -------------------------cag----------------------
A0A286XXB0_BMF-02      -------------------------cag----------------------
A0A2K5KGP2_BMF-01      -------------------------cag-------------gtgaggctg
A0A0D9R4R5_BMF-01      -------------------------tag----------------------
A0A2K5VLE9_BMF-01      -------------------------tag----------------------
A0A2K5VLE9_BMF-02      -------------------------tag----------------------
A0A096NTE9_BMF-02      -------------------------tag----------------------
A0A096NTE9_BMF-01      -------------------------tag----------------------
A0A096NTE9_BMF-03      -------------------------tag----------------------
A0A5F7ZML1_BMF-01      -------------------------tag----------------------
A0A5F7ZML1_BMF-02      -------------------------tag----------------------
A0A5F7ZML1_BMF-03      -------------------------tag----------------------
A0A2K5MJW4_BMF-01      -------------------------tag----------------------
A0A2K6B5F6_BMF-03      -------------------------tag----------------------
A0A2K5Z4A9_BMF-02      -------------------------tag----------------------
A0A2K5MJW4_BMF-02      -------------------------tag----------------------
A0A2K6B5F6_BMF-01      -------------------------tag----------------------
A0A2K6B5F6_BMF-02      -------------------------tag----------------------
A0A2K6B5F6_BMF-04      -------------------------tag----------------------
A0A2K5Z4A9_BMF-01      -------------------------tag----------------------
A0A2K5KGP2_BMF-02      -------------------------cag----------------------
A0A2K6RAW1_BMF-02      --------------------------------------------------
A0A2K6RAW1_BMF-01      -------------------------tag----------------------
A0A2K6L919_BMF-01      -------------------------tag----------------------
A0A2K6L919_BMF-03      -------------------------tag----------------------
A0A2K6L919_BMF-02      -------------------------taggcccttgacctggaatgggggc
A0A2U4BC98_BMF-01      -------------------------cag----------------------
G1PAU1_BMF-01          -------------------------cag----------------------
A0A2I3HD83_BMF-01      -------------------------tag----------------------
A0A2K6TW78_BMF-03      -------------------------gag----------------------
A0A2K6TW78_BMF-02      -------------------------gag----------------------
A0A2K6TW78_BMF-01      -------------------------gag----------------------
A0A2J8T301_BMF-01      -------------------------tag----------------------
G3T7Z4_BMF-01          -------------------------tag----------------------
A0A2K5RN49_BMF-02      -------------------------gag----------------------
A0A2K5RN49_BMF-01      -------------------------gag----------------------
F7HZL0_BMF-01          -------------------------gag----------------------
A0A2K5E1Q4_BMF-02      -------------------------gag----------------------
A0A2K5E1Q4_BMF-01      -------------------------gag----------------------
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          -------------------------tag----------------------
Q96LC9_BMF-07          -------------------------tag----------------------
Q96LC9_BMF-01          -------------------------tag----------------------
Q96LC9_BMF-02          -------------------------tag----------------------
Q96LC9_BMF-03          -------------------------tag----------------------
Q96LC9_BMF-04          -------------------------tag----------------------
A0A2J8QDD5_BMF-01      -------------------------tag----------------------
A0A2R9BS98_BMF-02      -------------------------tag----------------------
Q96LC9_BMF-06          -------------------------tag----------------------
A0A2I2Z168_BMF-02      -------------------------tag----------------------
A0A2I2Z168_BMF-01      -------------------------tag----------------------
Q96LC9_BMF-08          --------------------------------------------------
A0A2R9BS98_BMF-01      -------------------------tag----------------------
A0A2J8QDD5_BMF-02      -------------------------tag----------------------
                                                                         

A0A672RK14_BMF-01      --------------------------------------------------
A0A673JJ10_BMF-01      --------------------------------------------------
A0A3B4UNJ0_BMF-01      --------------------------------------------------
W5N4P7_BMF-01          --------------------------------------g-----------
A3KND0_BMF-01          --------------------------------------------------
Q0GKC7_BMF-01          --------------------------------------------------
A0A671M0H4_BMF-01      --------------------------------------------------
