Dataset for CDS BCL2L11 of organism Sinocyclocheilus rhinocerous

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A673IWZ7_BCL2L11      atggctgacagtacaatattgaagcaaacgctggccaatggcccggcctc
A0A673NIJ7_BCL2L11      --------------------------------------------------

A0A673IWZ7_BCL2L11      gcggggaagcggagagagcgccggtggcggagctgtcttgcgctctgaac
A0A673NIJ7_BCL2L11      --------------------------------------------------

A0A673IWZ7_BCL2L11      actttgacttccctcagccgagcgatggggacccgttaaggggagggatt
A0A673NIJ7_BCL2L11      --------------------------------ccgttaaggggagggatt

A0A673IWZ7_BCL2L11      gccatgtcaaatagtcaccagtcgaggtcaccgatgtcccgaaccttctc
A0A673NIJ7_BCL2L11      tccatgtcgaatagtcaccagtcgaggtcaccgatgtgccgaaccttctc
                         ******* **************************** ************

A0A673IWZ7_BCL2L11      caggtcctctagtggctatttttccgtcgacagcgattctgtgccaagtt
A0A673NIJ7_BCL2L11      caggtcctctagtggctatttttccgtcgacagcgattctgtgccaagtt

A0A673IWZ7_BCL2L11      ccccactaatgcccaatatttccgaagcgcaagacggccaaaatgatgag
A0A673NIJ7_BCL2L11      ccccgctaatgcccaatatttccgaagcgcaagacggccaaaatgatgag
                        **** *********************************************

A0A673IWZ7_BCL2L11      gtatggtctgccgaacctagccaccagcacgtgcagatggcagcacctgt
A0A673NIJ7_BCL2L11      gtatggtttgccgaacctagccaccagcacgcgcagatggcggcacctgt
                        ******* *********************** ********* ********

A0A673IWZ7_BCL2L11      cggagccatggggccggagatggcggtcgctcgggagctgcgccgcattg
A0A673NIJ7_BCL2L11      gggagccatggggccggagatggcggtcgctcgggagctgcggcgcattg
                         ***************************************** *******

A0A673IWZ7_BCL2L11      gagacgagttcaaccgtctgtactgtcagggggccggtgcaggcgggaac
A0A673NIJ7_BCL2L11      gagacgagttcaaccgcctgtactgtcagggggccggtgcaggtgggaac
                        **************** ************************** ******

A0A673IWZ7_BCL2L11      aacgcggcccagctgcgcgctcccaacgaacacgccatcatcatgtggat
A0A673NIJ7_BCL2L11      aacggggcccagctgcgcgctcccaacgaacacgccatcatcatgtggat
                        **** *********************************************

A0A673IWZ7_BCL2L11      gaacgaccttatcggacgtgtagtacagtttttcctgcgaaggagatga
A0A673NIJ7_BCL2L11      gaacgactttatcggacgtgtagtacagtttttcctgcgaagaagatga
                        ******* ********************************** ******

© 1998-2021Legal notice