Dataset for CDS classical BH3-containing proteins of organism Rhinopithecus bieti

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6KJF1_PMAIP1-      atg------------------------------------cctggaaagaa
A0A2K6KJF1_PMAIP1-      atg------------------------------------cctggaaagaa
A0A2K6MCW0_BIK-01       atg------------tctggagtaagacccgtctccagagacatcttgat
A0A2K6KJP8_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtg-----accgagaa
A0A2K6KJP8_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtg-----accgagaa
A0A2K6L919_BMF-01       atggagcc----------------atctcggtgtgtg-----gaggagct
A0A2K6L919_BMF-03       atggagcc----------------atctcggtgtgtg-----gaggagct
A0A2K6L919_BMF-02       atggagcc----------------atctcggtgtgtg-----gaggagct
A0A2K6KS56_BBC3-02      ------------------------------------------------ct
A0A2K6N196_BAD-01       atgttccag---------------atcccagagtttgagcctagtgagca
A0A2K6N196_BAD-02       atgttccag---------------atcccagagtttgagcctagtgagca
                                                                          

A0A2K6KJF1_PMAIP1-      ggcgc---------gcaagaacgcgcaa-----c----------------
A0A2K6KJF1_PMAIP1-      ggcgc---------gcaagaacgcgcaa-----c----------------
A0A2K6MCW0_BIK-01       ggagaccctcctgtatgagcagctcctggaacccctaaccatggaggttc
A0A2K6KJP8_BCL2L11      ggtag---------acaa----ttgcag-----cctgcggagaggcctcc
A0A2K6KJP8_BCL2L11      ggtag---------acaa----ttgcag-----cctgcggagaggcctcc
A0A2K6L919_BMF-01       ggagg---------atgatgtgttccag-----ccggaggacggggagcc
A0A2K6L919_BMF-03       ggagg---------atgatgtgttccag-----ccggaggacggggagcc
A0A2K6L919_BMF-02       ggagg---------atgatgtgttccag-----ccggaggacggggagcc
A0A2K6KS56_BBC3-02      ggcgg---------a-------gcgcac-----ct---------ggagtc
A0A2K6N196_BAD-01       ggaag---------a-------ctccag-----ctctgcagagaggggcc
A0A2K6N196_BAD-02       ggaag---------a-------ctccag-----ctctgcagagaggggcc
                        **                       *       *                

A0A2K6KJF1_PMAIP1-      ---------cgagcccag-------------cgcgggctcaggcag----
A0A2K6KJF1_PMAIP1-      ---------cgagcccag-------------cgcgggctcaggcaggacc
A0A2K6MCW0_BIK-01       ttggtgtgactgaccctgaagagga------cctggaccctatgga----
A0A2K6KJP8_BCL2L11      ccagct---cagacctgg----------------ggcccctacc------
A0A2K6KJP8_BCL2L11      ccagct---cagacctgg----------------ggcccctacc------
A0A2K6L919_BMF-01       gggggc---ccaacctgggag----------ctcgctctctgccgatctg
A0A2K6L919_BMF-03       gggggc---ccaacctgggag----------ctcgctctctgccgatctg
A0A2K6L919_BMF-02       gggggc---ccaacctgggag----------ctcgctctctgccgatctg
A0A2K6KS56_BBC3-02      gcggtg---ccagccccg----------------gggccctggc------
A0A2K6N196_BAD-01       tgggcc---ccagcccggcaggggacaggccctcagactccggcaa----
A0A2K6N196_BAD-02       tgggcc---ccagcccggcaggggacaggccctcagactccggcaa----
                                 *   **  *                   * *          

A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      tgcagggacggcagggacggcgagggaccaagccggattagggatt----
A0A2K6MCW0_BIK-01       ---------------------------------ggacttcgatcctttgg
A0A2K6KJP8_BCL2L11      ----------------------tccctacagacagaaccacaaggtaa--
A0A2K6KJP8_BCL2L11      ----------------------tccctacagacagaaccaca--------
A0A2K6L919_BMF-01       tttgcccagagcctacttgactgccccctcagccgacttcagctcttc--
A0A2K6L919_BMF-03       tttgcccagagcctacttgactgccccctcagccgacttcagctcttc--
A0A2K6L919_BMF-02       tttgcccagagcctacttgactgccccctcagccgacttcagctcttc--
A0A2K6KS56_BBC3-02      ----------------------------------ggccccgggagt----
A0A2K6N196_BAD-01       ----------------------gcatcatcgccaggccccaggcct----
A0A2K6N196_BAD-02       ----------------------gcatcatcgccaggccccaggcct----
                                                                          