A0A671M0H4_BMF-02      --------------------------------------------------
A0A671MNR9_BMF-01      --------------------------------------------------
A0A672JWL9_BMF-01      --------------------------------------------------
A0A672JWL9_BMF-02      --------------------------------------------------
A0A673HDR4_BMF-01      --------------------------------------------------
A0A3B3RH63_BMF-01      --------------------------------------a-----------
K7FRX2_BMF-01          --------------------------------------g-----------
A0A452H3N6_BMF-01      --------------------------------------g-----------
A0A674IPL3_BMF-01      --------------------------------------g-----------
A0A493T7X1_BMF-01      --------------------------------------------------
A0A3Q2UCA0_BMF-01      --------------------------------------g-----------
A0A3Q2UCA0_BMF-02      --------------------------------------g-----------
A0A669PL85_BMF-02      --------------------------------------------------
A0A493T7X1_BMF-02      --------------------------------------g-----------
A0A3Q2UCA0_BMF-03      --------------------------------------g-----------
A0A3Q2UCA0_BMF-04      --------------------------------------g-----------
A9XRH0_BMF-01          --------------------------------------g-----------
G1NHG8_BMF-01          --------------------------------------g-----------
A0A669PL85_BMF-01      --------------------------------------g-----------
U3JS06_BMF-01          --------------------------------------g-----------
A0A674GIP8_BMF-03      --------------------------------------------------
A0A674GIP8_BMF-01      --------------------------------------a-----------
A0A674GIP8_BMF-02      --------------------------------------g-----------
A0A672V891_BMF-01      --------------------------------------g-----------
A0A663DZQ4_BMF-01      --------------------------------------g-----------
A0A663MPI8_BMF-01      --------------------------------------g-----------
A0A670XMZ5_BMF-01      --------------------------------------------------
H9GL49_BMF-01          --------------------------------------c-----------
A0A670JUU6_BMF-01      --------------------------------------c-----------
A0A670JUU6_BMF-05      --------------------------------------g-----------
A0A670JUU6_BMF-04      --------------------------------------a-----------
A0A670JUU6_BMF-02      --------------------------------------a-----------
A0A670JUU6_BMF-03      --------------------------------------a-----------
A0A4W3JXA1_BMF-01      --------------------------------------a-----------
A0A3Q2CXC4_BMF-01      --------------------------------------g-----------
A0A3Q2CXC4_BMF-02      --------------------------------------t-----------
A0A3B5QK08_BMF-01      --------------------------------------g-----------
A0A3B5QK08_BMF-02      --------------------------------------g-----------
A0A096LRV0_BMF-01      --------------------------------------g-----------
A0A3B3WU80_BMF-01      --------------------------------------g-----------
A0A3P9Q8E2_BMF-01      --------------------------------------g-----------
A0A3Q2PJX9_BMF-01      --------------------------------------g-----------
A0A3Q2PJX9_BMF-03      --------------------------------------g-----------
A0A3Q2PJX9_BMF-02      --------------------------------------gattctctgtga
A0A3Q2YCX7_BMF-01      --------------------------------------------------
A0A3Q2YCX7_BMF-02      --------------------------------------------------
A0A3B5KWG6_BMF-02      --------------------------------------g-----------
A0A3B5KWG6_BMF-01      --------------------------------------g-----------
A0A3B5KWG6_BMF-03      --------------------------------------------------
A0A3B3CGR9_BMF-01      --------------------------------------g-----------
A0A3P9K487_BMF-01      --------------------------------------g-----------
A0A3P9K487_BMF-02      --------------------------------------gctatctgtcat
A0A3B3HAU1_BMF-01      --------------------------------------g-----------
A0A3B3HAU1_BMF-02      --------------------------------------g-----------
A0A3B3HAU1_BMF-03      --------------------------------------g-----------
A0A3B3HAU1_BMF-04      --------------------------------------g-----------
A0A3P9ICE1_BMF-04      --------------------------------------gctatctgtctt
A0A3P9ICE1_BMF-01      --------------------------------------g-----------
A0A3P9ICE1_BMF-02      --------------------------------------g-----------
A0A3P9ICE1_BMF-03      --------------------------------------g-----------
A0A3P9ICE1_BMF-05      --------------------------------------g-----------
