Dataset for CDS BIK of organism Rattus norvegicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q925D2_BIK-01      ------------------------------------------------------------
Q925D2_BIK-02      atggcgtccgcacctgtctccgcgaggacctgggagttcgcatctgtccctcccttgggg
                                                                               

Q925D2_BIK-01      ---------------------------------------atgtcagaggcgagactaatg
Q925D2_BIK-02      atcctgggatccgtaccgttcctgccgcgatctgaagacatgtcagaggcgagactaatg
                                                          *********************

Q925D2_BIK-01      gccagagacattatcaagactcttctacacgaccaggtcccccaacctgcagtggtctct
Q925D2_BIK-02      gccagagacattatcaagactcttctacacgaccaggtcccccaacctgcagtggtctct
                   ************************************************************

Q925D2_BIK-01      ggggctcccagcatgaaggagcctgtgggggttgaggacgtcagtcctgtgagagacttg
Q925D2_BIK-02      ggggctcccagcatgaaggagcctgtgggggttgaggacgtcagtcctgtgagagacttg
                   ************************************************************

Q925D2_BIK-01      gatttcatgaggtgcctggagagcagaaaccaggtggccctgaggctagcctgcatcggc
Q925D2_BIK-02      gatttcatgaggtgcctggagagcagaaaccaggtggccctgaggctagcctgcatcggc
                   ************************************************************

Q925D2_BIK-01      gatgagatggaccggtgtcttcggagcccccgtctggtccagctgcctgggattgctatg
Q925D2_BIK-02      gatgagatggaccggtgtcttcggagcccccgtctggtccagctgcctgggattgctatg
                   ************************************************************

Q925D2_BIK-01      cacagacttgctgccacctacagccagacgggtgtcagaggtattttcagaagcttgatt
Q925D2_BIK-02      cacagacttgctgccacctacagccagacgggtgtcagaggtattttcagaagcttgatt
                   ************************************************************

Q925D2_BIK-01      ggaagcctcaccaacctcagggaaaatatctggtcctggagagtcttcactcctggcgcc
Q925D2_BIK-02      ggaagcctcaccaacctcagggaaaatatctggtcctggagagtcttcactcctggcgcc
                   ************************************************************

Q925D2_BIK-01      tgggtgtcacctgaccaggaccctgggcagctgtttcccatggtgctgctggtcttcttg
Q925D2_BIK-02      tgggtgtcacctgaccaggaccctgggcagctgtttcccatggtgctgctggtcttcttg
                   ************************************************************

Q925D2_BIK-01      ctgctgggtggggcctggcatttgcagcttcagtga
Q925D2_BIK-02      ctgctgggtggggcctggcatttgcagcttcagtga
                   ************************************

© 1998-2022Legal notice