Dataset for CDS BBC3 of organism Saimiri boliviensis boliviensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6STD6_BBC3-01      atgaaatgtggcatggggtctgcctgggcatgtccatgccaagtgcccag
A0A2K6STD6_BBC3-02      atgaaatgtggcatggggtctgcctgggcatgtccatgccaagtgcccag
                        **************************************************

A0A2K6STD6_BBC3-01      ggcttcttccttgacgtgggtcccctgccagatgtgt-------------
A0A2K6STD6_BBC3-02      ggcttcttccttgacgtgggtcccctgccagatgtgtggttctcagccct
                        *************************************             

A0A2K6STD6_BBC3-01      --------------------------------------------------
A0A2K6STD6_BBC3-02      cgctctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccg
                                                                          

A0A2K6STD6_BBC3-01      --------------------------------------------------
A0A2K6STD6_BBC3-02      ggggccctggcgggcggtcccacccaggcggccccgggagtccgcgggga
                                                                          

A0A2K6STD6_BBC3-01      --------------------------------------------------
A0A2K6STD6_BBC3-02      ggaggagcagtgggctcgggagatcggggcccagctgcggcggatggcgg
                                                                          

A0A2K6STD6_BBC3-01      ----------------------------gagacaagaagagcagccgcaa
A0A2K6STD6_BBC3-02      acgacctcaacgcgcagtacgagcggcggagacaagaagagcagccgcaa
                                                    **********************

A0A2K6STD6_BBC3-01      caccgcccctcaccctggagggtcctgtacaatctcatcatgggactcct
A0A2K6STD6_BBC3-02      caccgcccctcaccctggagggtcctgtacaatctcatcatgggactcct
                        **************************************************

A0A2K6STD6_BBC3-01      gccctttcccaggggccacagagccccagagatggagcccaattaggtgc
A0A2K6STD6_BBC3-02      gccctttcccaggggccacagagccccagagatggagcccaattag----
                        **********************************************    

A0A2K6STD6_BBC3-01      ctgcacccgcccggtggacgtcagggactcggggggcaggcccctcccac
A0A2K6STD6_BBC3-02      --------------------------------------------------
                                                                          

A0A2K6STD6_BBC3-01      ctcctgacaccctggccagcgcgggggactttctctgcaccatgtag
A0A2K6STD6_BBC3-02      -----------------------------------------------
                                                                       

© 1998-2020Legal notice