Dataset for CDS BCL2L11 of organism Vulpes vulpes

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q7S5V2_BCL2L11      ggacggaagacaggcgcccgagccaggtgcgcgccacctccgccccctcc
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7S5V2_BCL2L11      cgagcacgtgcgggcagctgcgtgtccccgccgcactctggccgccgggc
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7S5V2_BCL2L11      gggaggcggcggtccggcgggcgggctccctcccccacgcaggtccaggt
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7S5V2_BCL2L11      tggggagggggcgtgcgtgcgtgcggagctccgggcggggggccgaagtg
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7S5V2_BCL2L11      cggctcgggccgggattgcgcgcgccggggagcggggaagggcagcgcgc
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7S5V2_BCL2L11      gctcggcgctgtcccgggagctgcggccccgctgctggatactgggctgc
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7S5V2_BCL2L11      gcggccggccggcaagtgtcgccgccctgtcccgagacgccccccccccc
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7S5V2_BCL2L11      gccctccccaggtagcggccgcgccgtcggagctggtctggcgccttggc
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7S5V2_BCL2L11      tttcctcgggtgctcgggcccgctgcggaggatttgcggaactgcggcgg
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7S5V2_BCL2L11      ttctttcactggcgagactcggcgttttccttgcaccggctgaggccgag
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7S5V2_BCL2L11      gtttcagggcggctgcagcgttcgcgctcttctggacgtgtctgggggcg
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7S5V2_BCL2L11      ccctgccctgccctgccctgcccgggccgcggctgcgctgcagacaccag
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7S5V2_BCL2L11      cagccgcacgatcccgacggcgagaggcctcgggccgcaggacctgctcc
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7S5V2_BCL2L11      gcccgtggggcacccccactcgctcgcagtgccgccgggcggtgcggtgc
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7S5V2_BCL2L11      cctcgggggcctgttcctcggtgtccgagctcgtggcggaagacccgccg
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7S5V2_BCL2L11      gccgcgggagcccggggcgtggatgtgttcgccgtctgccgcgctcacgg
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7S5V2_BCL2L11      gtgcgcgcggacacgcgtgcccgtggccagtggctgcggctgggatttgg
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7S5V2_BCL2L11      acgtacgcgccgcgctcggggaggaaaagggaggaatttgcggaggacga
A0A3Q7S5V2_BCL2L11      --------------------------------------------------
                                                                          

A0A3Q7S5V2_BCL2L11      aaaaaagaccaaatggcaaagcaaccttcagatgtaagttctgagtgtga
A0A3Q7S5V2_BCL2L11      ------------atggcaaagcaaccttcagatgtaagttctgagtgtga
                                    **************************************

A0A3Q7S5V2_BCL2L11      cagagaaggtggacaattgcagcctgctgagagacctcctcagctcaggc
A0A3Q7S5V2_BCL2L11      cagagaaggtggacaattgcagcctgctgagagacctcctcagctcaggc
                        **************************************************

A0A3Q7S5V2_BCL2L11      ctggggctcctacctctctacagacagaacagcaagacaggagcccggca
A0A3Q7S5V2_BCL2L11      ctggggctcctacctctctacagacagaacagcaagacaggagcccggca
                        **************************************************

A0A3Q7S5V2_BCL2L11      cccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggc
A0A3Q7S5V2_BCL2L11      cccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggc
                        **************************************************

A0A3Q7S5V2_BCL2L11      cttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggctg
A0A3Q7S5V2_BCL2L11      cttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggctg
                        **************************************************

A0A3Q7S5V2_BCL2L11      tacctgcagatatgcgcccggagatatggattgcccaagagttgcggcgt
A0A3Q7S5V2_BCL2L11      tacctgcagatatgcgcccggagatatggattgcccaagagttgcggcgt
                        **************************************************

A0A3Q7S5V2_BCL2L11      attggagacgaatttaatgcatattacccaaggagggtctttttgaataa
A0A3Q7S5V2_BCL2L11      attggagacgaatttaatgcatattacccaaggagggtctttttgaataa
                        **************************************************

A0A3Q7S5V2_BCL2L11      ttaccaagcagccgaagcccacccccaaatgattatcttacgactgttac
A0A3Q7S5V2_BCL2L11      ttaccaagcagccgaagcccacccccaaatgattatcttacgactgttac
                        **************************************************

A0A3Q7S5V2_BCL2L11      gttacatcgtccgcctggtgtggagattgcagtga
A0A3Q7S5V2_BCL2L11      gttacatcgtccgcctggtgtggagattgcagtga
                        ***********************************

© 1998-2020Legal notice