Dataset for CDS classical BH3-containing proteins of organism Rhinopithecus bieti

[Download (right click)] [Edit] [Sequences] [Repertoires]

20 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6KJF1_PMAIP1-      atg---------------------cctgga-------------------a
A0A2K6KJF1_PMAIP1-      atg---------------------cctgga-------------------a
A0A2K6MCW0_BIK-01       atg---------------------tctggagtaagaccc----gtctcca
A0A2K6KJM8_BCL2L11      atggcaaag---------caaccttctgatgtaagttctgagtgtgaccg
A0A2K6KJM8_BCL2L11      atggcaaag---------caaccttctgatgtaagttctgagtgtgaccg
A0A2K6KJM8_BCL2L11      atggcaaag---------caaccttctgatgtaagttctgagtgtgaccg
A0A2K6KJM8_BCL2L11      atggcaaag---------caaccttctgatgtaagttctgagtgtgaccg
A0A2K6KJM8_BCL2L11      atggcaaag---------caaccttctgatgtaagttctgagtgtgaccg
A0A2K6KJM8_BCL2L11      atggcaaag---------caaccttctgatgtaagttctgagtgtgaccg
A0A2K6KJM8_BCL2L11      atggcaaag---------caaccttctgatgtaagttctgagtgtgaccg
A0A2K6KJM8_BCL2L11      atggcaaag---------caaccttctgatgtaagttctgagtgtgaccg
A0A2K6KJM8_BCL2L11      atggcaaag---------caaccttctgatgtaagttctgagtgtgaccg
A0A2K6KJM8_BCL2L11      atggcaaag---------caaccttctgatgtaagttctgagtgtgaccg
A0A2K6L919_BMF-01       atggagcca--------------tctcggtgtgtggaggag--ctgg--a
A0A2K6L919_BMF-03       atggagcca--------------tctcggtgtgtggaggag--ctgg--a
A0A2K6L919_BMF-02       atggagcca--------------tctcggtgtgtggaggag--ctgg--a
A0A2K6KS56_BBC3-01      atgccgcgcaccagaggcagctcccccggacccgtagaggg--ctggccg
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6N196_BAD-01       atgttccaga-------------tcccagagtttgagccta--gtgagca
A0A2K6N196_BAD-02       atgttccaga-------------tcccagagtttgagccta--gtgagca

A0A2K6KJF1_PMAIP1-      agaaggcgcgcaagaacgcgcaaccgag----------cc-------cag
A0A2K6KJF1_PMAIP1-      agaaggcgcgcaagaacgcgcaaccgag----------cc-------cag
A0A2K6MCW0_BIK-01       gaga------------catcttgatggagaccct---cctgtatgagcag
A0A2K6KJM8_BCL2L11      agaaggtagacaattgcagcctgcggagaggcct---ccc-------cag
A0A2K6KJM8_BCL2L11      agaaggtagacaattgcagcctgcggagaggcct---ccc-------cag
A0A2K6KJM8_BCL2L11      agaaggtagacaattgcagcctgcggagaggcct---ccc-------cag
A0A2K6KJM8_BCL2L11      agaaggtagacaattgcagcctgcggagaggcct---ccc-------cag
A0A2K6KJM8_BCL2L11      agaaggtagacaattgcagcctgcggagaggcct---ccc-------cag
A0A2K6KJM8_BCL2L11      agaaggtagacaattgcagcctgcggagaggcct---ccc-------cag
A0A2K6KJM8_BCL2L11      agaaggtagacaattgcagcctgcggagaggcct---ccc-------cag
A0A2K6KJM8_BCL2L11      agaaggtagacaattgcagcctgcggagaggcct---ccc-------cag
A0A2K6KJM8_BCL2L11      agaaggtagacaattgcagcctgcggagaggcct---ccc-------cag
A0A2K6KJM8_BCL2L11      agaaggtagacaattgcagcctgcggagaggcct---ccc-------cag
A0A2K6L919_BMF-01       ggatgatgtgttccagccggaggacggggagccgggggcc-------caa
A0A2K6L919_BMF-03       ggatgatgtgttccagccggaggacggggagccgggggcc-------caa
A0A2K6L919_BMF-02       ggatgatgtgttccagccggaggacggggagccgggggcc-------caa
A0A2K6KS56_BBC3-01      cgacgg----ccgtcgccccttcccgctcggcctgtcctg-------cgg
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6N196_BAD-01       ggaaga----ctccagctctgcagagaggggcctgggccc-------cag
A0A2K6N196_BAD-02       ggaaga----ctccagctctgcagagaggggcctgggccc-------cag