A0A3P8NFE2_BMF-02      --------------------------------------gcagttct----
A0A668TQU8_BMF-01      --------------------------------------gcgttcggc---
I3K2D6_BMF-01          --------------------------------------g-----------
A0A3Q4G1I4_BMF-01      --------------------------------------g-----------
A0A3P8NFE2_BMF-01      --------------------------------------g-----------
A0A3P9DPJ5_BMF-01      --------------------------------------g-----------
A0A3P9DPJ5_BMF-02      --------------------------------------g-----------
A0A3B4ETH0_BMF-01      --------------------------------------g-----------
A0A3Q3C5V2_BMF-01      --------------------------------------g-----------
A0A672HG10_BMF-01      --------------------------------------g-----------
A0A3P8UA78_BMF-02      --------------------------------------g-----------
A0A3P8UA78_BMF-01      --------------------------------------g-----------
A0A3P8UA78_BMF-03      --------------------------------------g-----------
A0A3Q3GUU5_BMF-01      --------------------------------------g-----------
A0A3Q3VLX6_BMF-01      --------------------------------------g-----------
A0A3Q2ZA20_BMF-01      --------------------------------------g-----------
A0A667YNR9_BMF-01      --------------------------------------g-----------
A0A3Q3LME3_BMF-01      --------------------------------------------------
A0A3Q3LME3_BMF-02      --------------------------------------g-----------
A0A3Q3LME3_BMF-03      --------------------------------------acctccatgccc
A0A3Q1IPR4_BMF-01      --------------------------------------g-----------
A0A3Q3QZ16_BMF-01      --------------------------------------g-----------
A0A3Q3QZ16_BMF-02      --------------------------------------g-----------
A0A665VG08_BMF-01      --------------------------------------g-----------
A0A673C8N3_BMF-01      --------------------------------------g-----------
A0A3Q1FVH7_BMF-01      --------------------------------------g-----------
A0A3Q1FVH7_BMF-02      --------------------------------------g-----------
A0A3B5B8F6_BMF-01      --------------------------------------g-----------
A0A3Q1D1K3_BMF-01      --------------------------------------g-----------
A0A3P8RKY9_BMF-01      --------------------------------------g-----------
A0A671X848_BMF-01      --------------------------------------g-----------
A0A0F8AD62_BMF-01      --------------------------------------g-----------
A0A4W6DUL1_BMF-01      --------------------------------------g-----------
A0A2U9CJH3_BMF-01      --------------------------------------gcaggcgcacac
A0A3B4U5H8_BMF-01      --------------------------------------g-----------
A0A3B4WM88_BMF-01      --------------------------------------g-----------
A0A3P8ZIE7_BMF-01      --------------------------------------g-----------
A0A4W5N3A7_BMF-01      --------------------------------------g-----------
A0A6F9BGV6_BMF-01      --------------------------------------g-----------
A0A1S3SNN2_BMF-01      --------------------------------------g-----------
A0A674EF64_BMF-01      --------------------------------------g-----------
A0A1S3P5K4_BMF-01      --------------------------------------g-----------
A0A6F9B4C5_BMF-01      --------------------------------------g-----------
A0A4W5N721_BMF-01      --------------------------------------g-----------
A0A1S3P5K4_BMF-02      --------------------------------------g-----------
A0A673YQV3_BMF-01      --------------------------------------g-----------
A0A4W4DZH9_BMF-01      --------------------------------------g-----------
A0A3B4CNJ8_BMF-01      --------------------------------------g-----------
A0A3B1K1X5_BMF-01      --------------------------------------g-----------
A0A3B4B6Y3_BMF-01      --------------------------------------------------
A0A6I8NF73_BMF-01      --------------------------------------g-----------
A0A5F8GKJ8_BMF-01      --------------------------------------g-----------
G3WDQ2_BMF-01          --------------------------------------g-----------
A0A4X2KLG2_BMF-01      --------------------------------------g-----------
Q8K589_BMF-01          --------------------------------------g-----------
Q91ZE9_BMF-02          --------------------------------------g-----------
Q91ZE9_BMF-01          --------------------------------------g-----------
Q91ZE9_BMF-06          --------------------------------------g-----------
A0A287CXH0_BMF-01      --------------------------------------g-----------
A0A287CXH0_BMF-02      --------------------------------------g-----------
A0A671DWL6_BMF-01      --------------------------------------g-----------
A0A671DWL6_BMF-02      --------------------------------------g-----------
