Dataset for CDS BCL2L11 of organism Sarcophilus harrisii

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A7N4NUH6_BCL2L11      atggcaaagcaaccgtcagatctaaattctgagtgtgaccgtgaaggtgg
A0A7N4NUH6_BCL2L11      atggcaaagcaaccgtcagatctaaattctgagtgtgaccgtgaaggtgg
A0A7N4NUH6_BCL2L11      atggcaaagcaaccgtcagatctaaattctgagtgtgaccgtgaaggtgg
A0A7N4NUH6_BCL2L11      atggcaaagcaaccgtcagatctaaattctgagtgtgaccgtgaaggtgg

A0A7N4NUH6_BCL2L11      acaattgcagcctacagaaaggcctactcaacctcaactcagaccagggg
A0A7N4NUH6_BCL2L11      acaattgcagcctacagaaaggcctactcaacctcaactcagaccagggg
A0A7N4NUH6_BCL2L11      acaattgcagcctacagaaaggcctactcaacctcaactcagaccagggg
A0A7N4NUH6_BCL2L11      acaattgcagcctacagaaaggcctactcaacctcaactcagaccagggg

A0A7N4NUH6_BCL2L11      cccctacctctatacaaacacaatatca----------------------
A0A7N4NUH6_BCL2L11      cccctacctctatacaaacacaatatca----------------------
A0A7N4NUH6_BCL2L11      cccctacctctatacaaacacaatatcaaggtaattcaggtgaaggggac
A0A7N4NUH6_BCL2L11      cccctacctctatacaaacacaatatcaaggtaattcaggtgaaggggac

A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      agctgctcacctagcagccctcagggaccgtttgcaccacccactagccc
A0A7N4NUH6_BCL2L11      agctgctcacctagcagccctcagggaccgtttgcaccacccactagccc

A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      tagcccgtttgctaccagatccccacttttcatctttgtaagaagatccc
A0A7N4NUH6_BCL2L11      tagcccgtttgctaccagatccccacttttcatctttgtaagaagatccc

A0A7N4NUH6_BCL2L11      -------------------------------------------agacagg
A0A7N4NUH6_BCL2L11      -------------------------------------------a------
A0A7N4NUH6_BCL2L11      cactgctgcctcgatcttctagtgggtatttctcttttgacacagacagg
A0A7N4NUH6_BCL2L11      cactgctgcctcgatcttctagtgggtatttctcttttgacacagacagg

A0A7N4NUH6_BCL2L11      agtccagcgcctatgagttgtgataaatctacacaaactccaagccctcc
A0A7N4NUH6_BCL2L11      --------------------------------------------------
A0A7N4NUH6_BCL2L11      agtccagcgcctatgagttgtgataaatctacacaaactccaagccctcc
A0A7N4NUH6_BCL2L11      agtccagcgcctatgagttgtgataaatctacacaaactccaagccctcc

A0A7N4NUH6_BCL2L11      ttgtcaagccttcaatcattatctaagtgcaatgggtaagcaagatcatg
A0A7N4NUH6_BCL2L11      -------------------------------------------------g
A0A7N4NUH6_BCL2L11      ttgtcaagccttcaatcattatctaagtgcaatgggtaagcaagatcatg
A0A7N4NUH6_BCL2L11      ttgtcaagccttcaatcattatctaagtgcaatg---------------g

A0A7N4NUH6_BCL2L11      cttccatgaggcagtctcagtcaatacctgcagatatgcgaccagaaatt
A0A7N4NUH6_BCL2L11      cttccatgaggcagtctcagtcaatacctgcagatatgcgaccagaaatt
A0A7N4NUH6_BCL2L11      cttccatgaggcagtctcagtcaatacctgcagatatgcgaccagaaatt
A0A7N4NUH6_BCL2L11      cttccatgaggcagtctcagtcaatacctgcagatatgcgaccagaaatt

A0A7N4NUH6_BCL2L11      tggattgcacaagaattgcgacgtattggagatgaatttaatgcttctta
A0A7N4NUH6_BCL2L11      tggattgcacaagaattgcgacgtattggagatgaatttaatgcttctta
A0A7N4NUH6_BCL2L11      tggattgcacaagaattgcgacgtattggagatgaatttaatgcttctta
A0A7N4NUH6_BCL2L11      tggattgcacaagaattgcgacgtattggagatgaatttaatgcttctta

A0A7N4NUH6_BCL2L11      tccaagaagga----------------------------atgtcattgtc
A0A7N4NUH6_BCL2L11      tccaagaagga----------------------------atgtcattgtc
A0A7N4NUH6_BCL2L11      tccaagaaggggttttttggataataactatcaagcagcagatgatcatc
A0A7N4NUH6_BCL2L11      tccaagaaggg-----------------------------------cagt

A0A7N4NUH6_BCL2L11      accatgtggaagtttacagagagggtgttatcaattgataaata-----c
A0A7N4NUH6_BCL2L11      accatgtggaagtttacagagagggtgttatcaattgataaata-----c
A0A7N4NUH6_BCL2L11      accaaatggttatttt-----acggctattacattacatcatccgccttg
A0A7N4NUH6_BCL2L11      gtggcatggt--ttca-----agagctttgggattgga-----------g
                              ***   **       *  *   *   * *  *            

A0A7N4NUH6_BCL2L11      atcaaagtc--ctatga
A0A7N4NUH6_BCL2L11      atcaaagtc--ctatga
A0A7N4NUH6_BCL2L11      tttggagaatgcagtga
A0A7N4NUH6_BCL2L11      ttggaagtcagctttga
                         *   **    *  ***

© 1998-2022Legal notice