A0A2K6KJF1_PMAIP1-      cgc----------------gggct-----------------caggcag--
A0A2K6KJF1_PMAIP1-      cgc----------------gggct-----------------caggcagga
A0A2K6MCW0_BIK-01       ctc-------------ctggaacccctaaccatggaggttcttggtgtga
A0A2K6KJM8_BCL2L11      ctc---------agacctggggcccctacctc-----cctacagacagaa
A0A2K6KJM8_BCL2L11      ctc---------agacctggggcccctacctc-----cctacagacagaa
A0A2K6KJM8_BCL2L11      ctc---------agacctggggcccctacctc-----cctacagacagaa
A0A2K6KJM8_BCL2L11      ctc---------agacctggggcccctacctc-----cctacagacagaa
A0A2K6KJM8_BCL2L11      ctc---------agacctggggcccctacctc-----cctacagacagaa
A0A2K6KJM8_BCL2L11      ctc---------agacctggggcccctacctc-----cctacagacagaa
A0A2K6KJM8_BCL2L11      ctc---------agacctggggcccctacctc-----cctacagacagaa
A0A2K6KJM8_BCL2L11      ctc---------agacctggggcccctacctc-----cctacagacagaa
A0A2K6KJM8_BCL2L11      ctc---------agacctggggcccctacctc-----cctacagacagaa
A0A2K6KJM8_BCL2L11      ctc---------agacctggggcccctacctc-----cctacagacagaa
A0A2K6L919_BMF-01       cct---------------gggagctcgctctctg---ccgatctgtttgc
A0A2K6L919_BMF-03       cct---------------gggagctcgctctctg---ccgatctgtttgc
A0A2K6L919_BMF-02       cct---------------gggagctcgctctctg---ccgatctgtttgc
A0A2K6KS56_BBC3-01      cctctgcgagcccggccggctgccgcccccgctgcccccgccctgctcgc
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6N196_BAD-01       ccc-----------ggcaggggacaggccctcagactccggcaagcatca
A0A2K6N196_BAD-02       ccc-----------ggcaggggacaggccctcagactccggcaagcatca

A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      cctgcag-------------------------------------------
A0A2K6MCW0_BIK-01       ctg--------accctgaagaggacctggaccctatggaggacttcgatc
A0A2K6KJM8_BCL2L11      ccacaag-------------------------------------------
A0A2K6KJM8_BCL2L11      ccacaag-------------------------------------------
A0A2K6KJM8_BCL2L11      ccacaaggtaatcccgaagacaatcacggaggtgaaggggacagctgccc
A0A2K6KJM8_BCL2L11      ccacaaggtaatcccgaagacaatcacggaggtgaaggggacagctgccc
A0A2K6KJM8_BCL2L11      ccacaaggtaatcccgaagacaatcacggaggtgaaggggacagctgccc
A0A2K6KJM8_BCL2L11      ccacaaggtaatcccgaagacaatcacggaggtgaaggggacagctgccc
A0A2K6KJM8_BCL2L11      ccaca---------------------------------------------
A0A2K6KJM8_BCL2L11      ccacaaggtaatcccgaagacaatcacggaggtgaaggggacagctgccc
A0A2K6KJM8_BCL2L11      ccacaaggtaatcccgaagacaatcacggaggtgaaggggacagctgccc
A0A2K6KJM8_BCL2L11      ccacaaggtaatcccgaagacaatcacggaggtgaaggggacagctgccc
A0A2K6L919_BMF-01       ccagagc----ctacttgactgccccctcagccgacttcagctcttccct
A0A2K6L919_BMF-03       ccagagc----ctacttgactgccccctcagccgacttcagctcttccct
A0A2K6L919_BMF-02       ccagagc----ctacttgactgccccctcagccgacttcagctcttccct
A0A2K6KS56_BBC3-01      ccgcctg----ccacctctgcgcccccaccgcccacgccgtcccgcgccg
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6N196_BAD-01       tcgccag--------------------------------gccccaggcct
A0A2K6N196_BAD-02       tcgccag--------------------------------gccccaggcct