A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------gggatgcagctgcatttcaccaga
A0A2K6MCW0_BIK-01       agtgtatggaggacagtgacatgttggccctgcggctggcctgcatcggg
A0A2K6KJP8_BCL2L11      --tcccgaagacaatcacggaggtgaaggggacagctgcccccacggcag
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6L919_BMF-01       --cctctcacccactgctgtggccctggccttcgacccaccagcca--gg
A0A2K6L919_BMF-03       --cctctcacccactgctgtggccctggccttcgacccaccagcca--gg
A0A2K6L919_BMF-02       --cctctcacccactgctgtggccctggccttcgacccaccagcca--gg
A0A2K6KS56_BBC3-02      ----------------------------cgcgggg-------------ag
A0A2K6N196_BAD-01       ----------------------------cctgtgggacgccagtcaccag
A0A2K6N196_BAD-02       ----------------------------cctgtgggacgccagtcaccag
                                                                          

A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      ggcaaaaagctcctctcctcctccccacttgcccttccg-----------
A0A2K6MCW0_BIK-01       gatgagatggacgtgagcctcagggccccgcgcct---------------
A0A2K6KJP8_BCL2L11      ccctcagggcccgctggccccaccggccagccctggccc-----------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6L919_BMF-01       aagacaaggctacccagaccctcggcccagcctccccca---------gc
A0A2K6L919_BMF-03       aagacaaggctacccagaccctcggcccagcctccccca---------gc
A0A2K6L919_BMF-02       aagacaaggctacccagaccctcggcccagcctccccca---------gc
A0A2K6KS56_BBC3-02      gaggcgaagtgggccgg----------gaa--------------------
A0A2K6N196_BAD-01       caggagcagccaaccag----------cagcagccatca-----------
A0A2K6N196_BAD-02       caggagcagccaaccag----------cagcagccatcatggagggagag
                                                                          

A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6KJP8_BCL2L11      ---------------------ttttgctaccagatccccgcttttcatct
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6L919_BMF-01       caaggtgttatgctgcct--tgtggggtaactgaggaaccccagcgactg
A0A2K6L919_BMF-03       caaggtgttatgctgcct--tgtggggtaactgaggaaccccagcgactg
A0A2K6L919_BMF-02       caaggtgttatgctgcct--tgtggggtaactgaggaaccccagcgactg
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6N196_BAD-01       --------------------------------------------------
A0A2K6N196_BAD-02       cttggtattatcctgctgaatctgaggactctgaaaatcccagtgcaagg
                                                                          

A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6KJP8_BCL2L11      ttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctct
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6L919_BMF-01       ttttatggcaatgctggctaccggcttcctctccctgccagtttcccggc
A0A2K6L919_BMF-03       ttttatggcaatgctggctaccggcttcctctccctgccagtttcccggc
A0A2K6L919_BMF-02       ttttatggcaatgctggctaccggcttcctctccctgccagtttcccggc
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6N196_BAD-01       --------------------------------------------------
A0A2K6N196_BAD-02       atgctcgcggaagcatcagcagggatgtctgccccagccactgactcaga
                                                                          

A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      ---------------------------cggggccacgaggaacaagtgca
A0A2K6MCW0_BIK-01       ---------------ggcccagctctctgaggtgg--------ccatgca
A0A2K6KJP8_BCL2L11      tttgacacagacaggagcccagcacccatgagttgtgacaaatcaacaca
A0A2K6KJP8_BCL2L11      --------agacaggagcccagcacccatgagttgtgacaaatcaacaca
A0A2K6L919_BMF-01       agtcttgcccatcggggagcagccccccgaagggcagtgg---caacatc
A0A2K6L919_BMF-03       agtcttgcccatcggggagcagccccccgaagggcagtgg---caacatc
A0A2K6L919_BMF-02       agtcttgcccatcggggagcagccccccgaagggcagtgg---caacatc
A0A2K6KS56_BBC3-02      --------------------------tcggggcccagctg---cggcgga
A0A2K6N196_BAD-01       --------------------------tggaggcgctgggg---ctgtgga
A0A2K6N196_BAD-02       agcccaactcgcagagaatgtaaagctggaggcgctgggg---ctgtgga
                                                                          

