Dataset for CDS BIK of organism Vulpes vulpes

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q7V097_BIK-03      atgacgctcgcctgcagctccatgaggaccataggaccaaatgtcacact
A0A3Q7V097_BIK-01      --------------------------------------------------
A0A3Q7V097_BIK-02      --------------------------------------------------
                                                                         

A0A3Q7V097_BIK-03      cagcggagtatccccagcaggtggcacagcctgggcccactgggaagagg
A0A3Q7V097_BIK-01      --atggggcgttggaggagggggatgctgctgacgatgtttctgccaaag
A0A3Q7V097_BIK-02      --------------------------------------------------
                                                                         

A0A3Q7V097_BIK-03      ctggacggagggttgcatgcctgttacgtaccccaagtttcacaaggcag
A0A3Q7V097_BIK-01      catcactcttggttttcagattgtgaaataggccga--------------
A0A3Q7V097_BIK-02      --------------------------------------------------
                                                                         

A0A3Q7V097_BIK-03      ttggcaggtataaaagctggatttgctgagctgcagagaaaccaagagag
A0A3Q7V097_BIK-01      -------------------aatatacctaattccagaga-----------
A0A3Q7V097_BIK-02      --------------------------------------------------
                                                                         

A0A3Q7V097_BIK-03      cagcattagcccgttcttttcctctcctgatgggctaggatgtggaaggg
A0A3Q7V097_BIK-01      --------------------------------------------------
A0A3Q7V097_BIK-02      --------------------------------------------------
                                                                         

A0A3Q7V097_BIK-03      ggtgctcggaggatggctccatccgctggttgggtctccacgctgacctc
A0A3Q7V097_BIK-01      --------------------------------------------------
A0A3Q7V097_BIK-02      --------------------------------------------------
                                                                         

A0A3Q7V097_BIK-03      ggagaaatgtctcactcaggacccctctccaggaacctctttctgagcac
A0A3Q7V097_BIK-01      --agaaatgtctcactcaggacccctctccaggaacctctttctgagcac
A0A3Q7V097_BIK-02      ------atgtctcactcaggacccctctccaggaacctctttctgagcac
                             ********************************************

A0A3Q7V097_BIK-03      cttcctacaggagcatggcccggaagttctggaggttccgggcatgacag
A0A3Q7V097_BIK-01      cttcctacaggagcatggcccggaagttctggaggttccgggcatgacag
A0A3Q7V097_BIK-02      cttcctacaggagcatggcccggaagttctggaggttccgggcatgacag
                       **************************************************

A0A3Q7V097_BIK-03      atctcatggagtattatgaccctgggccctcccctaacagcaacaacccg
A0A3Q7V097_BIK-01      atctcatggagtattatgaccctgggccctcccctaacagcaacaacccg
A0A3Q7V097_BIK-02      atctcatggagtattatgaccctgggccctcccctaacagcaacaacccg
                       **************************************************

A0A3Q7V097_BIK-03      gacgatgtggccatgcggctggccttcatcggggacgagatggaagtgag
A0A3Q7V097_BIK-01      gacgatgtggccatgcggctggccttcatcggggacgagatggaagtgag
A0A3Q7V097_BIK-02      gacgatgtggccatgcggctggccttcatcggggacgagatggaagtgag
                       **************************************************

A0A3Q7V097_BIK-03      atggatgcttccccgtgttggcgagctgcccgggatggccatgtacagct
A0A3Q7V097_BIK-01      atggatgcttccccgtgttggcgagctgcccgggatggccatgtacagct
A0A3Q7V097_BIK-02      atggatgcttccccgtgttggcgagctgcccgggatggccatgtacagct
                       **************************************************

A0A3Q7V097_BIK-03      tggcttttacctacaaccagacaggcctgagaggtgttcttagaagtttc
A0A3Q7V097_BIK-01      tggcttttacctacaaccagacaggcctgagaggtgttcttagaagtttc
A0A3Q7V097_BIK-02      tggcttttacctacaaccagacaggcctgagaggtgttcttagaagtttc
                       **************************************************

A0A3Q7V097_BIK-03      ctggatggtcttgctaacctcagggagaacatccgcatctggagcttcct
A0A3Q7V097_BIK-01      ctggatggtcttgctaacctcagggagaacatccgcatctggagcttcct
A0A3Q7V097_BIK-02      ctggatggtcttgctaacctcagggagaacatccgcatctggagcttcct
                       **************************************************

A0A3Q7V097_BIK-03      gaccttccggaacagggtgtcccccaacccggggcgtgggctggtgctgt
A0A3Q7V097_BIK-01      gaccttccggaacagggtgtcccccaacccggggcgtgggctggtgctgt
A0A3Q7V097_BIK-02      gaccttccggaacagggtgtcccccaacccggggcgtgggctggtgctgt
                       **************************************************

A0A3Q7V097_BIK-03      cgctgctgctgctgctggtgctgctactaggctggggcctccgcctcctc
A0A3Q7V097_BIK-01      cgctgctgctgctgctggtgctgctactaggctggggcctccgcctcctc
A0A3Q7V097_BIK-02      cgctgctgctgctgctggtgctgctactaggctggggcctccgcctcctc
                       **************************************************

A0A3Q7V097_BIK-03      cagtga
A0A3Q7V097_BIK-01      cagtga
A0A3Q7V097_BIK-02      cagtga
                       ******

© 1998-2020Legal notice