A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      -----ggacggcagggacggcgagggaccaagccggattagggattggga
A0A2K6MCW0_BIK-01       ctttggagtgtatggaggacagtgacatgttggccctgcggctggcctgc
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      ccacggcagccctcagggcc--cgctggccccaccggccagccctggccc
A0A2K6KJM8_BCL2L11      ccacggcagccctcagggcc--cgctggccccaccggccagccctggccc
A0A2K6KJM8_BCL2L11      ccacggcagccctcagggcc--cgctggccccaccggccagccctggccc
A0A2K6KJM8_BCL2L11      ccacggcagccctcagggcc--cgctggccccaccggccagccctggccc
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      ccacggcagccctcagggcc--cgctggccccaccggccagccctggccc
A0A2K6KJM8_BCL2L11      ccacggcagccctcagggcc--cgctggccccaccggccagccctggccc
A0A2K6KJM8_BCL2L11      ccacggcagccctcagggcc--cgctggccccaccggccagccctggccc
A0A2K6L919_BMF-01       ctcacccactgctgtggccc--tggccttcgacc-caccagccaggaaga
A0A2K6L919_BMF-03       ctcacccactgctgtggccc--tggccttcgacc-caccagccaggaaga
A0A2K6L919_BMF-02       ctcacccactgctgtggccc--tggccttcgacc-caccagccaggaaga
A0A2K6KS56_BBC3-01      cccc--------tggggcgc--tggcctggtcccgcagccgccccgggcc
A0A2K6KS56_BBC3-02      -------------------c--tggc------------------------
A0A2K6N196_BAD-01       cctg--------tgggacgc--cagtcaccagcaggagcagccaaccagc
A0A2K6N196_BAD-02       cctg--------tgggacgc--cagtcaccagcaggagcagccaaccagc

A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      tgcagctgcat---------------------------------------
A0A2K6MCW0_BIK-01       atcggggatga---------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      ttttgctacca---------------------------------------
A0A2K6KJM8_BCL2L11      ttttgctacca---------------------------------------
A0A2K6KJM8_BCL2L11      ttttgctacca---------------------------------------
A0A2K6KJM8_BCL2L11      ttttgctacca---------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      ttttgctacca---------------------------------------
A0A2K6KJM8_BCL2L11      ttttgctacca---------------------------------------
A0A2K6KJM8_BCL2L11      ttttgctacca---------------------------------------
A0A2K6L919_BMF-01       caaggctaccc---------------------------------------
A0A2K6L919_BMF-03       caaggctaccc---------------------------------------
A0A2K6L919_BMF-02       caaggctaccc---------------------------------------
A0A2K6KS56_BBC3-01      cacgcccggag---------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6N196_BAD-01       agcagccatca---------------------------------------
A0A2K6N196_BAD-02       agcagccatcatggagggagagcttggtattatcctgctgaatctgagga

A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      -------------------------------ttcaccagaggcaaaaagc
A0A2K6MCW0_BIK-01       -----------------------------------------gatggacgt
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      ---------------------gatccccgcttttcatctttatgagaaga
A0A2K6KJM8_BCL2L11      ---------------------gatccccgcttttcatctttatgagaaga
A0A2K6KJM8_BCL2L11      ---------------------gatccccgcttttcatctttatgagaaga
A0A2K6KJM8_BCL2L11      ---------------------gatccccgcttttcatctttatgagaaga
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      ---------------------gatccccgcttttcatctttatgagaaga
A0A2K6KJM8_BCL2L11      ---------------------gatccccgcttttcatctttatgagaaga
A0A2K6KJM8_BCL2L11      ---------------------gatccccgcttttcatctttatgagaaga
A0A2K6L919_BMF-01       -------------------------------------------agaccct
A0A2K6L919_BMF-03       -------------------------------------------agaccct
A0A2K6L919_BMF-02       -------------------------------------------agaccct
A0A2K6KS56_BBC3-01      ------------------------------------------gtgagtgc
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6N196_BAD-01       --------------------------------------------------
A0A2K6N196_BAD-02       ctctgaaaatcccagtgcaaggatgctcgcggaagcatcagcagggatgt

