Dataset for CDS classical BH3-containing proteins of organism Salarias fasciatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A672HG10_BMF-01      atggacgatgag---------gaggatgatgtgtttgagccagacccacg
A0A672JQ68_BAD-01      atggctgcaaagttctcaatttcagacagtgagtccgagc----------
                       ****  *   **            **   ** **  ****          

A0A672HG10_BMF-01      ctgctggcgcacagcattcagggagataaagtgcgaag-----accgggg
A0A672JQ68_BAD-01      --------------catccgaggaggtagaagaggaagaaaccaacgaaa
                                     *** *  **** ** *    ****     * **   

A0A672HG10_BMF-01      cac--gcagac--gcctggccctgtcctggtgcccaacaacggcatgctg
A0A672JQ68_BAD-01      caccagcagatcagcgtgtccgt-----------------cggcgtcttg
                       ***  *****   ** ** ** *                 **** *  **

A0A672HG10_BMF-01      ccctgtggagtcgcagaggaacccagaccactcttctacggtaac-----
A0A672JQ68_BAD-01      acctcag----cttaaatgaattcaacctg-------acagcgactggtc
                        ***  *    *  * * ***  **  *         ** *  **     

A0A672HG10_BMF-01      ---gcaggttt---tcgattgcacttcccggcacacttt---gagcttgt
A0A672JQ68_BAD-01      ggatcaggcttaactcggagtcaatcgcttccacagtctccagagac---
                           **** **   ***    ** *  *   **** * *   ***     

A0A672HG10_BMF-01      gggggatcaccgagtgagg--cggagagaaagcga--agagcagcaga--
A0A672JQ68_BAD-01      -gaggagctccaggccagggccgaagaggaggtgggcacacccacagagg
                        * *** * **  *  ***  ** **** * * *   * * *  ****  

A0A672HG10_BMF-01      -----------acgggatgg-----atcagctgccccggcagcggcctgc
A0A672JQ68_BAD-01      gcgctccgttcagggggcggtcaaagtcggctcccccggc-----cctgt
                                  * ***  **      ** *** *******     **** 

A0A672HG10_BMF-01      gg--cgcaaagcgtggaggcttgcatcggacagaagctccagctcatagg
A0A672JQ68_BAD-01      gggccgccaagaa---------gta-cggccagaggcttcgaaggatgag
                       **  *** ***           * * *** **** *** *     **  *

A0A672HG10_BMF-01      agaccagtttcac------cgggaacacctgcaactgtatcaccgaaacc
A0A672JQ68_BAD-01      tgatgaattcgacagtttgctggataaaggggagatgaa-----gaagtt
                        **  * **  **      * ***  *   * *  ** *     ***   

A0A672HG10_BMF-01      aaaggaaccagg----------------ggccgctgtggtggcgcctggc
A0A672JQ68_BAD-01      gaggaatccaggccaagccagacagattcaccactctagaagctggtgga
                        * * * *****                  ** ** * *  **   *** 

A0A672HG10_BMF-01      cacaaccctcctcagccttctgtttgatcggggcg----tcatcgccgga
A0A672JQ68_BAD-01      gcta--cctcttcagccaccaggagaccgagggcgagaacaaccaccacg
                          *  **** ******  * *        *****      * * **   

A0A672HG10_BMF-01      ggaggaggaggcggtgcgggacggaggtga
A0A672JQ68_BAD-01      aaaaccacagccatgaccgcaccgagtag-
                         *     ** *    * * ** ***  * 

© 1998-2020Legal notice