A0A2K6KJF1_PMAIP1-      ---agctcgaagtcgagtgtgctact-------------caactcaggag
A0A2K6KJF1_PMAIP1-      agtagctcgaagtcgagtgtgctact-------------caactcaggag
A0A2K6MCW0_BIK-01       ---cagcctaggtctggctttcatctacgaccagaccgacgacatcaggg
A0A2K6KJP8_BCL2L11      ---aaccccaagtcctccttg---ccaggccttcaaccactatctcagtg
A0A2K6KJP8_BCL2L11      ---aaccccaagtcctccttg---ccaggccttcaaccactatctcagtg
A0A2K6L919_BMF-01       ---gagcagaggtacagattg---cc----------cgaaagcttcagtg
A0A2K6L919_BMF-03       ---gagcagaggtacagattg---cc----------cgaaagcttcagtg
A0A2K6L919_BMF-02       ---gagcagaggtacagattg---cc----------cgaaagcttcagtg
A0A2K6KS56_BBC3-02      ---tggc--gaga-----------cg----------actcaac----gcg
A0A2K6N196_BAD-01       ---gacccggagt-----------cg----------ccacagctcctacc
A0A2K6N196_BAD-02       ---gacccggagt-----------cg----------ccacagctcctacc
                                   *            *                         

A0A2K6KJF1_PMAIP1-      atttgg-------------agac----------------aaactgaactt
A0A2K6KJF1_PMAIP1-      atttgg-------------agac----------------aaactgaactt
A0A2K6MCW0_BIK-01       atgttcttacaagtttcatggacggcttcaccacccttaaggagaa----
A0A2K6KJP8_BCL2L11      caatgg-------cttccaggaggc--------------aggctgaacct
A0A2K6KJP8_BCL2L11      caatggtagtcatcctagaggatat--------------agg-tgatact
A0A2K6L919_BMF-01       cattgc-------------agacca--------------gttccac----
A0A2K6L919_BMF-03       cattgc-------------agacca--------------gttccac----
A0A2K6L919_BMF-02       cattgc-------------agacca--------------gttccac----
A0A2K6KS56_BBC3-02      cagtac-------------agacgg--------------cgga-ga----
A0A2K6N196_BAD-01       ccgcgg-------------ggacgg--------------aggagga----
A0A2K6N196_BAD-02       ccgcgg-------------ggacgg--------------aggagga----
                                            **                            

A0A2K6KJF1_PMAIP1-      ccggcagaaacttttgaatctgatagccaaactcttctgctcaggaacct
A0A2K6KJF1_PMAIP1-      ccggcagaaacttttgaatctgatagccaaactcttctgctcaggaacct
A0A2K6MCW0_BIK-01       -cataatgaggttctggag-atccctgaatcccgggtcccaggtgtcccg
A0A2K6KJP8_BCL2L11      gcagatatgcgcccgga--gatacggatcgcccaagagttgcg-gcgaat
A0A2K6KJP8_BCL2L11      tcat-tgtg-gtttggatttatatttactggcttagatttgtatgtggtt
A0A2K6L919_BMF-01       -cggcttcatgtgcagcaacaccagcagaaccgaaatcgcgtgtggtggc
A0A2K6L919_BMF-03       -cggcttcatgtgcagcaacaccagcagaaccgaaatcgcgtgtggtggc
A0A2K6L919_BMF-02       -cggcttcatgtgcagcaacaccagcagaaccgaaatcgcgtgtggtggc
A0A2K6KS56_BBC3-02      -ca-----agagga-gcagcagcgacaccgcccctcgccctggagggtcc
A0A2K6N196_BAD-01       -cg-----aagggatggaggaggagcccagcccctttc------ggggc-
A0A2K6N196_BAD-02       -cg-----aagggatggaggaggagcccagcccctttc------ggggc-
                         *             *               *            *     

