Dataset for CDS classical BH3-containing proteins of organism Xenopus tropicalis

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A6I8PXS6_BAD-01      atggcagattcatccccttcagcag----ttttcaagttagaggaa----
F6TGJ4_BMF-01          atgg---a----------acaggagagttacctgaatatggatgagttag
Q4KMV9_BCL2L11-01      atggccaa----------acaaccgtcggtcttgagtccggac-------
                       ****   *           **   *       * *     **        

A0A6I8PXS6_BAD-01      -----------ttcgataatgaggaacagggattacctttgccttttgtg
F6TGJ4_BMF-01          atgacgatgtgttttatcctgatgaatttggatacccagatcagaccatg
Q4KMV9_BCL2L11-01      -----------tgtaatagtggtgaaggtgg----ccagtt---------
                                  *   **  **  ***   **    **             

A0A6I8PXS6_BAD-01      gatccccctcgtggggcaggcgttcgacaacctgtagctaagagttctcc
F6TGJ4_BMF-01          acttcctcc----------acagtattcaaccaga-gcca----gtccta
Q4KMV9_BCL2L11-01      -------------------acaatcaacaagcagacaaca----ttctca
                                           *  *   *** * *     *     **   

A0A6I8PXS6_BAD-01      c---agcctgcgaagatacccagggaaggagtcacgtttacgcactgagt
F6TGJ4_BMF-01          cacatgcctgct----------gagccgctttcacctcttccca------
Q4KMV9_BCL2L11-01      t---cgccctctcaga-----agaggggcccccacctctcttagc--agt
                            ***  *           * *  *    *** * *           

A0A6I8PXS6_BAD-01      ctgcttcagagtccagtgagac-agaca-aagtgggcgagctcc------
F6TGJ4_BMF-01          ctttctcactgt--tgtggccctggatgcaggggcgcagactacgaagac
Q4KMV9_BCL2L11-01      ccttttcaaggt--aatcaatc-agatg--agggtgggagctcctcagcc
                       *    ***  **    *    *  **     * * *    ** *      

A0A6I8PXS6_BAD-01      -------------atc-----------ctttccgttcccgttcc------
F6TGJ4_BMF-01          aaggctacgcagactc--------------tgggttccccttccatcagc
Q4KMV9_BCL2L11-01      agcactccatggggtcctactatatcgccttatagtcccagttcctttgt
                                     **              *    ****  * *      

A0A6I8PXS6_BAD-01      --------cgttctgctccgt---------------cttcaatga-----
F6TGJ4_BMF-01          caggacatcatgctaccctgtggggtgtctgaaacccctcaaagactttt
Q4KMV9_BCL2L11-01      caacagatcaccccattgcatgctg-gtaagaggatcatc----acttgt
                               *   *       *               * **    *     

A0A6I8PXS6_BAD-01      ----------------tcgctacaaaatatggacgggagt----------
F6TGJ4_BMF-01          ttatggacatgcaggatacctattatatctccctcagaat---tctccgg
Q4KMV9_BCL2L11-01      ctccaaaacctcaag-tggctatt---tttcattcgaagtgagtcctggg
                                       *  ***     * *       * *          

A0A6I8PXS6_BAD-01      -----------taagaagaatgagtgatgaatttgaaaa--aagc-----
F6TGJ4_BMF-01          cccgttttggagaagaggt-tgacaacaggaggcaagaacagagc-----
Q4KMV9_BCL2L11-01      cctgt---------gagctgtgataaatcaactcaaacaccaagccctcc
                                     **    ***       *    *  *   ***     

A0A6I8PXS6_BAD-01      ----------ttcacgggccttcctcgtccaaagagtgcaagt---gcag
F6TGJ4_BMF-01          --gcagagcatcggatcgcccgcaaactgcagtgtattggaga---ccag
Q4KMV9_BCL2L11-01      ttgtcaggcatttaatcatctcctttccgcaatggctgacagaaatcctg
                                 *        *  *      **  *  *   **     * *

A0A6I8PXS6_BAD-01      cgggtcagatg--actgg-----------gaacagaagc--------att
F6TGJ4_BMF-01          tttcacaggtttcatctg--------------cagagacttcaacagaac
Q4KMV9_BCL2L11-01      tgaatcagatgtcaccagaactgtggatagcacaggaactccggcggatt
                            *** *   *   *              ***   *        *  

A0A6I8PXS6_BAD-01      cgaga----------------cttaatcatggg---cttgttctcaa---
F6TGJ4_BMF-01          cgaaatcagt-----------tttggtctcaga--------tcttaatct
Q4KMV9_BCL2L11-01      ggggatgactttaatgcatcattcagtccaagaaggggcattttcaacaa
                        *  *                 *   **   *         * * **   

A0A6I8PXS6_BAD-01      -------------------gacggaaaagtaaag------gaagggatga
F6TGJ4_BMF-01          tcttccgcaactt--------------ggtaatgcatccagtggggaata
Q4KMV9_BCL2L11-01      ccttccacgacccttggacaacgaccaagtaata-atcctgcgtgtttta
                                                   ****        *   *    *

A0A6I8PXS6_BAD-01      ---------gtctgg--ggatgaggagtga---
F6TGJ4_BMF-01          ga-------gccgggctggctcagaggtga---
Q4KMV9_BCL2L11-01      cgtttcattatccgactgatcctgagattataa
                                  * *   *     *   * *   

© 1998-2021Legal notice