Dataset for CDS BMF of organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A287AIU8_BMF-02      atggagccacctcagtgtgtggaggagctggaggatgatgtgttccagcc
A0A287AIU8_BMF-01      atggagccacctcagtgtgtggaggagctggaggatgatgtgttccagcc
                       **************************************************

A0A287AIU8_BMF-02      agaggaaggggagccggggacccagcccaggagggtctctgctgacccgt
A0A287AIU8_BMF-01      agaggaaggggagccggggacccagcccaggagggtctctgctgacccgt
                       **************************************************

A0A287AIU8_BMF-02      ttgtccagagccagctggactgccccctcagccgtctgcagctcttccct
A0A287AIU8_BMF-01      ttgtccagagccagctggactgccccctcagccgtctgcagctcttccct
                       **************************************************

A0A287AIU8_BMF-02      ctcacgcactgctgtggccctgggcttcgacccaccagccaggaagacaa
A0A287AIU8_BMF-01      ctcacgcactgctgtggccctgggcttcgacccaccagccaggaagacaa
                       **************************************************

A0A287AIU8_BMF-02      ggccacccagactctcagtccagcctccccgagccagggtgtcatgctgc
A0A287AIU8_BMF-01      ggccacccagactctcagtccagcctccccgagccagggtgtcatgctgc
                       **************************************************

A0A287AIU8_BMF-02      cttgtggggtgactgaggaaccccagcgactcttttat------------
A0A287AIU8_BMF-01      cttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggc
                       **************************************            

A0A287AIU8_BMF-02      ---------------------------------ggcttgccccttggcga
A0A287AIU8_BMF-01      taccggctccctctccctgccggtttccccgcaggcttgccccttggcga
                                                        *****************

A0A287AIU8_BMF-02      acagccccccgaagggcagtggcaacatcgagcagaggtacagattgccc
A0A287AIU8_BMF-01      acagccccccgaagggcagtggcaacatcgagcagaggtacagattgccc
                       **************************************************

A0A287AIU8_BMF-02      gaaaacttcagtgcattgcagaccagttccatcggcttcatatgcagcag
A0A287AIU8_BMF-01      gaaaacttcagtgcattgcagaccagttccatcggcttcatatgcagcag
                       **************************************************

A0A287AIU8_BMF-02      caccagcagaaccaaaatcgtgtgtggtggcaaatcctcctgtttctaca
A0A287AIU8_BMF-01      caccagcagaaccaaaatcgtgtgtggtggcaaatcctcctgtttctaca
                       **************************************************

A0A287AIU8_BMF-02      caacctcgctttgcatggagatgagaacaggaatggggcaggtcccaggt
A0A287AIU8_BMF-01      caacctcgctttgcatggagatgagaacaggaatggggcaggtcccaggt
                       **************************************************

A0A287AIU8_BMF-02      ga
A0A287AIU8_BMF-01      ga
                       **

© 1998-2020Legal notice