A0A2K6KJF1_PMAIP1-      ga------------------------------------------------
A0A2K6KJF1_PMAIP1-      gactgcatcaaaaacttgcataaggggactccaaacgagaatttttctca
A0A2K6MCW0_BIK-01       cgaacaggtgctgctggcgctgctgctgct---gctggcggcgctgctca
A0A2K6KJP8_BCL2L11      cggagacgagtttaacgcttacta-tgcaaggaggttagagaa-------
A0A2K6KJP8_BCL2L11      tgga-------tttatatttaccaccacagtcaagatacagaacaactca
A0A2K6L919_BMF-01       agatcctcctcttcctgcacaaccttgctttgaatggagaagagaatagg
A0A2K6L919_BMF-03       agatcctcctcttcctgcacaaccttgctttgaatggagaagagaatagg
A0A2K6L919_BMF-02       agatcctcctcttcctgcacaaccttgctttgaatggagaagagaatagg
A0A2K6KS56_BBC3-02      tgtacaatctcattatgggactcctgcccttacccaggggccaca-----
A0A2K6N196_BAD-01       ----cgctcgcgctccgcgccccctaacct---ctgggcagcacagcgat
A0A2K6N196_BAD-02       ----cgctcgcgctccgcgccccctaacct---ctgggcagcacagcgat
                                                                          

A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      ggaggtgcacgtttcat---------------------------------
A0A2K6MCW0_BIK-01       gcgggggcctgcacctg---------------------------------
A0A2K6KJP8_BCL2L11      ----------------a---------------------------------
A0A2K6KJP8_BCL2L11      accacagggatttctca---------------------------------
A0A2K6L919_BMF-01       aacggggcgggccctag---------------------------------
A0A2K6L919_BMF-03       aacggggcgggccctag---------------------------------
A0A2K6L919_BMF-02       aacggggcgggccctaggcccttgacctggaatgggggccgttgtcaaac
A0A2K6KS56_BBC3-02      --------gagcccccg-----------aaatgga---------------
A0A2K6N196_BAD-01       atggccgcgagctccgg-----------aggatgagtgacgagtttgtgg
A0A2K6N196_BAD-02       atggccgcgagctccgg-----------aggatga---------------
                                                                          

A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      -caatttgaagaaagattgcattgtaattgg-------------------
A0A2K6MCW0_BIK-01       -------------------ctgctcaagtga-------------------
A0A2K6KJP8_BCL2L11      ----------------------------tag-------------------
A0A2K6KJP8_BCL2L11      ----------------------------tga-------------------
A0A2K6L919_BMF-01       ---------------------------gtga-------------------
A0A2K6L919_BMF-03       ---------------------------gtga-------------------
A0A2K6L919_BMF-02       actgttgaaggggaggctgatgtgtctgtga-------------------
A0A2K6KS56_BBC3-02      ---------------------gcccaattag-------------------
A0A2K6N196_BAD-01       actcctttaagggacttcctcgcccgaagagcgcgggcacagcgacgcag
A0A2K6N196_BAD-02       --------------------------------------------------
                                                                          

A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6L919_BMF-01       --------------------------------------------------
A0A2K6L919_BMF-03       --------------------------------------------------
A0A2K6L919_BMF-02       --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6N196_BAD-01       atgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcg
A0A2K6N196_BAD-02       --------------------------------------------------
                                                                          

A0A2K6KJF1_PMAIP1-      -------------------------------------
A0A2K6KJF1_PMAIP1-      -------------------------------------
A0A2K6MCW0_BIK-01       -------------------------------------
A0A2K6KJP8_BCL2L11      -------------------------------------
A0A2K6KJP8_BCL2L11      -------------------------------------
A0A2K6L919_BMF-01       -------------------------------------
A0A2K6L919_BMF-03       -------------------------------------
A0A2K6L919_BMF-02       -------------------------------------
A0A2K6KS56_BBC3-02      -------------------------------------
A0A2K6N196_BAD-01       gaacttgggcaggggaagctccgccccctcccagtga
A0A2K6N196_BAD-02       -------------------------------------
                                                             

© 1998-2020Legal notice