A0A2K6FFN3_BMF-01      --------------------------------------g-----------
A0A2K6FFN3_BMF-02      --------------------------------------------------
A0A673TA87_BMF-01      --------------------------------------g-----------
L8IXF5_BMF-01          --------------------------------------g-----------
A0A4W2EII1_BMF-01      --------------------------------------g-----------
A0A4W2EII1_BMF-01      --------------------------------------g-----------
Q05KI3_BMF-01          --------------------------------------g-----------
Q05KI3_BMF-02          --------------------------------------g-----------
A0A4W2INA4_BMF-01      --------------------------------------g-----------
A0A4W2INA4_BMF-01      --------------------------------------g-----------
A0A452F2E0_BMF-01      --------------------------------------g-----------
A0A452F2E0_BMF-02      --------------------------------------g-----------
W5QFV1_BMF-01          --------------------------------------g-----------
H0WYH6_BMF-01          --------------------------------------g-----------
A0A337ST43_BMF-02      --------------------------------------------------
A0A337ST43_BMF-03      --------------------------------------------------
A0A337ST43_BMF-05      --------------------------------------------------
A0A337ST43_BMF-01      --------------------------------------------------
A0A337ST43_BMF-04      --------------------------------------------------
A0A667H967_BMF-01      --------------------------------------------------
M3YAD5_BMF-01          --------------------------------------------------
U6CSY8_BMF-01          --------------------------------------------------
A0A452SED0_BMF-01      --------------------------------------------------
A0A384D070_BMF-01      --------------------------------------------------
A0A5F4CJ04_BMF-04      --------------------------------------------------
A0A5F4CJ04_BMF-03      --------------------------------------------------
A0A5F4CJ04_BMF-01      --------------------------------------------------
A0A5F4CJ04_BMF-02      --------------------------------------------------
A0A4X1UQ42_BMF-01      --------------------------------------g-----------
A0A4X1UQ42_BMF-02      --------------------------------------g-----------
A0A287AIU8_BMF-01      --------------------------------------g-----------
A0A287AIU8_BMF-02      --------------------------------------g-----------
A0A3Q2HR24_BMF-01      gtgctctggaagtcagcaggattgcagct---------gcctctgtccga
A0A3Q2HR24_BMF-02      acccgttagggaattggagacttctgacttgtttctcagctgccatcctg
G1SR62_BMF-01          --------------------------------------g-----------
A0A286XXB0_BMF-03      --------------------------------------g-----------
A0A286XXB0_BMF-01      --------------------------------------g-----------
A0A286XXB0_BMF-02      --------------------------------------g-----------
A0A2K5KGP2_BMF-01      ggctgccctcttcacatggggcaccaggaacaccgtcaggaaggacatcg
A0A0D9R4R5_BMF-01      --------------------------------------g-----------
A0A2K5VLE9_BMF-01      --------------------------------------------------
A0A2K5VLE9_BMF-02      --------------------------------------g-----------
A0A096NTE9_BMF-02      --------------------------------------gcccctgacctg
A0A096NTE9_BMF-01      --------------------------------------gtataaaaatgc
A0A096NTE9_BMF-03      --------------------------------------------------
A0A5F7ZML1_BMF-01      --------------------------------------gcccctgacctg
A0A5F7ZML1_BMF-02      --------------------------------------g-----------
A0A5F7ZML1_BMF-03      --------------------------------------g-----------
A0A2K5MJW4_BMF-01      --------------------------------------------------
A0A2K6B5F6_BMF-03      --------------------------------------------------
A0A2K5Z4A9_BMF-02      --------------------------------------------------
A0A2K5MJW4_BMF-02      --------------------------------------g-----------
A0A2K6B5F6_BMF-01      --------------------------------------g-----------
A0A2K6B5F6_BMF-02      --------------------------------------g-----------
A0A2K6B5F6_BMF-04      --------------------------------------g-----------
A0A2K5Z4A9_BMF-01      --------------------------------------g-----------
A0A2K5KGP2_BMF-02      --------------------------------------g-----------
A0A2K6RAW1_BMF-02      --------------------------------------------------
A0A2K6RAW1_BMF-01      --------------------------------------g-----------
A0A2K6L919_BMF-01      --------------------------------------g-----------
A0A2K6L919_BMF-03      --------------------------------------g-----------
