Dataset for CDS classical BH3-containing proteins of organism Poecilia reticulata

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3P9Q7C3_BAD-01       --------------------------------------------------
A0A3P9N073_BCL2L11      gacccagcatcgtcagcgcgaacaccacgttcctcgaagcacacagagcg
A0A3P9Q8E2_BMF-01       --------------------------------------------------

A0A3P9Q7C3_BAD-01       -----------------------------------atgga-----cgcaa
A0A3P9N073_BCL2L11      gagctgcgcgccgcaggcgggcgcctccacagccgggggaggaggaggag
A0A3P9Q8E2_BMF-01       -----------------------------------atggaggatgaggag
                                                             ***      * * 

A0A3P9Q7C3_BAD-01       aatttacaatttcagacagcgactctga---gccatcggaagacgtaga-
A0A3P9N073_BCL2L11      gaggaagag-gggagccg--gactcggactcgccgccgtgcaccgtgagc
A0A3P9Q8E2_BMF-01       gatgatgtgtttgagcca--gatcccaact-gctggcgcacgccct----
                         *           ** *   **  *  *   **   **     * *    

A0A3P9Q7C3_BAD-01       --ggaaagaggaaacttg-cagctaatgcaagtaaaggagaggcc-----
A0A3P9N073_BCL2L11      ccggccagtttagacgt--ctttcgaagcaggtcgatatttcgccctccc
A0A3P9Q8E2_BMF-01       tcagggagataaagtgtgaagaccggggcacgcagacgcccggtcct---
                           *  **   *    *          *** *   *      * *     

A0A3P9Q7C3_BAD-01       --------gctcag-----------------tcaacgccacaccctcacg
A0A3P9N073_BCL2L11      cgccgctcgtccagcggatacttctcctttgactgcgactcgctgccgag
A0A3P9Q8E2_BMF-01       --------ggccaggcgctac----------acaacggcatgctg-----
                                *  ***                  *  ** *   *       

A0A3P9Q7C3_BAD-01       cttcctgagctc----cgatctacaacaggtcgggtgagactgaactcgg
A0A3P9N073_BCL2L11      ctccccgctctctccgcacccagtgacg--gctgacaaaaccacgcagac
A0A3P9Q8E2_BMF-01       ------------------ccctgtggtgttgcggaggagcccagacgatt
                                            *          * *   *  *    *    

A0A3P9Q7C3_BAD-01       agtccatcgcttccacca---------------tctccagagagg-----
A0A3P9N073_BCL2L11      ccccagccccaccggccaggtgatgaaccacgccctgcagcgaatggctg
A0A3P9Q8E2_BMF-01       attctacggtaacg--caggttttcgattgcacttcccagcgcat-----
                           *        *   **                   *** *        

A0A3P9Q7C3_BAD-01       ------------------aggagctgcaggccaggggggaagaggaggtc
A0A3P9N073_BCL2L11      tggagcacgaaattcccaag---ctcaatgtgaaaggaaaagaggaaaaa
A0A3P9Q8E2_BMF-01       -----tttgaacttgtcagggattttgacgcgaggcaacaagaggagca-
                                           *    *  * *  *      *******    

A0A3P9Q7C3_BAD-01       gg--gaccccaactgagggctttccatt----cagggtccggtctaattc
A0A3P9N073_BCL2L11      gggggaagagga-ggggcattcgtcattataccaaaaagagaaacaaacc
A0A3P9Q8E2_BMF-01       ----gaacaggatggagcagttacccctgcacc-------------agcc
                            **     *  * *   *   *  *    *             *  *

A0A3P9Q7C3_BAD-01       agctcccccctccctgtgggccgccaagaagtacggccggcagcttcgga
A0A3P9N073_BCL2L11      aacccattttgtcttgtgtcctccca------gtg-----------caac
A0A3P9Q8E2_BMF-01       ggctgcactcagcttggaggcttgca------tcgggcagaagcttcagc
                          *         * **    *   **        *           *   

A0A3P9Q7C3_BAD-01       ggatgagcgatgagttt------------gtcaacctgcttgataaaggg
A0A3P9N073_BCL2L11      tgatgattcagcagttttctcatgcg-acttccatcggtataaaaaaaag
A0A3P9Q8E2_BMF-01       tgataggcgaccagtttcaccgggaacacttacaacagtatcaacaaaac
                         ***     *  *****             *  * * *  * *  **   

A0A3P9Q7C3_BAD-01       gaaatgaggaaggtga-------gcagtgccgggtcgaacggaccgatcc
A0A3P9N073_BCL2L11      aaaaaga----------------gtaggatatgatga--tgattattatc
A0A3P9Q8E2_BMF-01       caaaggaatcaggggccgctgtggtggcgtatgactg--cagctcttctc
                         *** **                *  *     *                *

A0A3P9Q7C3_BAD-01       accactccaggagctggtggagctacctcttcagtcaccaggagacggag
A0A3P9N073_BCL2L11      a-----ttactacatagattgtttcttttt----------aaaatcagta
A0A3P9Q8E2_BMF-01       agcctcctgtttgatagggggtttattgct----------ggaggaggtg
                        *             * *      *     *            *    *  

A0A3P9Q7C3_BAD-01       ggagagaacaaccaccacgaaaaccacgcctcccgcaccgagtag
A0A3P9N073_BCL2L11      agtaaatac-gacgtggcatag-----------------------
A0A3P9Q8E2_BMF-01       gagcaggacggaggtga----------------------------
                            *  **                                    

© 1998-2020Legal notice