Dataset for CDS BMF of organism Salmo trutta

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A673YQV3_BMF-01      atggacgatgaggaggatgatgtgtttgaaccaga---ctcccactgctg
A0A674EF64_BMF-01      atggatgatgaggaggatgatgtgtttgtgccagactcctcccactgctg
                       ***** **********************  *****   ************

A0A673YQV3_BMF-01      gcgcacagccttcagggagataaagtacgaggacaggggaacccagacac
A0A674EF64_BMF-01      gcgcacagccttcagggaaataaagtacgaggacagaggcacccagacac
                       ****************** ***************** ** **********

A0A673YQV3_BMF-01      ccagccctgtcctgccactgcccaataatatgctgccctgcggggtggcc
A0A674EF64_BMF-01      ccagccctgccctggcactgcccaacgacatgctgccctgtggggtggcc
                       ********* **** **********  * *********** *********

A0A673YQV3_BMF-01      caggagcccagaccactcttctacggcaacgcaggctttcgattgcactt
A0A674EF64_BMF-01      caggagcccagaccactcttctacggcaacgcaggctttcgattgcactt
                       **************************************************

A0A673YQV3_BMF-01      cccagcgcagtttgagcgtgttggagaccaggggcctctgggagag---c
A0A674EF64_BMF-01      tccagcacggtttgagcaggttggagaccaggggcctcaggagcagcatc
                        ***** * ********  ******************* **   **   *

A0A673YQV3_BMF-01      gaggagagcgaggggggatggagaggctcaatcagcagccccagcagcca
A0A674EF64_BMF-01      agggggagcgagggaggatggaacggctt---------ctacagcagcca
                         ** ********* *******  ****          *  *********

A0A673YQV3_BMF-01      gcacgcagcatagagatctgcattggacagaaactccaactcatcggaga
A0A674EF64_BMF-01      gtgcaaagcatggaggtctgcattggacagaaactccaactcatcggaga
                       *  *  ***** *** **********************************

A0A673YQV3_BMF-01      ccagttccaccaagaacacgttcaagtgtatcaccgaaaccaaaggaaca
A0A674EF64_BMF-01      ccagttctaccaagaacaccttcaactgtatcaccgaaaccaaaggaaca
                       ******* *********** ***** ************************

A0A673YQV3_BMF-01      tgaggcccttgtggaggcgcctggcctcggctctgctcaccctgctgttt
A0A674EF64_BMF-01      tgaggcccttgtggtggcgcctggcctcagctctgttcaccctgctgttt
                       ************** ************* ****** **************

A0A673YQV3_BMF-01      gagcaggaggccatcgctggaggggagagagcagggtggaggtga
A0A674EF64_BMF-01      gagcaggaggccatcgctggaagggggagagcagggtggaggtga
                       ********************* *** *******************

© 1998-2020Legal notice