A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      tcctctcctcctccccacttgcccttccgcggggccacgaggaacaagtg
A0A2K6MCW0_BIK-01       gagcctcagggccccgcgcc------tggcccagctctctgaggtggcca
A0A2K6KJM8_BCL2L11      -------------------------------------------------a
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      tcctccctgctgtctcgatcctccagtgggtatttctcttttgacacaga
A0A2K6KJM8_BCL2L11      tcctccctgctgtctcgatcctccagtgggtatttctcttttgacacaga
A0A2K6KJM8_BCL2L11      tcctccctgctgtctcgatcctccagtgggtatttctcttttgacacaga
A0A2K6KJM8_BCL2L11      tcctccctgctgtctcgatcctccagtgggtatttctcttttgacacaga
A0A2K6KJM8_BCL2L11      -----------------------------------------------aga
A0A2K6KJM8_BCL2L11      tcctccctgctgtctcgatcctccagtgggtatttctcttttgacacaga
A0A2K6KJM8_BCL2L11      tcctccctgctgtctcgatcctccagtgggtatttctcttttgacacaga
A0A2K6KJM8_BCL2L11      tcctccctgctgtctcgatcctccagtgggtatttctcttttgacacaga
A0A2K6L919_BMF-01       cggcccagcctcccccagccaaggtgttatgctgccttgtggggtaactg
A0A2K6L919_BMF-03       cggcccagcctcccccagccaaggtgttatgctgccttgtggggtaactg
A0A2K6L919_BMF-02       cggcccagcctcccccagccaaggtgttatgctgccttgtggggtaactg
A0A2K6KS56_BBC3-01      ccgccc--gccccccgggttgataggagtcgggcgcacctggagtcgcgg
A0A2K6KS56_BBC3-02      -----------------------------ggagcgcacctggagtcgcgg
A0A2K6N196_BAD-01       --------------------------------------------------
A0A2K6N196_BAD-02       ctgccc--cagccactgactcagaagcccaactcgcagagaatgtaaagc

A0A2K6KJF1_PMAIP1-      -----agctcgaagtcgagtgtgctactcaac------------------
A0A2K6KJF1_PMAIP1-      caagtagctcgaagtcgagtgtgctactcaac------------------
A0A2K6MCW0_BIK-01       tgcacagcctaggtctggctttcatctacgaccagaccgacga-------
A0A2K6KJM8_BCL2L11      cagg-agcccagc---acccatgagttgtgacaa----atcaacacaaac
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      cagg-agcccagc---acccatgagttgtgacaa----atcaacacaaac
A0A2K6KJM8_BCL2L11      cagg-agcccagc---acccatgagttgtgacaa----atcaacacaaac
A0A2K6KJM8_BCL2L11      cagg-agcccagc---acccatgagttgtgacaa----atcaacacaaac
A0A2K6KJM8_BCL2L11      cagg-agcccagc---acccatgagttgtgacaa----atcaacacaaac
A0A2K6KJM8_BCL2L11      cagg-agcccagc---acccatgagttgtgacaa----atcaacacaaac
A0A2K6KJM8_BCL2L11      cagg-agcccagc---acccatgagttgtgacaa----atcaacacaaac
A0A2K6KJM8_BCL2L11      cagg-agcccagc---acccatgagttgtgacaa----atcaacacaaac
A0A2K6KJM8_BCL2L11      cagg-agcccagc---acccatgagttgtgacaa----atcaacacaaac
A0A2K6L919_BMF-01       agga-accccagc---gactgttttat-----------ggcaatgctggc
A0A2K6L919_BMF-03       agga-accccagc---gactgttttat-----------ggcaatgctggc
A0A2K6L919_BMF-02       agga-accccagc---gactgttttat-----------ggcaatgctggc
A0A2K6KS56_BBC3-01      tgcc-agccccgg---ggccctggcgggcggtccaccaggcgg-------
A0A2K6KS56_BBC3-02      tgcc-agccccgg---ggccct----------------ggcgg-------
A0A2K6N196_BAD-01       tgga-ggcgctgg---ggctgt----------------ggaga-------
A0A2K6N196_BAD-02       tgga-ggcgctgg---ggctgt----------------ggaga-------