A0A2K6L919_BMF-02      cgttgtcaaacactgttgaaggggaggctgatgtgtctg-----------
A0A2U4BC98_BMF-01      --------------------------------------g-----------
G1PAU1_BMF-01          --------------------------------------g-----------
A0A2I3HD83_BMF-01      --------------------------------------------------
A0A2K6TW78_BMF-03      --------------------------------------------------
A0A2K6TW78_BMF-02      --------------------------------------g-----------
A0A2K6TW78_BMF-01      --------------------------------------g-----------
A0A2J8T301_BMF-01      --------------------------------------g-----------
G3T7Z4_BMF-01          --------------------------------------g-----------
A0A2K5RN49_BMF-02      --------------------------------------------------
A0A2K5RN49_BMF-01      --------------------------------------g-----------
F7HZL0_BMF-01          --------------------------------------g-----------
A0A2K5E1Q4_BMF-02      --------------------------------------------------
A0A2K5E1Q4_BMF-01      --------------------------------------g-----------
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          --------------------------------------g-----------
Q96LC9_BMF-02          --------------------------------------g-----------
Q96LC9_BMF-03          --------------------------------------g-----------
Q96LC9_BMF-04          --------------------------------------g-----------
A0A2J8QDD5_BMF-01      --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
Q96LC9_BMF-06          --------------------------------------g-----------
A0A2I2Z168_BMF-02      --------------------------------------------------
A0A2I2Z168_BMF-01      --------------------------------------g-----------
Q96LC9_BMF-08          --------------------------------------------------
A0A2R9BS98_BMF-01      --------------------------------------g-----------
A0A2J8QDD5_BMF-02      --------------------------------------g-----------
                                                                         

A0A672RK14_BMF-01      --------------------------------------------------
A0A673JJ10_BMF-01      --------------------------------------------------
A0A3B4UNJ0_BMF-01      --------------------------------------------------
W5N4P7_BMF-01          --------------------------------------------------
A3KND0_BMF-01          --------------------------------------------------
Q0GKC7_BMF-01          --------------------------------------------------
A0A671M0H4_BMF-01      --------------------------------------------------
A0A671M0H4_BMF-02      --------------------------------------------------
A0A671MNR9_BMF-01      --------------------------------------------------
A0A672JWL9_BMF-01      --------------------------------------------------
A0A672JWL9_BMF-02      --------------------------------------------------
A0A673HDR4_BMF-01      --------------------------------------------------
A0A3B3RH63_BMF-01      --------------------------------------------------
K7FRX2_BMF-01          --------------------------------------------------
A0A452H3N6_BMF-01      --------------------------------------------------
A0A674IPL3_BMF-01      --------------------------------------------------
A0A493T7X1_BMF-01      --------------------------------------------------
A0A3Q2UCA0_BMF-01      --------------------------------------------------
A0A3Q2UCA0_BMF-02      --------------------------------------------------
A0A669PL85_BMF-02      --------------------------------------------------
A0A493T7X1_BMF-02      --------------------------------------------------
A0A3Q2UCA0_BMF-03      --------------------------------------------------
A0A3Q2UCA0_BMF-04      --------------------------------------------------
A9XRH0_BMF-01          --------------------------------------------------
G1NHG8_BMF-01          --------------------------------------------------
A0A669PL85_BMF-01      --------------------------------------------------
U3JS06_BMF-01          --------------------------------------------------
A0A674GIP8_BMF-03      --------------------------------------------------
A0A674GIP8_BMF-01      --------------------------------------------------
A0A674GIP8_BMF-02      --------------------------------------------------
A0A672V891_BMF-01      --------------------------------------------------
A0A663DZQ4_BMF-01      --------------------------------------------------
A0A663MPI8_BMF-01      --------------------------------------------------
A0A670XMZ5_BMF-01      --------------------------------------------------
H9GL49_BMF-01          --------------------------------------------------
