Dataset for CDS BBC3 of organism Propithecus coquereli

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6FQZ1_BBC3-04      atgaaatttggtgcggggtctgcccgggcatgtccctgccaggtgcccgg
A0A2K6FQZ1_BBC3-01      atg------------------gcccgcgcacgcc----------------
A0A2K6FQZ1_BBC3-02      atgaaatttggtgcggggtctgcccgggcatgtccctgccaggtgcccgg
A0A2K6FQZ1_BBC3-03      atgaaatttggtgcggggtctgcccgggcatgtccctgccaggtgcccgg
                        ***                  ***** *** * *                

A0A2K6FQZ1_BBC3-04      gacttccttctcatggtgggtcctgggccatattcct-------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-02      gacttccttctcatggtgggtcctgggccatattcctggccccagggagc
A0A2K6FQZ1_BBC3-03      gacttccttctcatggtgggtcctgggccatattcct-------------
                                                                          

A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      -------------------aggagggcagctccccggagcccgtagaggg
A0A2K6FQZ1_BBC3-02      gccatggcccgcgcacgccaggagggcagctccccggagcccgtagaggg
A0A2K6FQZ1_BBC3-03      --------------------------------------------------
                                                                          

A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      cctggcccgcgacggcccgcgccccttcccgctcggccgcctggtgccct
A0A2K6FQZ1_BBC3-02      cctggcccgcgacggcccgcgccccttcccgctcggccgcctggtgccct
A0A2K6FQZ1_BBC3-03      --------------------------------------------------
                                                                          

A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      cggccgtgtcctgcggcctctgcgagcccggcctgcccgctgcccccgcc
A0A2K6FQZ1_BBC3-02      cggccgtgtcctgcggcctctgcgagcccggcctgcccgctgcccccgcc
A0A2K6FQZ1_BBC3-03      --------------------------------------------------
                                                                          

A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      gcccccgccctgctacccgctgcctacctctgcgcccccaccgccccgcc
A0A2K6FQZ1_BBC3-02      gcccccgccctgctacccgctgcctacctctgcgcccccaccgccccgcc
A0A2K6FQZ1_BBC3-03      --------------------------------------------------
                                                                          

A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      cgccgtcaccgccgccctggggggcccccgctggcctgggggtccccgca
A0A2K6FQZ1_BBC3-02      cgccgtcaccgccgccctggggggcccccgctggcctgggggtccccgca
A0A2K6FQZ1_BBC3-03      --------------------------------------------------
                                                                          

A0A2K6FQZ1_BBC3-04      --------------------------ggtcctcagccatcactctcgctg
A0A2K6FQZ1_BBC3-01      gccgaccccgaggcccgcgcccggacggtcctcagccatcactctcgctg
A0A2K6FQZ1_BBC3-02      gccgaccccgaggcccgcgcccggacggtcctcagccatcactctcgctg
A0A2K6FQZ1_BBC3-03      --------------------------------------------------
                                                                          

A0A2K6FQZ1_BBC3-04      gcagagcagcacctggagtcgcccgtccccagcgccccgggggccctggc
A0A2K6FQZ1_BBC3-01      gcagagcagcacctggagtcgcccgtccccagcgccccgggggccctggc
A0A2K6FQZ1_BBC3-02      gcagagcagcacctggagtcgcccgtccccagcgccccgggggccctggc
A0A2K6FQZ1_BBC3-03      --------------------------------------------------
                                                                          

A0A2K6FQZ1_BBC3-04      gggcggtcccacccaggcggccccgggagtccggggggaggaggagcagt
A0A2K6FQZ1_BBC3-01      gggcggtcccacccaggcggccccgggagtccggggggaggaggagcagt
A0A2K6FQZ1_BBC3-02      gggcggtcccacccaggcggccccgggagtccggggggaggaggagcagt
A0A2K6FQZ1_BBC3-03      --------------------------------------------------
                                                                          

A0A2K6FQZ1_BBC3-04      gggcccgagagatcggggcccagctgcggcggatggcagacgacctcaat
A0A2K6FQZ1_BBC3-01      gggcccgagagatcggggcccagctgcggcggatggcagacgacctcaat
A0A2K6FQZ1_BBC3-02      gggcccgagagatcggggcccagctgcggcggatggcagacgacctcaat
A0A2K6FQZ1_BBC3-03      --------------------------------------------------
                                                                          

A0A2K6FQZ1_BBC3-04      gcgcagtacgagcggcggagacaagaggagcagcagagacaccgcccctc
A0A2K6FQZ1_BBC3-01      gcgcagtacgagcggcggagacaagaggagcagcagagacaccgcccctc
A0A2K6FQZ1_BBC3-02      gcgcagtacgagcggcggagacaagaggagcagcagagacaccgcccctc
A0A2K6FQZ1_BBC3-03      -----------------gagacaagaggagcagcagagacaccgcccctc
                                         *********************************

A0A2K6FQZ1_BBC3-04      accctggagggtcctgtacaatctcatcatgggactcctgcccttaccca
A0A2K6FQZ1_BBC3-01      accctggagggtcctgtacaatctcatcatgggactcctgcccttaccca
A0A2K6FQZ1_BBC3-02      accctggagggtcctgtacaatctcatcatgggactcctgcccttaccca
A0A2K6FQZ1_BBC3-03      accctggagggtcctgtacaatctcatcatgggactcctgcccttaccca
                        **************************************************

A0A2K6FQZ1_BBC3-04      ggggccacagagcccctgagatggagcccaattag---------------
A0A2K6FQZ1_BBC3-01      ggggccacagagcccctgagatggagcccaattag---------------
A0A2K6FQZ1_BBC3-02      ggggccacagagcccc---gatggagcccaattaggtgcctgcacccgcc
A0A2K6FQZ1_BBC3-03      ggggccacagagcccc---gatggagcccaattaggtgcctgcacccgcc
                        ****************   ****************               

A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-02      tggtggacgtcggagacttggggggcaggaccctcccacctcctgacacc
A0A2K6FQZ1_BBC3-03      tggtggacgtcggagacttggggggcaggaccctcccacctcctgacacc
                                                                          

A0A2K6FQZ1_BBC3-04      ------------------------------------
A0A2K6FQZ1_BBC3-01      ------------------------------------
A0A2K6FQZ1_BBC3-02      ctggccagcacgggggactttttctgcaccatgtag
A0A2K6FQZ1_BBC3-03      ctggccagcacgggggactttttctgcaccatgtag
                                                            

© 1998-2020Legal notice