Dataset for CDS BBC3 of organism Propithecus coquereli

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6FQZ1_BBC3-01      atggcccgcgcacgccaggagggcagctccccggagcccgtagagggcct
A0A2K6FQZ1_BBC3-04      atg-----------------------------aaatttggtgcggggtct
                        ***                               *    **   *** **

A0A2K6FQZ1_BBC3-01      ggcccgcgacggcccgcgccccttcccgctcggccgcctggtgccctcgg
A0A2K6FQZ1_BBC3-04      g--------------------------------------------cccgg
                        *                                            * ***

A0A2K6FQZ1_BBC3-01      ccgtgtcctgcggcctctgcgagcccggcctgcccgctgcccccgccgcc
A0A2K6FQZ1_BBC3-04      gcatgtc---------------------cctgccaggtgccc--------
                         * ****                     ****** * *****        

A0A2K6FQZ1_BBC3-01      cccgccctgctacccgctgcctacctctgcgcccccaccgccccgcccgc
A0A2K6FQZ1_BBC3-04      --------------------------------------------------

A0A2K6FQZ1_BBC3-01      cgtcaccgccgccctggggggcccccgctggcctgggggtccccgcagcc
A0A2K6FQZ1_BBC3-04      -----------------gggacttcc-------------ttctcatggtg
                                         *** *  **             * * *   *  

A0A2K6FQZ1_BBC3-01      gaccccgaggcccgcgcccggacggtcctcagccatcactctcgctggca
A0A2K6FQZ1_BBC3-04      ggtcctgggccatattcc----tggtcctcagccatcactctcgctggca
                        *  ** * * *     **     ***************************

A0A2K6FQZ1_BBC3-01      gagcagcacctggagtcgcccgtccccagcgccccgggggccctggcggg
A0A2K6FQZ1_BBC3-04      gagcagcacctggagtcgcccgtccccagcgccccgggggccctggcggg

A0A2K6FQZ1_BBC3-01      cggtcccacccaggcggccccgggagtccggggggaggaggagcagtggg
A0A2K6FQZ1_BBC3-04      cggtcccacccaggcggccccgggagtccggggggaggaggagcagtggg

A0A2K6FQZ1_BBC3-01      cccgagagatcggggcccagctgcggcggatggcagacgacctcaatgcg
A0A2K6FQZ1_BBC3-04      cccgagagatcggggcccagctgcggcggatggcagacgacctcaatgcg

A0A2K6FQZ1_BBC3-01      cagtacgagcggcggagacaagaggagcagcagagacaccgcccctcacc
A0A2K6FQZ1_BBC3-04      cagtacgagcggcggagacaagaggagcagcagagacaccgcccctcacc

A0A2K6FQZ1_BBC3-01      ctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggg
A0A2K6FQZ1_BBC3-04      ctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggg

A0A2K6FQZ1_BBC3-01      gccacagagcccctgagatggagcccaattag
A0A2K6FQZ1_BBC3-04      gccacagagcccctgagatggagcccaattag

© 1998-2020Legal notice