Dataset for CDS BMF of organism Sinocyclocheilus grahami

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A672RK14_BMF-01      atggatgatgaggaggacgaacagcttcctcactgctgtgaaacaccgct
A0A672JWL9_BMF-01      atggatgaggatgaggatga----------------tgtg------cgc-
A0A672JWL9_BMF-02      atggatgaggatgaggatga----------------tgtg------cgc-
                       ******** ** ***** **                ****      *** 

A0A672RK14_BMF-01      aagaaacaagagctcagagaacagagacgggagaggtggagaggtgggac
A0A672JWL9_BMF-01      ----aggaagggtctacagcac----------------------------
A0A672JWL9_BMF-02      ----aggaagggtctacagcac----------------------------
                           *  *** *   * ** **                            

A0A672RK14_BMF-01      aaacagctaacagacacggacgctttgaagacagatcaacgcagactgcc
A0A672JWL9_BMF-01      --------------------------------------------------
A0A672JWL9_BMF-02      --------------------------------------------------
                                                                         

A0A672RK14_BMF-01      agctctgtgctgaattcagtgagaaacggagatatggcaccattccaggg
A0A672JWL9_BMF-01      ----------------------------------tggccttcctcccgcg
A0A672JWL9_BMF-02      ----------------------------------tggccttcctcccgcg
                                                         ****     *** * *

A0A672RK14_BMF-01      tttagagggagatgcatcatctccctgcagagctgtggatgccaggactg
A0A672JWL9_BMF-01      ttcagataaa----------------gcaga----------ccgagaccg
A0A672JWL9_BMF-02      ttcagataaa----------------gcaga----------ccgagaccg
                       ** ***   *                *****          **  *** *

A0A672RK14_BMF-01      catttggggtta---actgtggaaccgggggccttgcgtcacttactatg
A0A672JWL9_BMF-01      ca----gggataccccctctatgccccagcggcatgctgccctgtcgagt
A0A672JWL9_BMF-02      ca----gggataccccctctatgccccagcggcatgctgccctgtcgagt
                       **    *** **    ** *    **  * * * ***  * **  * *  

A0A672RK14_BMF-01      gcccctggggcctcagaagggccaagagcactttttc-atggaaatgctg
A0A672JWL9_BMF-01      gcatgtggagcc-caga-----------cgctttctctacggtaacacag
A0A672JWL9_BMF-02      gcatgtggagcc-caga-----------cgctttctctacggtaacacag
                       **   *** *** ****           * **** ** * ** **  * *

A0A672RK14_BMF-01      gatttcgtgcacacttccccgcactgtttgaacccctcctggatggcaca
A0A672JWL9_BMF-01      gactgc-tgc-----tgctagcgccgcct-agccgctctcggcctccaga
A0A672JWL9_BMF-02      gactgc-tgc-----tgctagcgccgcct-agccgctctcggcctccaga
                       ** * * ***     * *  ** * *  * * ** ***  **    ** *

A0A672RK14_BMF-01      caaaacgcagaagaggacgaagggagaccagaagaa---aaggaagacga
A0A672JWL9_BMF-01      cgtggttc------------------tccggcagaacctgcgcatgatgg
A0A672JWL9_BMF-02      cgtggttc------------------tccggcagaacctgcgcatgatgg
                       *      *                   ** * ****     * * ** * 

A0A672RK14_BMF-01      acgtgacgtgggaattagtgtggagattcagattggacgtaaactgcgtg
A0A672JWL9_BMF-01      atccggcggag-----agcgtggagaccctcatcgggcagaagctccagc
A0A672JWL9_BMF-02      atccggcggag-----agcgtggagaccctcatcgggcagaagctccagc
                       *   * **  *     ** *******  *  ** ** *  ** ** *   

A0A672RK14_BMF-01      aaatgggggatcagtttcagcagg-----atcatcttcagctggtaagag
A0A672JWL9_BMF-01      tgatcggagatcagttctatcaggagcacatgatgcatcacagaaaccaa
A0A672JWL9_BMF-02      tgatcggagatcagttctatcagg-----acgctcctttacacaa---aa
                         ** ** ********  * ****     *   *      *       * 

A0A672RK14_BMF-01      tgatttcagatgagactagttctctgtggtttt----cattgcagtggtt
A0A672JWL9_BMF-01      aggaaccgggag-----------ccgctgtggtggcgcgtggccgtggcg
A0A672JWL9_BMF-02      gtgttccatgtg-----------ccgtgtttgt----tttggccggactg
                             *    *           * *   *  *      * ** *     

A0A672RK14_BMF-01      tctgtcacgatgtgcaatgacatcatcgtctgttatttcaa--------t
A0A672JWL9_BMF-01      ttctacacg--------------------cttttatttggaagagagccc
A0A672JWL9_BMF-02      ttt--------------------------------------------cct
                       *                                                 

A0A672RK14_BMF-01      gctgcatatgcaaat-----atga
A0A672JWL9_BMF-01      aacgcaagagcaaatcgtaggtga
A0A672JWL9_BMF-02      gactc-tggtctagttgt--ttga
                           *     * * *      ***

© 1998-2020Legal notice