Dataset for CDS BBC3 of organism Pongo abelii

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H2NZD3_BBC3-01      atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgcccagggcttcttct
H2NZD3_BBC3-02      atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgcccagggcttcttct
                    ************************************************************

H2NZD3_BBC3-01      gcgacgtgggtcccctgccagatttgtggccccagggagcgccatggcccgcgcacggca
H2NZD3_BBC3-02      gcgacgtgggtcccctgccagatttgt---------------------------------
                    ***************************                                 

H2NZD3_BBC3-01      ggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttccc
H2NZD3_BBC3-02      ------------------------------------------------------------
                                                                                

H2NZD3_BBC3-01      gctcggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggccgc
H2NZD3_BBC3-02      ------------------------------------------------------------
                                                                                

H2NZD3_BBC3-01      cgcccccgccgcccccgccctgctgcccgctgcctacctctgcgcccccaccgccccacc
H2NZD3_BBC3-02      ------------------------------------------------------------
                                                                                

H2NZD3_BBC3-01      cgccgtcaccgccgccctggggggcccccgctggccggggggtccccgcagccggccccg
H2NZD3_BBC3-02      ------------------------------------------------------------
                                                                                

H2NZD3_BBC3-01      aggcccgcgcccggacggtcctcagccctcgctctcgctggcggagcagcacctggagtc
H2NZD3_BBC3-02      ----------------ggtcctcagccctcgctctcgctggcggagcagcacctggagtc
                                    ********************************************

H2NZD3_BBC3-01      gcccgtgcccagcgccccgggggctctggcgggcggtcccacccaggcggccccgggagt
H2NZD3_BBC3-02      gcccgtgcccagcgccccgggggctctggcgggcggtcccacccaggcggccccgggagt
                    ************************************************************

H2NZD3_BBC3-01      ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggcggatggcgga
H2NZD3_BBC3-02      ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggcggatggcgga
                    ************************************************************

H2NZD3_BBC3-01      cgacctcaacgcgcagtacgagcggcggagacaagaggagcagcagcggcaccgcccctc
H2NZD3_BBC3-02      cgacctcaacgcgcagtacgagcggcggagacaagaggagcagcagcggcaccgcccctc
                    ************************************************************

H2NZD3_BBC3-01      gccctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacag
H2NZD3_BBC3-02      gccctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacag
                    ************************************************************

H2NZD3_BBC3-01      agcccccgagatggagcccaattaggtgcctgcacccgcccggtggacgtcagggactcg
H2NZD3_BBC3-02      agcccccgagatggagcccaattag-----------------------------------
                    *************************                                   

H2NZD3_BBC3-01      gggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttctctgcacc
H2NZD3_BBC3-02      ------------------------------------------------------------
                                                                                

H2NZD3_BBC3-01      atgtag
H2NZD3_BBC3-02      ------
                          

© 1998-2022Legal notice