A0A2K6KJF1_PMAIP1-      --------------tcaggagatttggagacaaactgaacttccggcaga
A0A2K6KJF1_PMAIP1-      --------------tcaggagatttggagacaaactgaacttccggcaga
A0A2K6MCW0_BIK-01       catcagggatgttcttacaagtttcatggacggcttcaccacccttaagg
A0A2K6KJM8_BCL2L11      cccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtag
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      cccaagtcctccttgccaggccttcaaccactatctcagtgcaatgg---
A0A2K6KJM8_BCL2L11      cccaagtcctccttgccaggccttcaaccactatctcagtgcaat-----
A0A2K6KJM8_BCL2L11      cccaagtcctccttgccaggccttcaaccactatctcagtgcaatgg---
A0A2K6KJM8_BCL2L11      cccaagtcctccttgccaggccttcaaccactatctcagtgcaatgg---
A0A2K6KJM8_BCL2L11      cccaagtcctccttgccaggccttcaaccactatctcagtgcaatgg---
A0A2K6KJM8_BCL2L11      cccaagtcctccttgccaggccttcaaccactatctcagtgcaatgg---
A0A2K6KJM8_BCL2L11      cccaagtcctccttgccaggccttcaaccactatctcagtgcaatgg---
A0A2K6KJM8_BCL2L11      cccaagtcctccttgccaggccttcaaccactatctcagtgcaatgg---
A0A2K6L919_BMF-01       taccggcttcctctccctgccagtttcccggcagtcttgcccatcgggga
A0A2K6L919_BMF-03       taccggcttcctctccctgccagtttcccggcagtcttgcccatcgggga
A0A2K6L919_BMF-02       taccggcttcctctccctgccagtttcccggcagtcttgcccatcgggga
A0A2K6KS56_BBC3-01      --------------ccccgggagtcgc------------------gggga
A0A2K6KS56_BBC3-02      --------------ccccgggagtcgc------------------gggga
A0A2K6N196_BAD-01       --------------ccc--ggagtcgccacagctcctaccccgcggggac
A0A2K6N196_BAD-02       --------------ccc--ggagtcgccacagctcctaccccgcggggac

A0A2K6KJF1_PMAIP1-      aacttttgaatctgatagccaaactcttctgctcaggaacctga------
A0A2K6KJF1_PMAIP1-      aacttttgaatctgatagccaaactcttctgctcaggaacctgactgcat
A0A2K6MCW0_BIK-01       agaacataatgaggttctggagatccctgaatcccgggtcccaggtgtcc
A0A2K6KJM8_BCL2L11      tcatcctagaggatataggtgatactt---cattgtggtttggatttata
A0A2K6KJM8_BCL2L11      ----cttccaggaggcaggctgaacctgcagatatgcgcccgga--gata
A0A2K6KJM8_BCL2L11      ----tt-----------------------------------aga--gaaa
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      ----cttccaggaggcaggctgaacctgcagatatgcgcccgga--gata
A0A2K6KJM8_BCL2L11      ----cttccaggaggcaggctgaacctgcagatatgcgcccgga--gata
A0A2K6KJM8_BCL2L11      ----cttccaggaggcaggctgaacctgcagatatgcgcccgga--gata
A0A2K6KJM8_BCL2L11      ----cttccaggaggcaggctgaacctgcagatatgcgcccgga--gata
A0A2K6KJM8_BCL2L11      ----cttccaggaggcaggctgaacctgcagatatgcgcccgga--gata
A0A2K6KJM8_BCL2L11      ----ctaactgg--------------------------------------
A0A2K6L919_BMF-01       gcagccccccgaagggcagtggcaacatcgagcagaggtacagattgccc
A0A2K6L919_BMF-03       gcagccccccgaagggcagtggcaacatcgagcagaggtacagattgccc
A0A2K6L919_BMF-02       gcagccccccgaagggcagtggcaacatcgagcagaggtacagattgccc
A0A2K6KS56_BBC3-01      ggaggcgaa-gtgggccgg----------gaatcggggcccagc------
A0A2K6KS56_BBC3-02      ggaggcgaa-gtgggccgg----------gaatcggggcccagc------
A0A2K6N196_BAD-01       ggaggaggacgaagggatg----------gaggaggagcccagccccttt
A0A2K6N196_BAD-02       ggaggaggacgaagggatg----------gaggaggagcccagccccttt