A0A670JUU6_BMF-01      --------------------------------------------------
A0A670JUU6_BMF-05      --------------------------------------------------
A0A670JUU6_BMF-04      --------------------------------------------------
A0A670JUU6_BMF-02      --------------------------------------------------
A0A670JUU6_BMF-03      --------------------------------------------------
A0A4W3JXA1_BMF-01      --------------------------------------------------
A0A3Q2CXC4_BMF-01      --------------------------------------------------
A0A3Q2CXC4_BMF-02      --------------------------------------------------
A0A3B5QK08_BMF-01      --------------------------------------------------
A0A3B5QK08_BMF-02      --------------------------------------------------
A0A096LRV0_BMF-01      --------------------------------------------------
A0A3B3WU80_BMF-01      --------------------------------------------------
A0A3P9Q8E2_BMF-01      --------------------------------------------------
A0A3Q2PJX9_BMF-01      --------------------------------------------------
A0A3Q2PJX9_BMF-03      --------------------------------------------------
A0A3Q2PJX9_BMF-02      gttccctacgcttctc----------------------------------
A0A3Q2YCX7_BMF-01      --------------------------------------------------
A0A3Q2YCX7_BMF-02      --------------------------------------------------
A0A3B5KWG6_BMF-02      --------------------------------------------------
A0A3B5KWG6_BMF-01      --------------------------------------------------
A0A3B5KWG6_BMF-03      --------------------------------------------------
A0A3B3CGR9_BMF-01      --------------------------------------------------
A0A3P9K487_BMF-01      --------------------------------------------------
A0A3P9K487_BMF-02      gagtgac-------------------------------------------
A0A3B3HAU1_BMF-01      --------------------------------------------------
A0A3B3HAU1_BMF-02      --------------------------------------------------
A0A3B3HAU1_BMF-03      --------------------------------------------------
A0A3B3HAU1_BMF-04      --------------------------------------------------
A0A3P9ICE1_BMF-04      gagtgac-------------------------------------------
A0A3P9ICE1_BMF-01      --------------------------------------------------
A0A3P9ICE1_BMF-02      --------------------------------------------------
A0A3P9ICE1_BMF-03      --------------------------------------------------
A0A3P9ICE1_BMF-05      --------------------------------------------------
A0A3P8NFE2_BMF-02      --------------------------------------------------
A0A668TQU8_BMF-01      --------------------------------------------------
I3K2D6_BMF-01          --------------------------------------------------
A0A3Q4G1I4_BMF-01      --------------------------------------------------
A0A3P8NFE2_BMF-01      --------------------------------------------------
A0A3P9DPJ5_BMF-01      --------------------------------------------------
A0A3P9DPJ5_BMF-02      --------------------------------------------------
A0A3B4ETH0_BMF-01      --------------------------------------------------
A0A3Q3C5V2_BMF-01      --------------------------------------------------
A0A672HG10_BMF-01      --------------------------------------------------
A0A3P8UA78_BMF-02      --------------------------------------------------
A0A3P8UA78_BMF-01      --------------------------------------------------
A0A3P8UA78_BMF-03      --------------------------------------------------
A0A3Q3GUU5_BMF-01      --------------------------------------------------
A0A3Q3VLX6_BMF-01      --------------------------------------------------
A0A3Q2ZA20_BMF-01      --------------------------------------------------
A0A667YNR9_BMF-01      --------------------------------------------------
A0A3Q3LME3_BMF-01      --------------------------------------------------
A0A3Q3LME3_BMF-02      --------------------------------------------------
A0A3Q3LME3_BMF-03      t-------------------------------------------------
A0A3Q1IPR4_BMF-01      --------------------------------------------------
A0A3Q3QZ16_BMF-01      --------------------------------------------------
A0A3Q3QZ16_BMF-02      --------------------------------------------------
A0A665VG08_BMF-01      --------------------------------------------------
A0A673C8N3_BMF-01      --------------------------------------------------
A0A3Q1FVH7_BMF-01      --------------------------------------------------
A0A3Q1FVH7_BMF-02      --------------------------------------------------
A0A3B5B8F6_BMF-01      --------------------------------------------------
