Dataset for CDS classical BH3-containing proteins of organism Xenopus tropicalis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A6I8PXS6_BAD-01      atggcagattcatccccttcagcagttttcaagttagaggaattcgataa
Q4KMV9_BCL2L11-01      atgg-------at-----------gtgtttaag---aaaggtttttctat
                       ****       **           ** ** ***    * *  **   ** 

A0A6I8PXS6_BAD-01      tgaggaacagggattacctttgccttttgtggatccccctcgtggggcag
Q4KMV9_BCL2L11-01      ggctaaagaagg---------------tgtggttgc------tgcagcag
                        *   ** * **               ***** * *      **  ****

A0A6I8PXS6_BAD-01      gcgttcgacaacctgtagctaagagttctcccagcctgcgaagataccca
Q4KMV9_BCL2L11-01      a-----gaaaacc---aagcagggtgtgacagaagctgcagaaaaaacca
                             ** ****   *   * *   *  *  *  ****  * * * ***

A0A6I8PXS6_BAD-01      gggaaggagtcacgt---------------------------ttacgcac
Q4KMV9_BCL2L11-01      aggagggggtcatgtatgtaggagcaaaaactaaagagggcgttgtacac
                        *** ** **** **                           **   ***

A0A6I8PXS6_BAD-01      ----tgagt----ctgcttcagagtccagtgagacagacaaagtgggc--
Q4KMV9_BCL2L11-01      agcgtgagtacagttgctgaaaaaaccaaagaacaggccaatgtggtcgg
                           *****     ****  * *  ***  **    * *** **** *  

A0A6I8PXS6_BAD-01      --gagctccatcctttccgttcccgttcccgttctgctccgtcttcaatg
Q4KMV9_BCL2L11-01      cggagct----------------------------------------gtg
                         *****                                         **

A0A6I8PXS6_BAD-01      atcgctacaaaatatggacgggagttaagaagaatgagtgatgaatttga
Q4KMV9_BCL2L11-01      gtctctggagtaaatca--ggtagcttcaaagactgta----gaaggcac
                        ** **  *  * **    ** ** *   **** **      ***     

A0A6I8PXS6_BAD-01      aaaaagcttcacgggccttcctcgtcca--aagagtgcaag---tgcag-
Q4KMV9_BCL2L11-01      agagaacatcgtaggcactactggtttagtaaaaaaggaagatctacatc
                       * * * * **   ***  * ** **  *  ** *  * ***   * **  

A0A6I8PXS6_BAD-01      cgggtcagatgactgggaacagaagcattcgagacttaatcatgggcttg
Q4KMV9_BCL2L11-01      caggtcag----------ccagaagaacctgctggcgaagaa-gaacctg
                       * ******           ****** *   *      **  * *  * **

A0A6I8PXS6_BAD-01      ttctcaagacggaaaagtaaaggaagggatgagt---ctggggatgagga
Q4KMV9_BCL2L11-01      cagtggaggc-------tacagaaagcactgagcaggttggtgatggaga
                          *  ** *       ** ** ***   ****     *** ****  **

A0A6I8PXS6_BAD-01      g---tga
Q4KMV9_BCL2L11-01      gaattaa
                       *   * *

© 1998-2020Legal notice