A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      caaaaacttgcat----------aaggggactccaaacgagaatttttct
A0A2K6MCW0_BIK-01       cgcgaacaggtgctgctggcgctgctgctgctgctggcggcgctgctcag
A0A2K6KJM8_BCL2L11      ttta-------------------ctggcttagatttgtatgtggttt---
A0A2K6KJM8_BCL2L11      cgga-------------------tcgcccaagagttgcg-gcgaatc---
A0A2K6KJM8_BCL2L11      tag-----------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      cgga-------------------tcgcccaagagttgcg-gcgaatc---
A0A2K6KJM8_BCL2L11      cgga-------------------tcgcccaagagttgcg-gcgaatc---
A0A2K6KJM8_BCL2L11      cgga-------------------tcgcccaagagttgcg-gcgaatc---
A0A2K6KJM8_BCL2L11      cgga-------------------tcgcccaagagttgcg-gcgaatc---
A0A2K6KJM8_BCL2L11      cgga-------------------tcgcccaagagttgcg-gcgaatc---
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6L919_BMF-01       gaaa-------------------gcttcagtgcattgcagaccagttcca
A0A2K6L919_BMF-03       gaaa-------------------gcttcagtgcattgcagaccagttcca
A0A2K6L919_BMF-02       gaaa-------------------gcttcagtgcattgcagaccagttcca
A0A2K6KS56_BBC3-01      tgcg-------------------gcgga------tggcgagacgactcaa
A0A2K6KS56_BBC3-02      tgcg-------------------gcgga------tggcgagacgactcaa
A0A2K6N196_BAD-01       cggg-------------------gccgc------tcgcg------ctccg
A0A2K6N196_BAD-02       cggg-------------------gccgc------tcgcg------ctccg

A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      caggaggtgcacgtttcatcaatttgaagaaagattgcattgtaattgg-
A0A2K6MCW0_BIK-01       cggg---------------------ggcctgcacctgctgctcaagtga-
A0A2K6KJM8_BCL2L11      -----------------ggatttatatttaccac------cacagtcaag
A0A2K6KJM8_BCL2L11      -----------------ggagacgagtttaacgcttactatgcaaggagg
A0A2K6KJM8_BCL2L11      --------------------------------------------aggaag
A0A2K6KJM8_BCL2L11      ------------------------------------------------gg
A0A2K6KJM8_BCL2L11      -----------------ggagacgagtttaacgcttactatgcaaggagg
A0A2K6KJM8_BCL2L11      -----------------ggagacgagtttaacgcttactatgcaaggagg
A0A2K6KJM8_BCL2L11      -----------------ggagacgagtttaacgcttactatgcaaggagg
A0A2K6KJM8_BCL2L11      -----------------ggagacgagtttaacgcttactatgcaaggagg
A0A2K6KJM8_BCL2L11      -----------------ggagacgagtttaacgcttactatgcaaggagg
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6L919_BMF-01       ccggcttca---------------tgtgcagcaacaccagcagaaccgaa
A0A2K6L919_BMF-03       ccggcttca---------------tgtgcagcaacaccagcagaaccgaa
A0A2K6L919_BMF-02       ccggcttca---------------tgtgcagcaacaccagcagaaccgaa
A0A2K6KS56_BBC3-01      cgcgcagtacagacggcggagacaagaggagcagcagcgacaccgc----
A0A2K6KS56_BBC3-02      cgcgcagtacagacggcggagacaagaggagcagcagcgacaccgc----
A0A2K6N196_BAD-01       cgcccccta----------acctctgggcagca-cagcgatatggc----
A0A2K6N196_BAD-02       cgcccccta----------acctctgggcagca-cagcgatatggc----

A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6KJM8_BCL2L11      ataca----------gaacaa-------------------ctcaaccaca
A0A2K6KJM8_BCL2L11      ttg------------gcaaaa-----------------------------
A0A2K6KJM8_BCL2L11      ttgtc----------gtgtag-----------------------------
A0A2K6KJM8_BCL2L11      gtattttt-------gaataa-----------------------------
A0A2K6KJM8_BCL2L11      gtattttt-------gaataattaccaagcagccgaagaccacccacaaa
A0A2K6KJM8_BCL2L11      gtattttt-------gaataattaccaagcagccgaagaccacccacaaa
A0A2K6KJM8_BCL2L11      gtattttt-------gaataattaccaagcagccgaagaccacccacaaa
A0A2K6KJM8_BCL2L11      atgtctcttccacctgattaa-----------------------------
A0A2K6KJM8_BCL2L11      tt---------agagaaatag-----------------------------
A0A2K6KJM8_BCL2L11      ---------------gactag-----------------------------
A0A2K6L919_BMF-01       atcgcgtgtggtggcagatc------------------------------
A0A2K6L919_BMF-03       atcgcgtgtggtggcagatc------------------------------
A0A2K6L919_BMF-02       atcgcgtgtggtggcagatc------------------------------
A0A2K6KS56_BBC3-01      --ccctcgccctggagggtcctgtacaatct---------cattatggga
A0A2K6KS56_BBC3-02      --ccctcgccctggagggtcctgtacaatct---------cattatggga
A0A2K6N196_BAD-01       --cgcgagctccggaggatgagtgacgagtttgtggactcctttaaggga
A0A2K6N196_BAD-02       --cgcgagctccggaggatga-----------------------------