A0A3Q1D1K3_BMF-01      --------------------------------------------------
A0A3P8RKY9_BMF-01      --------------------------------------------------
A0A671X848_BMF-01      --------------------------------------------------
A0A0F8AD62_BMF-01      --------------------------------------------------
A0A4W6DUL1_BMF-01      --------------------------------------------------
A0A2U9CJH3_BMF-01      aaaacgcagggcgaaagcctccgggccgcagaaccgggccagttcagtgg
A0A3B4U5H8_BMF-01      --------------------------------------------------
A0A3B4WM88_BMF-01      --------------------------------------------------
A0A3P8ZIE7_BMF-01      --------------------------------------------------
A0A4W5N3A7_BMF-01      --------------------------------------------------
A0A6F9BGV6_BMF-01      --------------------------------------------------
A0A1S3SNN2_BMF-01      --------------------------------------------------
A0A674EF64_BMF-01      --------------------------------------------------
A0A1S3P5K4_BMF-01      --------------------------------------------------
A0A6F9B4C5_BMF-01      --------------------------------------------------
A0A4W5N721_BMF-01      --------------------------------------------------
A0A1S3P5K4_BMF-02      --------------------------------------------------
A0A673YQV3_BMF-01      --------------------------------------------------
A0A4W4DZH9_BMF-01      --------------------------------------------------
A0A3B4CNJ8_BMF-01      --------------------------------------------------
A0A3B1K1X5_BMF-01      --------------------------------------------------
A0A3B4B6Y3_BMF-01      --------------------------------------------------
A0A6I8NF73_BMF-01      --------------------------------------------------
A0A5F8GKJ8_BMF-01      --------------------------------------------------
G3WDQ2_BMF-01          --------------------------------------------------
A0A4X2KLG2_BMF-01      --------------------------------------------------
Q8K589_BMF-01          --------------------------------------------------
Q91ZE9_BMF-02          --------------------------------------------------
Q91ZE9_BMF-01          --------------------------------------------------
Q91ZE9_BMF-06          --------------------------------------------------
A0A287CXH0_BMF-01      --------------------------------------------------
A0A287CXH0_BMF-02      --------------------------------------------------
A0A671DWL6_BMF-01      --------------------------------------------------
A0A671DWL6_BMF-02      --------------------------------------------------
A0A2K6FFN3_BMF-01      --------------------------------------------------
A0A2K6FFN3_BMF-02      --------------------------------------------------
A0A673TA87_BMF-01      --------------------------------------------------
L8IXF5_BMF-01          --------------------------------------------------
A0A4W2EII1_BMF-01      --------------------------------------------------
A0A4W2EII1_BMF-01      --------------------------------------------------
Q05KI3_BMF-01          --------------------------------------------------
Q05KI3_BMF-02          --------------------------------------------------
A0A4W2INA4_BMF-01      --------------------------------------------------
A0A4W2INA4_BMF-01      --------------------------------------------------
A0A452F2E0_BMF-01      --------------------------------------------------
A0A452F2E0_BMF-02      --------------------------------------------------
W5QFV1_BMF-01          --------------------------------------------------
H0WYH6_BMF-01          --------------------------------------------------
A0A337ST43_BMF-02      -------g---tgaggctgggctgccctcctcgcatggggcaccacagga
A0A337ST43_BMF-03      -------agttttggcctcggct-----------------------atta
A0A337ST43_BMF-05      -------agttttggcctcggct-----------------------atta
A0A337ST43_BMF-01      -------gacctcaccaggaatg-----------------------aggg
A0A337ST43_BMF-04      -------g------------------------------------------
A0A667H967_BMF-01      -------g------------------------------------------
M3YAD5_BMF-01          -------g------------------------------------------
U6CSY8_BMF-01          -------g------------------------------------------
A0A452SED0_BMF-01      -------g------------------------------------------
A0A384D070_BMF-01      -------g------------------------------------------
A0A5F4CJ04_BMF-04      -------g------------------------------------------
A0A5F4CJ04_BMF-03      -------c------------------------------------------
A0A5F4CJ04_BMF-01      -------c------------------------------------------
A0A5F4CJ04_BMF-02      -------c------------------------------------------
