Dataset for CDS classical BH3-containing proteins of organism Terrapene carolina triunguis

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A674I2R9_BAD-01       atgtttcgc---------atccaggagtt---------cccggacgaggt
A0A674IPL3_BMF-01       atggatccccccagctacctggaagaggactattccagcctggatgggc-
A0A674IAI8_BCL2L11      ------------------atggcaaagcaatcttctgatctaaattcaga
A0A674JUE0_PMAIP1-      ------------------gt-ccgaggca----------ccaaattcgg-
                                           *      *            *   *      

A0A674I2R9_BAD-01       gttcccggggcgagggaaggagtcgc------------------------
A0A674IPL3_BMF-01       --------tggacgatgacgtgtttcactctgactttggactcacaggtc
A0A674IAI8_BCL2L11      gtgcaacagagaaggtggacagtttcagtcaa---ttgaaaggccaagtc
A0A674JUE0_PMAIP1-      --------------------------------------------------

A0A674I2R9_BAD-01       ----------------ctcttccccccgagtcgcagcggggacacacgcc
A0A674IPL3_BMF-01       agcctggtgagatgacccctcctggc---attttcacacagaaccaatcc
A0A674IAI8_BCL2L11      agcctcagcatcttagacctggggcccctacctctatacaaacacagtat
A0A674JUE0_PMAIP1-      -----------------------------atctcgattcgaac-------

A0A674I2R9_BAD-01       c-----------------------ggctccaagcagccagacacccccac
A0A674IPL3_BMF-01       tacagctgtctcct-----ggggaggtttcaactattcccactcacacac
A0A674IAI8_BCL2L11      caaggtaatcattcaggtgagggggacttcacccagcagccctcaggga-
A0A674JUE0_PMAIP1-      --------------------------caccaccca------cacaggaa-
                                                     **   *      * *    * 

A0A674I2R9_BAD-01       agctg------------------------------aggtgcgaagccgga
A0A674IPL3_BMF-01       tgctgtggtccaggtatcaggcatgctgagcagcaagacaaggcaaccca
A0A674IAI8_BCL2L11      -gctcttcgcccagcagcc------ctcagggaccatttgcaccacccag
A0A674JUE0_PMAIP1-      -gctgt--------------------------------------------

A0A674I2R9_BAD-01       tagggtcagaccccccatctctggagccagaagt---------gcaggat
A0A674IPL3_BMF-01       aacactcagtccatcctcttcca---ctcaggatgtcatgttgccatgtg
A0A674IAI8_BCL2L11      tagccccagtccatttgctaccagatccccacttttcatctttgtaagaa
A0A674JUE0_PMAIP1-      --gatgcagtgc--------------------------tctttgcaa---
                              ***  *                                 *    

A0A674I2R9_BAD-01       gagccag-----------------------gtggg---------------
A0A674IPL3_BMF-01       gagtcactgaagagccccagagactcttctatgggaat------------
A0A674IAI8_BCL2L11      gatcctc---actgctgtctagatcctccagtgggtatttctctttcgac
A0A674JUE0_PMAIP1-      --------------------------------------------------

A0A674I2R9_BAD-01       ----------------------------gcattccgggcacgctcccgct
A0A674IPL3_BMF-01       -------------------------gctgggtaccgtttacatgtccccc
A0A674IAI8_BCL2L11      acagacaggagtcctgcgcctatgagttgcgacaagtccacgcagactcc
A0A674JUE0_PMAIP1-      -------------------------------------ctacgca------

A0A674I2R9_BAD-01       cagccccccctatcctttgggctgccatgcgttacgggcgggaactgcgc
A0A674IPL3_BMF-01       cagttggcttt-----gcattgaatccgcacct---------------cc
A0A674IAI8_BCL2L11      aagtcccccttgtcaagcctttaatcattatctaagtgcaatggcttcca
A0A674JUE0_PMAIP1-      -------------------------------------------------a

A0A674I2R9_BAD-01       aggatgagtgacgagtttgacgtggcgctgcaggtgctgccacgccccaa
A0A674IPL3_BMF-01       aagaggagcctcgggaaggtcaacg-----------------------gg
A0A674IAI8_BCL2L11      ggtgggagtctccctcagtacgtga-----------------------ag
A0A674JUE0_PMAIP1-      aataggag----------------------------------------at

A0A674I2R9_BAD-01       gagtgcaggcacaacatcccagctgcaccgggggaacagc----tggaaa
A0A674IPL3_BMF-01       aagcacgtactgag-gttcagattgcacggaagttacagtgcattgcaga
A0A674IAI8_BCL2L11      acatgcagccggaa-atatggattgcacaggaactgcggcgtattggaga
A0A674JUE0_PMAIP1-      atatgcaac------------------------ctgcagc-------aga
                             *                              * *        * *

A0A674I2R9_BAD-01       gaaaccctccaggcc--------------------------------tgg
A0A674IPL3_BMF-01       ccagttccacaggctccacatacagaggca-----------------tca
A0A674IAI8_BCL2L11      tgagt-ttaatgcttcctattgcccaagaaggggtttcttggataatcca
A0A674JUE0_PMAIP1-      agattcttaatgtt------------------------------------
                          *        *                                      

A0A674I2R9_BAD-01       ttgggacacagacccgcccgtgatg------cccccccca----------
A0A674IPL3_BMF-01       gcagaacaga-aatcaagtgtggtggcagatccttctcttcctacataac
A0A674IAI8_BCL2L11      gcagtaaacc-accaaattgttttg------cgcctgttacgttctatca
A0A674JUE0_PMAIP1-      -------att-acaaaactgttctg------ccc----------------
                               *   *       **  **      *                  

A0A674I2R9_BAD-01       ------------ggagc----------------------tccaagtga
A0A674IPL3_BMF-01       ttggccttaaatgtggaggcgaacaggaacaacgtaggtcagaggtga
A0A674IAI8_BCL2L11      tccgcctcatttggaga----------------------ctgcagtaa
A0A674JUE0_PMAIP1-      ------------aggaa----------------------c----gtga
                                                                    ** *

© 1998-2021Legal notice