Dataset for CDS BMF of organism Sinocyclocheilus rhinocerous

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A673HDR4_BMF-01      atggatgaggatgaggatga----------------tgtg------cgc-
A0A673JJ10_BMF-01      atggatgatgaggaagacgaacagcttcctcactgctgtgaaacaccgct
                       ******** ** ** ** **                ****      *** 

A0A673HDR4_BMF-01      ----aggaagggtctacagcgctggccttcctcccgcgttcagataaagc
A0A673JJ10_BMF-01      aagaaacaagagctcagagaacagagacggcccacgaggagaggtgggac
                           *  *** *   * **  * *      * * ** *   ** *    *

A0A673HDR4_BMF-01      agaccg-----agaca----------gcagggagaccccctctatccccc
A0A673JJ10_BMF-01      aaacggctaacagacacggacgctttgaagacagatcgacgcagactgcc
                       * ** *     *****          * **  *** *  * *   *  **

A0A673HDR4_BMF-01      agcggcatgctgccct-gccgagtg--------------------catgt
A0A673JJ10_BMF-01      agaactgtgctgaattcagcgagagatggagatatggcaccattccagga
                       **     *****   *   **** *                    ** * 

A0A673HDR4_BMF-01      ggagcccagacgctttctctacggtaacacaggactgctgctgctagcgc
A0A673JJ10_BMF-01      agggccaagagcactttttcatggaaatgctggatttc----gttcacac
                        * *** ***    ** *  * ** **  * *** * *    * *  * *

A0A673HDR4_BMF-01      cgcctagccgctctcggcctc----------------------cagacgt
A0A673JJ10_BMF-01      ttccccgcattgttcgaacccgtcccggatagcacacaaaacgcagaaga
                         **  **     ***  * *                      **** * 

A0A673HDR4_BMF-01      ggtt-------ctccggcagaacctgcgcatgatggatccggcggag---
A0A673JJ10_BMF-01      ggacggagggacaccagaagaa---aaggaagatgaacgtgatgtgggaa
                       **         * ** * ****     * * **** *   *  *  *   

A0A673HDR4_BMF-01      --agcgtggagaccctcatcgggcagaagctccagctgatcggagatcag
A0A673JJ10_BMF-01      ttagcgtggagattcagattggacgtaaactgcgtgaaatgggggatcag
                         **********  *  ** ** *  ** ** *     ** ** ******

A0A673HDR4_BMF-01      ttctatcaggagcacat---gatggtgacgc-------------------
A0A673JJ10_BMF-01      tttcagcaggaacatcttcagctggtaatactgatttcagatgagactag
                       **  * ***** **  *   * **** *  *                   

A0A673HDR4_BMF-01      --tcctttacacaaa-----------------agtgttttccg------t
A0A673JJ10_BMF-01      tttcttttcctcaagtctgtggttttcactgcagtggtttctgtcacgat
                         ** *** * ***                  **** **** *      *

A0A673HDR4_BMF-01      gtgc----------------------------------------------
A0A673JJ10_BMF-01      gtgcaatgacatcatcgtctgttatttcaatgctgcatatgcaaatgctc
                       ****                                              

A0A673HDR4_BMF-01      -----------------cgtgtttgttttggccggactgtttcctga---
A0A673JJ10_BMF-01      agtgggagagatgacatcatttttggtttacccgagttatattgtgtttt
                                        * * **** ***  ***   * * *  **    

A0A673HDR4_BMF-01      -------------------
A0A673JJ10_BMF-01      tgttgtagttaaaaactag
                                          

© 1998-2020Legal notice