A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6KJM8_BCL2L11      gggatttctcatga------------------------------------
A0A2K6KJM8_BCL2L11      ------------------cttctggcatcctccacctga-----------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      tggttatcttacgactgttgcgttacattgtccgcctggtgtggagaatg
A0A2K6KJM8_BCL2L11      tggttatcttacgactgttgcgttacattgtccgcctggtgtggagaatg
A0A2K6KJM8_BCL2L11      tggttatcttacgactgttgcgttacattgtccgcctggtgtggagaatg
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6L919_BMF-01       ctcctcttcctgcaca--------accttgctttgaatggagaagagaat
A0A2K6L919_BMF-03       ctcctcttcctgcaca--------accttgctttgaatggagaagagaat
A0A2K6L919_BMF-02       ctcctcttcctgcaca--------accttgctttgaatggagaagagaat
A0A2K6KS56_BBC3-01      ctcctgcccttacccaggggccacagagcccccgaaatggagcccaatta
A0A2K6KS56_BBC3-02      ctcctgcccttacccaggggccacagagcccccgaaatggagcccaatta
A0A2K6N196_BAD-01       cttcctcgcccgaagagcgcgggcacagcgacgcagatgcggcaaagctc
A0A2K6N196_BAD-02       --------------------------------------------------

A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      cattga--------------------------------------------
A0A2K6KJM8_BCL2L11      cattga--------------------------------------------
A0A2K6KJM8_BCL2L11      cattga--------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6L919_BMF-01       aggaacggggcgggccctag------------------------------
A0A2K6L919_BMF-03       aggaacggggcgggccctag------------------------------
A0A2K6L919_BMF-02       aggaacggggcgggccctaggcccttgacctggaatgggggccgttgtca
A0A2K6KS56_BBC3-01      ggtgcctgcacccgcccggtggacgtcagggactcggggggcaggcccct
A0A2K6KS56_BBC3-02      g-------------------------------------------------
A0A2K6N196_BAD-01       cagctggacgcgagtcttccagtcctggtgggatcggaacttgg------
A0A2K6N196_BAD-02       --------------------------------------------------

A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6KJM8_BCL2L11      --------------------------------------------------
A0A2K6L919_BMF-01       ------------------------------------------------gt
A0A2K6L919_BMF-03       ------------------------------------------------gt
A0A2K6L919_BMF-02       aacac------------------tgttgaaggggaggctgatgtgtctgt
A0A2K6KS56_BBC3-01      cccacctcctgacaccctggccagcgcgggggactttctctgcaccatgt
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6N196_BAD-01       -----------------------gcaggggaagctccgccccctcccagt
A0A2K6N196_BAD-02       --------------------------------------------------

A0A2K6KJF1_PMAIP1-      --
A0A2K6KJF1_PMAIP1-      --
A0A2K6MCW0_BIK-01       --
A0A2K6KJM8_BCL2L11      --
A0A2K6KJM8_BCL2L11      --
A0A2K6KJM8_BCL2L11      --
A0A2K6KJM8_BCL2L11      --
A0A2K6KJM8_BCL2L11      --
A0A2K6KJM8_BCL2L11      --
A0A2K6KJM8_BCL2L11      --
A0A2K6KJM8_BCL2L11      --
A0A2K6KJM8_BCL2L11      --
A0A2K6KJM8_BCL2L11      --
A0A2K6L919_BMF-01       ga
A0A2K6L919_BMF-03       ga
A0A2K6L919_BMF-02       ga
A0A2K6KS56_BBC3-01      ag
A0A2K6KS56_BBC3-02      --
A0A2K6N196_BAD-01       ga
A0A2K6N196_BAD-02       --

© 1998-2022Legal notice