A0A4X1UQ42_BMF-01      --------------------------------------------------
A0A4X1UQ42_BMF-02      --------------------------------------------------
A0A287AIU8_BMF-01      --------------------------------------------------
A0A287AIU8_BMF-02      --------------------------------------------------
A0A3Q2HR24_BMF-01      acttcttcccttctctccctgctgtggcactaatggagagaatttaaagc
A0A3Q2HR24_BMF-02      agtta--cccccagctcccggcttttgtc---------aggacttcgtgc
G1SR62_BMF-01          --------------------------------------------------
A0A286XXB0_BMF-03      --------------------------------------------------
A0A286XXB0_BMF-01      --------------------------------------------------
A0A286XXB0_BMF-02      --------------------------------------------------
A0A2K5KGP2_BMF-01      ggcaggactgacactgtgtcttgtga------------agttgttttttt
A0A0D9R4R5_BMF-01      --------------------------------------------------
A0A2K5VLE9_BMF-01      --------------------------------------------------
A0A2K5VLE9_BMF-02      --------------------------------------------------
A0A096NTE9_BMF-02      gaatggggccgttgtcaaa-------------------------------
A0A096NTE9_BMF-01      aagaagatcagttaggaaattaaagg------------cttctagctttc
A0A096NTE9_BMF-03      --------------------------------------------------
A0A5F7ZML1_BMF-01      gaatggggctgttgtcaaa-------------------------------
A0A5F7ZML1_BMF-02      --------------------------------------------------
A0A5F7ZML1_BMF-03      --------------------------------------------------
A0A2K5MJW4_BMF-01      --------------------------------------------------
A0A2K6B5F6_BMF-03      --------------------------------------------------
A0A2K5Z4A9_BMF-02      --------------------------------------------------
A0A2K5MJW4_BMF-02      --------------------------------------------------
A0A2K6B5F6_BMF-01      --------------------------------------------------
A0A2K6B5F6_BMF-02      --------------------------------------------------
A0A2K6B5F6_BMF-04      --------------------------------------------------
A0A2K5Z4A9_BMF-01      --------------------------------------------------
A0A2K5KGP2_BMF-02      --------------------------------------------------
A0A2K6RAW1_BMF-02      --------------------------------------------------
A0A2K6RAW1_BMF-01      --------------------------------------------------
A0A2K6L919_BMF-01      --------------------------------------------------
A0A2K6L919_BMF-03      --------------------------------------------------
A0A2K6L919_BMF-02      --------------------------------------------------
A0A2U4BC98_BMF-01      --------------------------------------------------
G1PAU1_BMF-01          --------------------------------------------------
A0A2I3HD83_BMF-01      --------------------------------------------------
A0A2K6TW78_BMF-03      --------------------------------------------------
A0A2K6TW78_BMF-02      --------------------------------------------------
A0A2K6TW78_BMF-01      --------------------------------------------------
A0A2J8T301_BMF-01      --------------------------------------------------
G3T7Z4_BMF-01          --------------------------------------------------
A0A2K5RN49_BMF-02      --------------------------------------------------
A0A2K5RN49_BMF-01      --------------------------------------------------
F7HZL0_BMF-01          --------------------------------------------------
A0A2K5E1Q4_BMF-02      --------------------------------------------------
A0A2K5E1Q4_BMF-01      --------------------------------------------------
Q96LC9_BMF-09          --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          --------------------------------------------------
Q96LC9_BMF-02          --------------------------------------------------
Q96LC9_BMF-03          --------------------------------------------------
Q96LC9_BMF-04          --------------------------------------------------
A0A2J8QDD5_BMF-01      --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
Q96LC9_BMF-06          --------------------------------------------------
A0A2I2Z168_BMF-02      --------------------------------------------------
A0A2I2Z168_BMF-01      --------------------------------------------------
Q96LC9_BMF-08          --------------------------------------------------
A0A2R9BS98_BMF-01      --------------------------------------------------
A0A2J8QDD5_BMF-02      --------------------------------------------------
                                                                         

A0A672RK14_BMF-01      --------------------------------------------------
A0A673JJ10